ID: 1166017420

View in Genome Browser
Species Human (GRCh38)
Location 19:39993266-39993288
Sequence TAAAATGCTGATAGTGATAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 642
Summary {0: 1, 1: 9, 2: 64, 3: 118, 4: 450}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166017420 Original CRISPR TAAAATGCTGATAGTGATAA CGG Intronic
900894316 1:5472808-5472830 TAAAATGGGGATAATGACAAAGG - Intergenic
901343759 1:8519721-8519743 TAAAATCCTGACTGTGATATGGG - Intronic
901670597 1:10853979-10854001 TGATATGCTGATAGTGGTAGTGG - Intergenic
902556819 1:17251780-17251802 TAAACTGATGATGATGATAATGG - Intronic
902658158 1:17883672-17883694 TACAATGGGGATAATGATAAAGG + Intergenic
903421830 1:23223342-23223364 TAAAATAATGATAATAATAATGG - Intergenic
903434561 1:23336900-23336922 TAAAATGGTAATAATAATAATGG + Intronic
903548158 1:24140167-24140189 TCAAATGGGGATAGTGATAGTGG - Intronic
903801184 1:25969566-25969588 TAAAATGCAGTTAATAATAAAGG + Intronic
904413323 1:30338574-30338596 GATAATGGTGATAGTGATGATGG + Intergenic
904413350 1:30338986-30339008 GATGATGATGATAGTGATAATGG + Intergenic
904413352 1:30339001-30339023 GATAATGGTGATGGTGATAATGG + Intergenic
904768500 1:32868502-32868524 TAAAATGGAGATATTGATAGCGG - Intronic
905379538 1:37551359-37551381 TGAAATGCTGATAAAGATACAGG + Intronic
905582061 1:39089835-39089857 TAAAAGGGAGATGGTGATAAAGG + Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
906955296 1:50369139-50369161 TATAATGATGATAGTGATGATGG + Intergenic
907350156 1:53822787-53822809 AATAATGATGATAATGATAATGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911431418 1:97792636-97792658 TAAAGTGGAGATAATGATAATGG - Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912153299 1:106884689-106884711 TAAAATTCTGATGGAGATTATGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912680915 1:111728254-111728276 TGAAATGATGACAGTGATGATGG + Intronic
913973503 1:143435166-143435188 TAAAATAGGGATAGTGATACTGG + Intergenic
914067891 1:144260773-144260795 TAAAATAAGGATAGTGATACTGG + Intergenic
914111264 1:144705581-144705603 TAAAATAAGGATAGTGATACTGG - Intergenic
915017365 1:152746447-152746469 TGAAAGGATGATGGTGATAATGG - Intronic
915461891 1:156075467-156075489 TATAATGCCCATAGTGATGAAGG + Exonic
916236084 1:162590372-162590394 AAGAATGCTGATAGTCAGAATGG + Exonic
916337330 1:163687846-163687868 TCCAGTGCTAATAGTGATAATGG + Intergenic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
916584580 1:166139503-166139525 TAAAATGGCCATAGTGATAGAGG + Intronic
917745251 1:178000519-178000541 TAAAATGATGATAATAGTAATGG - Intergenic
918200565 1:182262429-182262451 TTGAAGGCTGATAGTGATAAGGG + Intergenic
918965982 1:191348924-191348946 TAAAATGAGGATAGTATTAAAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919557762 1:199081890-199081912 TAAAATGTGGTTAGTGAAAAGGG - Intergenic
920520664 1:206622609-206622631 TAAAATGTTGATTGTGGTGATGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921042418 1:211446730-211446752 GAAAATACTGGTAGTGATACTGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921729293 1:218559233-218559255 TGTAATGATGATAGTGGTAATGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922638705 1:227204636-227204658 TGAAATGCTGTTAGAGATATTGG - Intronic
923319603 1:232817684-232817706 TAACACTCTGATAGTGTTAAAGG - Intergenic
924301806 1:242647029-242647051 TAAATTGCTAAGAGTGATAGTGG - Intergenic
1063012228 10:2035344-2035366 TAAAATGCTGAAATTTCTAATGG - Intergenic
1063151484 10:3340678-3340700 TAAAATGCTGTTATGCATAAAGG - Intergenic
1063211462 10:3884836-3884858 TTAAATGATGATAGTATTAAAGG - Intergenic
1064412805 10:15122133-15122155 AAAAATTCTGATATTGAGAAAGG - Intronic
1065567249 10:27025574-27025596 TAAAATTCTGAAAGTCATCAAGG + Intronic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066626353 10:37409854-37409876 TAATATGGTAAGAGTGATAATGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068298859 10:55112675-55112697 TAACATGCTGATCGTCATATGGG - Intronic
1068341982 10:55716267-55716289 TAAAAAGCTGATGGTCAAAATGG - Intergenic
1068367865 10:56075574-56075596 AAAAATGATGATAATGATGATGG - Intergenic
1069338810 10:67386743-67386765 TGAAATACTGAGAATGATAAAGG + Intronic
1071208013 10:83306052-83306074 TAATATGTTGATGATGATAATGG - Intergenic
1071410720 10:85391199-85391221 TTAAATGCAGATAGCAATAAAGG + Intergenic
1071414606 10:85429366-85429388 GAAATTGCTGATAGGGAAAAGGG - Intergenic
