ID: 1166026498

View in Genome Browser
Species Human (GRCh38)
Location 19:40090636-40090658
Sequence CTGCGTCCACACGCCCTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166026496_1166026498 5 Left 1166026496 19:40090608-40090630 CCGGCACAGTGTCACTCAGCAAA 0: 1
1: 1
2: 0
3: 26
4: 253
Right 1166026498 19:40090636-40090658 CTGCGTCCACACGCCCTCCCGGG 0: 1
1: 0
2: 1
3: 18
4: 202
1166026495_1166026498 15 Left 1166026495 19:40090598-40090620 CCTAGGGGCACCGGCACAGTGTC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1166026498 19:40090636-40090658 CTGCGTCCACACGCCCTCCCGGG 0: 1
1: 0
2: 1
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166026498 Original CRISPR CTGCGTCCACACGCCCTCCC GGG Intronic
900178172 1:1299760-1299782 CTGCGTCCTCACCCCATGCCCGG - Intronic
900284027 1:1890760-1890782 GTTCGTCCACCCGCCCGCCCTGG - Intronic
900319181 1:2074111-2074133 CTGCAGCCGCACGCCTTCCCCGG - Intronic
902352842 1:15871042-15871064 CTGCGTCCTCACCGCCTCCTGGG + Intronic
902983639 1:20142448-20142470 CTGGGTCCACACGCCCAGCCTGG - Intronic
903173114 1:21565653-21565675 CTCCGTCCTCACTCACTCCCTGG - Intronic
904237289 1:29123709-29123731 CCGCGTCCACACTCCCGCCTGGG + Intronic
908356799 1:63330203-63330225 CTGGGTCCTCTCGGCCTCCCAGG - Intergenic
914447050 1:147758968-147758990 CTTCGTCTCCACGCCCTCTCTGG - Exonic
915431159 1:155868183-155868205 CTACGTCCACCTTCCCTCCCAGG - Exonic
915589542 1:156862759-156862781 CTGCATTCTCACCCCCTCCCTGG + Intronic
916056749 1:161073454-161073476 CTGCGACCACAAACCCACCCTGG + Intronic
917977794 1:180251299-180251321 CCGCCTCCACACGCCAGCCCAGG + Intronic
920371769 1:205483584-205483606 CTGCATCCAGAGTCCCTCCCCGG + Intergenic
921217810 1:212951727-212951749 GTGCATCCACATGCGCTCCCAGG - Exonic
921284494 1:213596922-213596944 CTCCGTCCACATGGCCACCCTGG - Intergenic
922740812 1:228013401-228013423 CTGCTTCCACATTCCTTCCCCGG + Intronic
923650339 1:235867196-235867218 CTGGGTCCGCACCTCCTCCCAGG + Intronic
924798156 1:247308079-247308101 CTGCTTTGACACACCCTCCCCGG + Intronic
1065020018 10:21495926-21495948 CAGCGTCCCCACCCCCTCCGGGG - Exonic
1065386861 10:25142627-25142649 CTGGTTCCTCACGCCATCCCTGG + Intergenic
1070455080 10:76605154-76605176 CTGAGTCCACATGTCCTCACTGG + Intergenic
1071412740 10:85412891-85412913 CTGCGACCACACACTCACCCAGG + Intergenic
1072619362 10:97069310-97069332 CTGCATCCACAAGCCCAGCCCGG - Intronic
1072745400 10:97936021-97936043 CTGCTGCCACAGGACCTCCCTGG - Intronic
1076721925 10:132396745-132396767 CTGCGCCCTCCCTCCCTCCCCGG - Intergenic
1076862726 10:133148154-133148176 CTGCACCCATACACCCTCCCAGG + Intergenic