1071512848 10:86275480-86275502 AAATATGCTGAAAGTGGTAAAGG + Intronic
1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG + Intronic
1072395582 10:95036668-95036690 TAATAAGCAGATAGTGACAAAGG - Intergenic
1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1074391284 10:113060181-113060203 AAAAATGCATTTAGTGATAAAGG + Intronic
1074745756 10:116530555-116530577 TAAAATGGTGGTAGAGATGATGG + Intergenic
1075067229 10:119297324-119297346 AATTATGGTGATAGTGATAATGG - Intronic
1076048281 10:127312521-127312543 TAAAATGCTGCATGTTATAAAGG - Intronic
1077379148 11:2220400-2220422 TAAAATGCTGATAGACATGCAGG - Intergenic
1077546696 11:3174388-3174410 TATGATGGTGATAGTGATGATGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078343498 11:10520959-10520981 TACAATGCTGACATTGATAATGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079279396 11:19073780-19073802 TAAAAAGGTGATAGTGATACAGG + Intergenic
1079580572 11:22058386-22058408 TAAAAGGCTCCTATTGATAAAGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079762339 11:24344810-24344832 TAAAAAGCTGAAAGTTAGAAAGG - Intergenic
1079830372 11:25259030-25259052 TAAAACTCTGATGGTGATACAGG + Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080729080 11:34929893-34929915 TCAAATGCTGATAGTTACATTGG + Intronic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081554809 11:44148802-44148824 GATGATGCTGATAGTGATGATGG + Intronic
1081830668 11:46110221-46110243 TAAAATGGGGATAATAATAAGGG - Intronic
1081844058 11:46225639-46225661 TAGAAAGCTGCTAGTGATAGGGG - Intergenic
1082018126 11:47508018-47508040 TTAAATGGTCATAATGATAAAGG - Intronic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1084738804 11:71124228-71124250 TGGTATGATGATAGTGATAATGG + Intronic
1085706609 11:78792049-78792071 TAAAATGAGGAGAGTAATAATGG + Intronic
1085862316 11:80248730-80248752 TAAAATGGAGATAGAGAGAATGG - Intergenic
1085863935 11:80266043-80266065 TATAATGATGATAGAGATAATGG + Intergenic
1086756129 11:90564525-90564547 TAAAATACTTCTAGAGATAATGG + Intergenic
1086772671 11:90788192-90788214 TAAAATCTTGCTAGAGATAAAGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088412526 11:109550886-109550908 GATACTGATGATAGTGATAATGG + Intergenic
1088563874 11:111146877-111146899 TAAAAAGTTGATATTGATATAGG + Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090689680 11:129166282-129166304 TAAATTGATGACAGAGATAAGGG + Intronic
1092278810 12:7083440-7083462 TGTAATGGTGATAGTGATGATGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095319215 12:40805584-40805606 TAAAATGCTAACAGATATAAAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095610141 12:44118450-44118472 TCAACTGCTGAAAATGATAAAGG + Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097451813 12:59745396-59745418 TACAATGATGATAATGACAATGG + Intronic
1097487688 12:60226326-60226348 AAAAATGCTCAAAGAGATAAAGG + Intergenic
1097540340 12:60935368-60935390 TCAAATGCTGATTGTGGTCATGG + Intergenic
1097605741 12:61751373-61751395 AAAAATGCTGCTTGTGAAAATGG - Intronic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1098859671 12:75693893-75693915 TATAATGCTGATGGTGACAGTGG - Intergenic
1098896949 12:76073940-76073962 GAAAATGCTGAGCATGATAATGG - Intronic
1099260287 12:80372108-80372130 TTAATTGCTCATAGTGATTATGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100778885 12:98002776-98002798 TAAAATGCTGTTACTGACATTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102354449 12:112221200-112221222 TAAAGTGTTGGTAGTGAAAACGG + Intronic
1102514716 12:113438650-113438672 TAAAATGGGGATGGTAATAATGG - Intergenic
1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG + Intronic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104274542 12:127313140-127313162 TAAAATGCTGAAATTCAAAAGGG + Intergenic
1104421474 12:128639354-128639376 GAAGATGATGATGGTGATAATGG + Intronic
1104974155 12:132544743-132544765 GACAATGGTGATAGTGATTATGG + Intronic
1105283085 13:18980972-18980994 GAAAATGCTAAGAGTAATAATGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105634027 13:22200014-22200036 AAAAATGGTGATGGTGATGATGG + Intergenic
1105671551 13:22623173-22623195 TAACATGCTAATAGTTCTAATGG - Intergenic
1108085300 13:46783184-46783206 AAAAGTGCTGATAGTGAGAGAGG - Intronic
1109182470 13:59230408-59230430 TAAAATGGGGAGAATGATAACGG - Intergenic
1109254310 13:60060347-60060369 TAAAATGCTCACAGTGGTTATGG + Intronic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109487254 13:63042444-63042466 AAAAATGCTGATAGTCTTTATGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110381398 13:74855685-74855707 GACAATGGTGATAATGATAATGG + Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111580551 13:90217454-90217476 GAAAATGATGATAGGGATGACGG + Intergenic
1112225923 13:97539934-97539956 TAAAATTCAGAAAGTGATTAAGG - Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1112893166 13:104264056-104264078 TAAATTTCTGCTAATGATAATGG - Intergenic
1113845928 13:113391528-113391550 TAAAATCCTGATTGTAATAAAGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1115401660 14:32968455-32968477 TAAAATTCTGAAGGTGATATAGG + Intronic
1115935711 14:38549832-38549854 ACATATGCTGATTGTGATAATGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116459506 14:45156131-45156153 TAAAGTGATGATGGAGATAAGGG + Intronic
1116618500 14:47168794-47168816 TAAAATGCTAATAAGGCTAATGG + Intronic
1116650220 14:47581175-47581197 TCAAATGCAGAAAGTAATAAAGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1119534327 14:75390296-75390318 TGAAATGCAGATTGTGACAAAGG + Intergenic
1119691966 14:76680234-76680256 TAAAATGGTGAAAGTGTTACAGG - Intergenic
1119783182 14:77292304-77292326 TGAAATGCTGATGCTGAAAATGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1123984606 15:25634057-25634079 GAGAATGATGACAGTGATAAAGG + Intergenic
1124009587 15:25826814-25826836 AATAATGATGATAATGATAATGG + Intronic
1124173680 15:27402386-27402408 TAAAATGCTGATATCCATAGAGG - Intronic
1124988978 15:34651836-34651858 GATGATGATGATAGTGATAAAGG + Intergenic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1126224004 15:46248702-46248724 TAATATGATTATTGTGATAATGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1129356169 15:74993585-74993607 TAAAATAAGGATGGTGATAATGG - Intronic
1130633350 15:85592404-85592426 TATAATGCTGATATTCAAAATGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1130828870 15:87579141-87579163 GAAGATGCAGATAGTGAAAAAGG - Intergenic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1132049951 15:98599181-98599203 TAAAATGGGCATAGTGATGATGG - Intergenic
1133142328 16:3755732-3755754 TAAAATGTTTCTATTGATAAAGG + Intronic
1133705028 16:8346313-8346335 TAATATCCTGATAGTGTCAAGGG + Intergenic
1134193600 16:12141344-12141366 GTAAATGCTGGTAGTGCTAATGG + Intronic
1134307864 16:13049531-13049553 TGAATTGCTGATAGTGGTGATGG + Intronic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1135132883 16:19867431-19867453 TAAAATGCTCAGAATGATACCGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1136695074 16:32072021-32072043 TAAAATGCTCATCATGATCAAGG + Intergenic
1136795574 16:33015280-33015302 TAAAATGCTCATCATGATCAAGG + Intergenic
1136874348 16:33839096-33839118 TAAAATGCTCATCATGATCAAGG - Intergenic
1138763879 16:59577006-59577028 TAACATTCTGATGGTGAGAAGGG + Intergenic
1138856825 16:60704071-60704093 TATAACGTAGATAGTGATAATGG - Intergenic
1138876975 16:60963991-60964013 TAGAATGCTGTTAGTGCTACTGG + Intergenic
1138919939 16:61515192-61515214 TATAATTCTTATAGTGATATAGG + Intergenic
1138923595 16:61563857-61563879 TAAAATGCTGAATATGACAAAGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139555233 16:67704406-67704428 TAAAATGAAGATAATAATAATGG - Intronic
1140262620 16:73393355-73393377 TAAAATACTGTCAGTGATCATGG - Intergenic
1141813647 16:86393892-86393914 AATGATGGTGATAGTGATAATGG - Intergenic
1141823621 16:86464171-86464193 GAAAATGGTGATAGTGATGGTGG + Intergenic
1141931830 16:87210284-87210306 GATAATGGTGATGGTGATAATGG + Intronic
1141959890 16:87398359-87398381 TAAAAAGCTGGAAGTGATAAGGG + Intronic
1203097829 16_KI270728v1_random:1276944-1276966 TAAAATGCTCATCATGATCAAGG + Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1145115596 17:20208192-20208214 TCAAATACTGATAGTAAGAAGGG + Intronic
1146050632 17:29549856-29549878 TAAAATGCTGTTAGGAAGAAGGG - Exonic
1146812519 17:35915252-35915274 TCAAATGCTGAAACTGCTAAGGG + Intergenic
1147456209 17:40539778-40539800 TAAAATGTTAATAGCAATAAAGG + Intergenic
1149280372 17:55098001-55098023 TATAATGATGATGATGATAATGG - Intronic
1149337161 17:55647547-55647569 AAAAATGCTCATAATAATAAAGG + Intergenic
1149799355 17:59552760-59552782 TAAAATCCTGATACTTCTAATGG + Intergenic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1153209278 18:2742102-2742124 TAACATGCTGATAGGTCTAATGG - Intronic
1154114401 18:11598575-11598597 TAAGATGATGAGAGTGCTAAAGG + Intergenic