1077045676 11:544233-544255 CTGCCTCCACACCCCTCCCCTGG - Intronic
1077580436 11:3413832-3413854 GTGAGCCCACACGCCCACCCGGG - Intergenic
1078403046 11:11044833-11044855 CTTCGTACACAAGCCCTCCCTGG + Intergenic
1078855604 11:15204481-15204503 CTCCACCCACACCCCCTCCCTGG + Intronic
1079393022 11:20038726-20038748 CTGCCTCCCCACGCCTTGCCTGG - Intronic
1080024605 11:27600277-27600299 CTGGGTCCACACTCCCTGTCTGG + Intergenic
1083611715 11:64007539-64007561 CTGCCTCTACAGGACCTCCCGGG + Intronic
1083639766 11:64139240-64139262 CTGCATCCTCCCGTCCTCCCTGG + Intronic
1083670384 11:64296892-64296914 CTGGGTCCGCACCCCCTCCCAGG - Exonic
1083939636 11:65888661-65888683 CTGCGTCCTGTCTCCCTCCCCGG + Intergenic
1083999001 11:66285889-66285911 CTGCTTCCAAATGCCCTGCCTGG + Intronic
1084890552 11:72234692-72234714 CTGGCCCCACACTCCCTCCCAGG - Intronic
1086312389 11:85549280-85549302 CTGCTTCCACTCGCCCTCCTTGG + Intronic
1089705139 11:120272364-120272386 CTGTATCCACACACCATCCCTGG + Intronic
1090344914 11:126062441-126062463 CTGCACCCCCACGCCCTCCAGGG + Intronic
1095704608 12:45223033-45223055 CTGAGTTTTCACGCCCTCCCAGG - Intronic
1097246467 12:57610283-57610305 CTGCGCGCATGCGCCCTCCCTGG + Exonic
1097261002 12:57720269-57720291 CTGGGTCCAGCCGCCCTCCAGGG - Intronic
1100896184 12:99185584-99185606 CTGCTTCTACTCGCCCTCCATGG - Intronic
1101253724 12:102957729-102957751 CTTCTTTCACTCGCCCTCCCTGG - Exonic
1101295999 12:103424514-103424536 CTGCTTCCACTCGCCCTCTGTGG - Intronic
1101589593 12:106113825-106113847 CTTCATCCACAGGCCCTCCTTGG - Intronic
1102543459 12:113638375-113638397 CTGCGTCCGCCCCCTCTCCCCGG - Intergenic
1104901088 12:132189870-132189892 CGGCGTCTCCCCGCCCTCCCCGG + Intergenic
1110360186 13:74615987-74616009 CTTCCTCCAAACGCCCTACCAGG + Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113201209 13:107868299-107868321 CTGCGTCCAGACCCCCTCCCGGG + Intergenic
1113881410 13:113628803-113628825 CTGCCCACACACGCCCTCCAGGG + Intronic
1115294705 14:31812612-31812634 CTGCTTCCACTTGCCCTCCTTGG + Intronic
1117313450 14:54551153-54551175 CTGCCTCCTCACCCCCACCCAGG + Intergenic
1118559930 14:67067931-67067953 CTGCTTCGACTCGCCCTCCATGG + Intronic
1119386082 14:74258836-74258858 CTCCGCCCCCACTCCCTCCCAGG + Intronic
1119532545 14:75373139-75373161 CTGTGTCCCCAAGCCCTCCACGG - Intergenic
1120993617 14:90398317-90398339 CGGCGTCCAGACGCCCGCTCGGG + Intronic
1121285120 14:92729238-92729260 CTCTGTCCCCACTCCCTCCCAGG + Intronic
1122372593 14:101236900-101236922 CTTTGTCCTCAGGCCCTCCCAGG + Intergenic
1122506166 14:102233219-102233241 CTCAGCCCACAGGCCCTCCCTGG + Intronic