1154151820 18:11912163-11912185 TAAGATGCTGACATTTATAAAGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156799567 18:41093072-41093094 TAAAATGGGGATAGTGAGAATGG - Intergenic
1157711702 18:49854161-49854183 TAAAATGGGGCTAGTAATAATGG - Intronic
1157712652 18:49860416-49860438 TAAAATGGTGATAATGATGCTGG + Intronic
1157983736 18:52413662-52413684 TAAAAACCTCATAGAGATAAAGG - Intronic
1158754219 18:60302709-60302731 TATAATGCTGATAGTGTTGATGG + Intergenic
1159026632 18:63188916-63188938 TAAAATGCTGCTATTAAGAAAGG - Intronic
1159687395 18:71439366-71439388 AAAAATGTTAAGAGTGATAAAGG + Intergenic
1159767531 18:72508539-72508561 TAAAATACTGATAGAAATGAAGG + Intergenic
1160143180 18:76344242-76344264 AATAATGGTGATAGTGATGATGG + Intergenic
1164396799 19:27872577-27872599 TATGATGATGATAGTGATGATGG + Intergenic
1165293997 19:34911437-34911459 AAGAATGGTGATAGGGATAAGGG + Intergenic
1165504370 19:36215504-36215526 GAAAGTGCTGATAATTATAACGG + Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168338917 19:55612924-55612946 TAAAATGAGCATAATGATAAGGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925205353 2:2001157-2001179 AAAAAAACTAATAGTGATAAAGG - Intronic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926010646 2:9403697-9403719 TAAAATAATAATTGTGATAAAGG - Exonic
926112085 2:10189929-10189951 GATGATGGTGATAGTGATAATGG + Intronic
926112246 2:10190856-10190878 TACAATGCTGAGAGTGATGATGG + Intronic
926902101 2:17763247-17763269 TCAACTGCTGATAGTCATTAGGG - Intronic
927140507 2:20127171-20127193 CAAAATTCTGATGGTGTTAATGG + Intergenic
927797540 2:26063285-26063307 TAAAAAGCTGAAAGGGAAAAGGG - Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929089654 2:38202436-38202458 TAGAATCCTAATAGGGATAAGGG - Intergenic
929267780 2:39938321-39938343 TAGAATTCTGTTAGTGGTAAGGG + Intergenic
929304220 2:40341794-40341816 TCACAGGATGATAGTGATAATGG + Intronic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929695198 2:44108807-44108829 TAAAATGTTGATAGGTATAACGG + Intergenic
930249243 2:49017084-49017106 TAAAATGCTGATATTTATCAAGG + Intronic
930278810 2:49344812-49344834 TAAAAAGCTGAAATTGCTAAGGG - Intergenic
930436161 2:51345265-51345287 TAAAATGCCTTTAGTAATAATGG - Intergenic
930571777 2:53095049-53095071 TGAAATGCAAATAGTAATAATGG - Intergenic
930691177 2:54366734-54366756 AAAAATACTGAAAGTAATAATGG + Intronic
930843673 2:55877438-55877460 TATAATGCTGAAAGTGCCAAAGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
930982293 2:57542056-57542078 TAATTTGCTAATATTGATAAAGG + Intergenic
932753667 2:74389648-74389670 TGAAGTAGTGATAGTGATAATGG - Intronic
933026219 2:77262851-77262873 CTAAATGATGAGAGTGATAAAGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933344673 2:81067660-81067682 TACAAAGCTGAAAGTTATAATGG - Intergenic
934178200 2:89596132-89596154 TAAAATAGGGATAGTGATACTGG + Intergenic
934288497 2:91670424-91670446 TAAAATAGGGATAGTGATACTGG + Intergenic
936838648 2:116741105-116741127 TAAACTGGTGATAGTTAAAAAGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937518533 2:122683553-122683575 TAAAATACTGAAATGGATAAAGG - Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
939130868 2:138234684-138234706 TAAAATACTCATAGTCATGATGG - Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940489780 2:154344353-154344375 TAACATTCTGACAGTGTTAAAGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG + Intronic
941204810 2:162558641-162558663 TAACATGGTGATGGTAATAATGG + Intronic
941357254 2:164509723-164509745 TAAAATGCAGATACTGATTCAGG - Intronic
941541097 2:166785602-166785624 AAAAATGTTAATAGAGATAAGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942649580 2:178152842-178152864 TAAAAGGCTAATAGTGTTACCGG + Intergenic
942844475 2:180406103-180406125 TAAAATTTTGCCAGTGATAATGG - Intergenic
943532796 2:189106635-189106657 TTAAATGGTAATGGTGATAATGG + Intronic
943644314 2:190392293-190392315 CAAAATGTCAATAGTGATAAAGG - Intergenic
945445825 2:209937126-209937148 TAAAATGAAGGTAATGATAATGG + Intronic
945467748 2:210189502-210189524 TATATTCCTGATAGTGATAGTGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945560755 2:211337129-211337151 TGAAGTGCTGATGGTGATGATGG + Intergenic
945936768 2:215910338-215910360 TAATATGCTAATAGTTATGAGGG + Intergenic
946554361 2:220838173-220838195 GAAAATGCTGCTATAGATAATGG + Intergenic
946669091 2:222083218-222083240 TAAAATGCTGCTTCTGAAAATGG - Intergenic
946684352 2:222252556-222252578 TTAGATGGTGATAGTGATGATGG - Intronic