1122809638 14:104281629-104281651 CTGAGCCCCCAAGCCCTCCCTGG + Intergenic
1122958775 14:105085037-105085059 CTGCCTCCTGACCCCCTCCCTGG - Intergenic
1123007413 14:105330510-105330532 CTGCGGCCCCACTCCCTCCCAGG - Intronic
1123480725 15:20628911-20628933 CTGCTTCAACTCGCCCTCCGTGG - Intergenic
1123637285 15:22371456-22371478 CTGCTTCAACTCGCCCTCCGTGG + Intergenic
1124353692 15:28979128-28979150 CTCCATCCACACCCCCTGCCTGG + Intronic
1124433858 15:29631853-29631875 GGGAGTCCACACCCCCTCCCTGG + Intergenic
1125098125 15:35878216-35878238 CAGGGTCCACAAGCCCTGCCTGG + Intergenic
1127113044 15:55695545-55695567 CTGCTGCCACACCCCCTCCTTGG + Intronic
1132591518 16:728271-728293 CCGGGTCCACCCGCCCTCACAGG + Intronic
1133013935 16:2930322-2930344 CAGGATCCCCACGCCCTCCCTGG + Intronic
1133835898 16:9366915-9366937 CTGAGGCCACAGACCCTCCCTGG - Intergenic
1136265756 16:29117106-29117128 CGGCATCCACATGTCCTCCCCGG - Intergenic
1136626884 16:31466784-31466806 CTGCCTCCACAAGCCCCACCAGG - Exonic
1137610456 16:49814069-49814091 CTTCGACCTCACGCCTTCCCTGG - Intronic
1140165151 16:72543346-72543368 CTGCTTCCGCTCGCCCTCCATGG - Intergenic
1141351320 16:83300585-83300607 CTGCGTCCCCAGACCCTGCCTGG - Intronic
1141804868 16:86335942-86335964 CTCCCTCCACCCACCCTCCCCGG + Intergenic
1142054572 16:87985040-87985062 CGGCGTCCACATGTCCTCCCCGG - Intronic
1142190565 16:88715416-88715438 CTGCGTCCCCACGGCCTGCGTGG - Exonic
1142198106 16:88748132-88748154 CTGCCTACACTTGCCCTCCCTGG + Intronic
1142218399 16:88841174-88841196 CTGCGTCCACACATCCTAACAGG + Intronic
1142685618 17:1575472-1575494 CAGCGTTCACGCTCCCTCCCGGG - Exonic
1142810573 17:2393849-2393871 CTGCGCACGCGCGCCCTCCCGGG + Intronic
1144626345 17:16846183-16846205 CACCGTCCCCAGGCCCTCCCAGG + Intergenic
1144880087 17:18426536-18426558 CACCGTCCCCAGGCCCTCCCAGG - Intergenic
1145152146 17:20517848-20517870 CACCGTCCCCAGGCCCTCCCAGG + Intergenic
1145774250 17:27516378-27516400 CTCTGTCCAAACACCCTCCCAGG - Intronic
1145819217 17:27818451-27818473 CTACCTCCACACCCACTCCCTGG + Intronic
1147428213 17:40356312-40356334 CTGCCCCCACCTGCCCTCCCGGG + Exonic
1147580491 17:41624881-41624903 CACCGTCCCCAGGCCCTCCCAGG + Intergenic
1147741920 17:42674857-42674879 CTTCTTCCACACTGCCTCCCTGG + Intronic
1147986230 17:44309059-44309081 ATGCGTCCACTGTCCCTCCCAGG + Intronic
1151805963 17:76405483-76405505 CTGCGTCCCCACCCCAGCCCCGG - Intronic
1152690059 17:81713865-81713887 CTGGCTCCTCCCGCCCTCCCAGG - Intronic
1157613863 18:48975735-48975757 CCGCGTCCCCACCCCCACCCCGG - Intergenic
1159102343 18:63970601-63970623 CTCCTCCCACTCGCCCTCCCGGG - Intronic
1159926539 18:74274914-74274936 CTGCAGCCAGAGGCCCTCCCTGG - Intronic