946950955 2:224874431-224874453 TAAAATGGTGATAATACTAAGGG - Intronic
947354516 2:229277968-229277990 GGAAATGCTGCTAGTGATTATGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948659838 2:239500156-239500178 TGAAATGCTGAGGGTGAGAAGGG - Intergenic
1169792266 20:9423886-9423908 AAAATTGTTGGTAGTGATAATGG - Exonic
1169951754 20:11052364-11052386 AAAAATGGTGATAATAATAAGGG - Intergenic
1170199241 20:13724762-13724784 TAACATGCTGAAAGTCATATGGG + Intronic
1170337466 20:15286085-15286107 TAAAATGCTGAGAGAGAAAGGGG + Intronic
1170346826 20:15396320-15396342 TAAAATGGGGATACTAATAATGG - Intronic
1170390579 20:15868697-15868719 TACTATGCAGATAATGATAAGGG - Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171280414 20:23891433-23891455 GAAAATGGTGATGGTGATGATGG - Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173657550 20:44710857-44710879 TAAAATGCAGATCCTGATAGTGG + Intergenic
1173968906 20:47135451-47135473 AATAATGTTGATAATGATAATGG - Intronic
1174784453 20:53419506-53419528 TAAAATGGAGCTAGTGATAATGG - Intronic
1174927543 20:54777219-54777241 GAAAATGCAGATAGGGAAAAAGG + Intergenic
1175041711 20:56058312-56058334 TAAAATGATGTTAATGGTAATGG - Intergenic
1175112462 20:56658217-56658239 CAAAATGAAGATGGTGATAATGG + Intergenic
1175332295 20:58173785-58173807 TAACATGGTGAAAGTGCTAAAGG + Intergenic
1175933496 20:62504436-62504458 GAAAATGGTGATGGTGATGATGG - Intergenic
1176258043 20:64163417-64163439 TAACATCCTGATTATGATAATGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1179083183 21:38192389-38192411 TAAAATTCAGAGAATGATAAAGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181505233 22:23351637-23351659 TTAATTGCTCATAGTGATATAGG - Intergenic
1182367769 22:29790306-29790328 TCAAATAAGGATAGTGATAATGG + Intronic
1183566468 22:38619051-38619073 GGAAATGCTGACAGTGACAATGG + Intronic
949220861 3:1632458-1632480 TAAAAAACTGAGAGTGATATAGG + Intergenic
949349032 3:3105467-3105489 TTAAATCCTCATAGTGAAAAAGG - Intronic
950367759 3:12500142-12500164 TAAAATGCAGAAAGTGTTAAGGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951011496 3:17686904-17686926 TAAAATGTTAGTAGTGATGAGGG + Intronic
951394526 3:22149129-22149151 TAAAATGCAGATTCTGATACAGG - Intronic
951437707 3:22684261-22684283 TATAATGCTGATAATTATACAGG - Intergenic
953107345 3:39896642-39896664 TAAATTCCTAAGAGTGATAAAGG - Intronic
955885559 3:63594741-63594763 GATAATGATGATAGTGTTAATGG - Intronic
955897692 3:63718026-63718048 TAAAATGCTGTTTGTGGAAAAGG - Intergenic
956574641 3:70738671-70738693 TGAAATTCTGATAGTGCTACAGG + Intergenic
956885973 3:73560290-73560312 TAAAATGGGGACAGTAATAATGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959795456 3:110422560-110422582 GACAATGATGATAGTGATAGTGG + Intergenic
960034886 3:113092486-113092508 TAAAATGCTGATTCTGGGAAAGG - Intergenic
962597434 3:136960880-136960902 TTAAAGGCTGATAGAGGTAAAGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963671155 3:148253826-148253848 TGAAAAGCTCATAGAGATAATGG + Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964215903 3:154281941-154281963 TGAAATGCTGTTAGTTAAAAGGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965265854 3:166542359-166542381 TAAAATGGTGATAATGAAAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965938801 3:174149609-174149631 TAAAGTGGTGATAGTTTTAAAGG - Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967243672 3:187465862-187465884 TAAAATGGTGATATTGAAACTGG - Intergenic
968592836 4:1467682-1467704 GACAATGGTGATGGTGATAATGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
969831050 4:9797264-9797286 TAAAATAAGGATAGTGATACTGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971133072 4:23834916-23834938 TAATATGGAGATAGTTATAATGG - Intronic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971722330 4:30261677-30261699 TAAAATGCTGATAGAAATTCTGG - Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972427612 4:38948921-38948943 TAAAATCCTGAGAGAGAAAAAGG - Intergenic
972821942 4:42711717-42711739 TAAATTGCTGAGTGAGATAAAGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973676267 4:53266764-53266786 TAAAACACTGACAGTGATATTGG + Intronic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975320424 4:73004246-73004268 TAAAATGCTGGTAAAAATAAAGG - Intergenic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
976001844 4:80383512-80383534 TAAAATGCTGATGGAAATTATGG - Intronic
976990705 4:91361548-91361570 TAAAAAGCTGTAAGTTATAATGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978141915 4:105327562-105327584 TAAAATGTTGCTAGTGTTAATGG - Intergenic
978274426 4:106932468-106932490 TACAATACTGATATTGATCATGG + Intronic
978432457 4:108647277-108647299 TAAAATTAGAATAGTGATAATGG + Intergenic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
978942415 4:114452579-114452601 TAAAATGTTCATACTGATCAAGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
980415103 4:132477377-132477399 TGGAACACTGATAGTGATAAAGG - Intergenic
980606239 4:135093845-135093867 TAGAAAGCTCATAGTGTTAAAGG - Intergenic
981016236 4:139977331-139977353 TAAAATGCTGATAGTGCCGAGGG + Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981534853 4:145788439-145788461 TAAAATGATTATTGTTATAATGG - Intronic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983013244 4:162576610-162576632 AAAAATGTTGATAGTGGTAGAGG + Intergenic
983184476 4:164685789-164685811 TAAAGTGTTGAAAGTGTTAATGG + Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984460802 4:180034406-180034428 TCACCTGCTAATAGTGATAAGGG - Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986120235 5:4828487-4828509 TATAATGTTTATAGTGATAGAGG - Intergenic
986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986812182 5:11372382-11372404 GAAAATAATGATAGTGGTAACGG + Intronic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988069178 5:26265290-26265312 TTAAAGGCAGCTAGTGATAAAGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988572615 5:32385167-32385189 TAAAATGTTGCTAGTGACTAGGG - Intronic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990221433 5:53594270-53594292 GAAGAAGGTGATAGTGATAAAGG - Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990936668 5:61157671-61157693 TAATATGCTGAAAGTTATCATGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991323286 5:65400967-65400989 TAATATGCTAAAAGTGTTAATGG - Intronic
992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG + Intronic
992715921 5:79511330-79511352 TAAACTGCTTAGAGTGAAAAAGG + Intronic
992994132 5:82315913-82315935 TAAAATGCTCATTGTGATGAAGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993226430 5:85170912-85170934 GAAAATGTTGGTAGTCATAAAGG + Intergenic
993686996 5:90949999-90950021 TAAGATGCTGATAGGGATCATGG - Intronic
993763625 5:91828258-91828280 TCATATGATCATAGTGATAATGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993937614 5:94023281-94023303 TATGGTGCTGATAGTGATATGGG - Intronic
993956606 5:94242320-94242342 AAGCATGCTGATAGTGGTAATGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995595342 5:113742043-113742065 TAGAATGGTGACAGTGAGAAAGG - Intergenic
996122086 5:119684024-119684046 TAAAATGGTGATAATACTAATGG + Intergenic
996191086 5:120542411-120542433 GAAAATGTTAATAGTGATAGAGG - Intronic
996347989 5:122508290-122508312 TAAAATGGAGATAATGATAATGG - Intergenic
996467564 5:123821265-123821287 TTAACAGCTGAAAGTGATAATGG - Intergenic
996595957 5:125203009-125203031 TAAAATGCAGTAAGTGATGATGG - Intergenic
997018490 5:129966412-129966434 TCAAATGCTCAGAGAGATAACGG - Intronic
998034081 5:138898736-138898758 GACAATGCTGAAAGAGATAATGG - Intronic
998424979 5:142018829-142018851 TAAAATGGGGATAATCATAATGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1001527965 5:172442064-172442086 TTAAATGTTGTTAGTGATTACGG - Intronic
1001535278 5:172493679-172493701 TTACAGGCTGATAGTGCTAATGG - Intergenic
1001891026 5:175338760-175338782 TAAAATGTATGTAGTGATAATGG - Intergenic
1002060522 5:176623124-176623146 CAAAATGCTGGGAGTGGTAACGG - Intronic
1003280588 6:4687604-4687626 TAATATCCTGAGAGAGATAACGG + Intergenic
1003768708 6:9272102-9272124 TAAAATGTTCATATTTATAAGGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1003884337 6:10507530-10507552 TAAAATATTGATAGTGCCAAGGG + Intronic
1004187968 6:13437912-13437934 TAAAATGCTGAGGGAGAAAATGG + Intronic
1004545058 6:16589706-16589728 AACAATACTGATAGTGATAATGG - Intronic
1005074521 6:21893800-21893822 TGAAGTGCTGAGAGTGATACTGG - Intergenic
1006211419 6:32398608-32398630 TAAAATCCTCATATGGATAAAGG - Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007817958 6:44538129-44538151 GACAATGCTGATGGTGACAAGGG + Intergenic
1008033093 6:46718959-46718981 TAAAATACTGCATGTGATAAAGG - Intronic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009641205 6:66339299-66339321 TAAAATGCTGATTGTTCTAAAGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010420548 6:75669787-75669809 TAAAATGCTGCTAGTTATAGTGG - Intronic
1010567836 6:77439170-77439192 TAGAATCCTGAAAGTGAAAAAGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010875158 6:81094741-81094763 TTATATGCTGATAGTTATATTGG + Intergenic
1011626837 6:89290079-89290101 TAAAATGCTGATGGGCCTAATGG - Intronic
1011789027 6:90878234-90878256 TTAGATGCTGATAGTGATACTGG - Intergenic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1011895451 6:92218830-92218852 TAAAATGTAGCTAGTGATACAGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012379296 6:98600904-98600926 TATAATGATGACAGTGATAAGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012623792 6:101381293-101381315 TAAAATGCTGACAGCAATCAAGG - Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013112925 6:107078806-107078828 TAGCATGCTGGTAGTGATATGGG + Intronic
1013181404 6:107719728-107719750 TAAAATTGTGATAATAATAATGG - Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014364935 6:120527798-120527820 TCTAATGCTGACAGGGATAAGGG + Intergenic
1014645307 6:123965683-123965705 TAGTATTCTGATAGGGATAAGGG - Intronic
1014662006 6:124184236-124184258 AGAAAGGCTGATAGTGAAAAAGG - Intronic
1014698904 6:124658596-124658618 TAAAATGCTGATGATAACAAAGG - Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015652303 6:135477388-135477410 TAAAAAGCCAATAATGATAATGG - Intronic
1015689894 6:135910323-135910345 TAAAGTGCTGACTGTGATACTGG - Intronic
1015695028 6:135970504-135970526 TAAAATGCTGATTTTGATTCAGG + Intronic
1015828290 6:137339491-137339513 TAAAATCCTGATGATGTTAAAGG - Intergenic
1015921807 6:138274106-138274128 TCAGATGCTGAAAGTGAAAAAGG - Intronic
1016611761 6:145998205-145998227 TAAATTCCTAATGGTGATAAAGG + Intergenic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1017961485 6:159225793-159225815 TAAGATGCCAATAGTGACAAAGG + Intronic
1018381452 6:163261490-163261512 CAAATTGCTGCTGGTGATAATGG - Intronic
1018590103 6:165410179-165410201 TAAAATGCTGGTATTAATGAGGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019490206 7:1309242-1309264 GATAATGGTGATAGTGGTAATGG + Intergenic
1020471323 7:8538498-8538520 TAAAATGAGGATAAAGATAATGG + Intronic
1020843130 7:13246538-13246560 TAAAATGCTACTAGTGATACTGG - Intergenic
1020921181 7:14266514-14266536 AAAAATGTTTATAGTTATAAAGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1020978317 7:15036458-15036480 TAATATCCTCATAGAGATAATGG + Intergenic
1022577717 7:31514399-31514421 TTAAATGCTGTTGGTGATAAAGG + Intronic
1023066913 7:36387642-36387664 AATGATGATGATAGTGATAATGG - Intronic
1023514610 7:40988555-40988577 TAAAATGTGGATACTGATACTGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1025282246 7:57636562-57636584 GAACATGGTGATAGTGAGAATGG + Intergenic
1025302484 7:57828957-57828979 GAACATGGTGATAGTGAGAATGG - Intergenic
1026796620 7:73369872-73369894 GAAAATGCTAACAGTGAGAAGGG - Intergenic
1027521748 7:79217292-79217314 AAATATGCTGATGGTGACAAAGG + Intronic
1029092223 7:98057227-98057249 TAAAATAATAATAGTAATAATGG + Intergenic
1030689048 7:112514124-112514146 CAAAACTCTGATAGAGATAAAGG + Intergenic
1030921695 7:115397537-115397559 TAAAATCCTGTAATTGATAAGGG - Intergenic
1030961973 7:115934865-115934887 TAAATTGCTAATAGGCATAATGG - Intergenic
1031178767 7:118388417-118388439 TAAAAAGCTTATGGTGAAAATGG - Intergenic
1031202517 7:118706260-118706282 TAAAATGCTGTCAGTGTTATTGG + Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031761849 7:125723070-125723092 TAAAATGTTCATATTGATGATGG - Intergenic
1032707027 7:134429981-134430003 TAAAATGGAGATAATGCTAATGG - Intergenic
1034079736 7:148265445-148265467 TAAAATTTTTATAGAGATAATGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034745011 7:153516538-153516560 TAAAATGCAGATTCTGATGAAGG - Intergenic
1034883486 7:154779768-154779790 TAAAATGCTGCTGCTGAGAAGGG - Intronic
1035970694 8:4244875-4244897 TAAACTCCTGATAGATATAATGG + Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038382510 8:27109825-27109847 TAAAATGCTGATGGGGATGAGGG - Intergenic
1038636884 8:29294538-29294560 TTAAATTCAGAGAGTGATAAAGG + Intergenic
1038836000 8:31124039-31124061 TGAAGAGCTGATAGAGATAAAGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040547610 8:48411421-48411443 AAAAATGCTGAAAGAGCTAAAGG + Intergenic
1041430005 8:57769182-57769204 TAAAATGCATATTGTAATAATGG + Intergenic
1041876888 8:62698801-62698823 GAAAATGCTGAAAAAGATAATGG + Intronic
1042156100 8:65845651-65845673 TAATATGCTGAAAGAGCTAAGGG - Intergenic
1042391771 8:68244239-68244261 TAAAATGCTTTTCATGATAAAGG + Intergenic
1042685595 8:71435967-71435989 TAAAATGATATTGGTGATAAAGG - Intronic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045054213 8:98355420-98355442 TAAATTTCTGAGAGTGATACTGG + Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045229237 8:100285619-100285641 AAAAATTCTGACAATGATAAAGG - Intronic
1045322172 8:101090611-101090633 TAAAATTCAAATAGTGATAAGGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045977695 8:108148276-108148298 GAGAATGCTGACAGTGATTAAGG - Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046188479 8:110756410-110756432 CAAACTGCTGATAGGGACAACGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047894564 8:129352301-129352323 TAATATGATGATACTGATAATGG + Intergenic
1048655191 8:136528347-136528369 TAAAATGTTGATAGTGGAAGAGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1049916937 9:326918-326940 TAAAATTCTCATGGTGATGAAGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051096347 9:13470089-13470111 TAAAATGCAGTTGGTGCTAATGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052503137 9:29318045-29318067 GAAAATGCTGAGGGTGCTAATGG + Intergenic
1052510890 9:29418593-29418615 TAAAATCCTTTTGGTGATAAGGG + Intergenic
1052993147 9:34534067-34534089 TAAAATTCTGGTATTGATTATGG - Intergenic
1055108099 9:72533239-72533261 TATAATGCATAAAGTGATAAAGG + Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055230386 9:74057205-74057227 TAAAATGCATGTAGTGATAATGG - Intergenic
1055719336 9:79154143-79154165 TTTTATCCTGATAGTGATAAGGG - Intergenic
1056058003 9:82848954-82848976 TAACAGGCTGAAAGTGAGAAGGG - Intergenic
1056533854 9:87510843-87510865 TAAAATGGGGATAGTCATCACGG + Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058050571 9:100402066-100402088 GAAAATGCTGGTAGGGATCAGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059943029 9:119376355-119376377 TAAAATCAAAATAGTGATAATGG + Intergenic
1060882016 9:127123933-127123955 TAAAAAGGTGTTAGTGATGATGG + Intronic
1062078332 9:134604428-134604450 TAAAATGCTGATAGTCGAAGAGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185683091 X:1905043-1905065 AATGATGGTGATAGTGATAATGG + Intergenic
1186732730 X:12427657-12427679 TAAAAGGCTGATGGTACTAAAGG + Intronic
1187000783 X:15175167-15175189 TACAATGATGATAGTGAGGATGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188194114 X:27209430-27209452 TAAAATGCTGTTAGACAAAAAGG + Intergenic
1188194761 X:27219563-27219585 TCATATGCTGGTAGTGAAAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189076890 X:37925517-37925539 TAAAATGCTGGCAGAGAAAAAGG - Intronic
1189432376 X:40959057-40959079 TAGAATGCTGAGAGGGAGAATGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1191965584 X:66753563-66753585 TATAATGTTGATCGTGATGATGG - Intergenic
1191969375 X:66796581-66796603 TAAAATGGGGATAATAATAATGG + Intergenic
1192207195 X:69104352-69104374 TAAAATGGTGATGATGATAATGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193090023 X:77483828-77483850 TTAAATGCAGCTAGAGATAAGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193565805 X:83075696-83075718 TAGAATGCTGTTTGTGATACAGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194190546 X:90831055-90831077 TAAAATGTAGATGGTGATACTGG + Intergenic
1194650383 X:96507548-96507570 TAAAATCCTGGTGATGATAATGG - Intergenic
1195476980 X:105298296-105298318 TAAAATGGTGACAGTGAAGATGG + Intronic
1195588243 X:106591724-106591746 TAAGATGCTGAAAATTATAAAGG - Intergenic
1195595047 X:106679008-106679030 TCAAATGCTCATATTGAAAATGG + Exonic
1195636049 X:107117426-107117448 TGAAATGGTAATAGTGAAAATGG + Intronic
1196133131 X:112179191-112179213 TAAAATGCTAATACTGAGGAGGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197548902 X:127862957-127862979 TAAAATAATGATATTAATAAAGG + Intergenic
1197740790 X:129891967-129891989 TAAAATGCTGAAAGAAAGAAAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198733507 X:139760300-139760322 GAAAATGATGATAATGATGATGG - Intronic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199986022 X:152951546-152951568 TAAACTGCTAAAAGTAATAATGG - Intronic
1200537206 Y:4413479-4413501 TAAAATGTAGATGGTGATACTGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201143607 Y:11048805-11048827 TGGTATGATGATAGTGATAATGG + Intergenic
1201406449 Y:13654742-13654764 TAAAAAGCTGTTGGTGCTAAAGG + Intergenic