1160766547 19:811177-811199 CTGCAGCCACACACCCACCCGGG + Exonic
1160870670 19:1276339-1276361 CTGCGTCCCCAGACCCTCGCGGG + Intronic
1162024718 19:7887524-7887546 CTGCCTCCCCACCCCCACCCTGG - Intergenic
1163459029 19:17425196-17425218 CTCCGCCCCCACGCCCTGCCGGG + Exonic
1164563347 19:29309071-29309093 CTGCGCCCTCAGCCCCTCCCTGG - Intergenic
1164784123 19:30916319-30916341 CTGCTTCCCCACCCCCACCCTGG - Intergenic
1165438821 19:35812318-35812340 CTGCGTCCTCCCAGCCTCCCTGG + Intronic
1165690401 19:37858581-37858603 CTGCTTCCACTCCCCTTCCCTGG + Intergenic
1166026498 19:40090636-40090658 CTGCGTCCACACGCCCTCCCGGG + Intronic
1168217842 19:54939541-54939563 CTGCGCCCACAGGCCCTGCGCGG + Exonic
1168224276 19:54983059-54983081 CTGCGCCCACAGGCCCTGCGCGG - Exonic
925252531 2:2451991-2452013 CTGCTTCCACTCACCCTCCGTGG + Intergenic
925285961 2:2715848-2715870 CTGCATCCCTACGTCCTCCCTGG + Intergenic
925992355 2:9263639-9263661 CAGCGCCCACAGGCACTCCCGGG - Intronic
926052031 2:9751487-9751509 CTCCGTCCACACTCTGTCCCTGG + Intergenic
927699803 2:25260769-25260791 CTCAGTCCGCACTCCCTCCCAGG - Intronic
928127501 2:28626628-28626650 CTGCTGCCCCAGGCCCTCCCTGG + Intronic
928651273 2:33406019-33406041 CTACATCCCCACGCCCTCCAGGG - Intergenic
934861969 2:97771737-97771759 CAGCCTGCACAAGCCCTCCCCGG + Intronic
934862421 2:97775345-97775367 CTGGGGCCACACTCCCTCCAGGG + Intronic
936071398 2:109374106-109374128 CTGCCCCCACACCCCCTCACAGG + Intronic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
941794423 2:169584277-169584299 TTGCGTCACCACGCCCTCCTAGG - Intergenic
944495969 2:200307202-200307224 CGGCGGCCACACGCTCGCCCGGG - Intronic
1169011665 20:2256234-2256256 ATGCGTGCACACGCCCTTGCTGG - Intergenic
1169758799 20:9068943-9068965 CTGCCTCCGCACCCCCTCCCTGG - Intronic
1171133911 20:22679279-22679301 CTGCATCCACACCCTCTCCAAGG - Intergenic
1171372491 20:24670616-24670638 CTGGGACCACCCCCCCTCCCGGG - Intergenic
1172762801 20:37333862-37333884 CTACGTCCACACACGTTCCCGGG - Intergenic
1173813903 20:45972543-45972565 CCGCGGCCACACGCTCTTCCGGG - Intergenic
1173821322 20:46022129-46022151 CTCCGTCCAAACCCCTTCCCTGG - Intronic
1173844088 20:46177151-46177173 CTGCCTCCCCCCGCCCTCACTGG - Intronic
1174190969 20:48740214-48740236 CTGGGTCCACTCTCCTTCCCAGG - Intronic
1174205641 20:48836321-48836343 CTCCATCCACATACCCTCCCTGG - Intergenic
1175133141 20:56804396-56804418 CTCCCTCCACACGCCATCCGGGG + Intergenic
1175748305 20:61477065-61477087 CAGTGTCCACACGTCCTCCCTGG - Intronic
1175949826 20:62577533-62577555 CTGCTCACACACGTCCTCCCGGG + Intergenic
1179341584 21:40515709-40515731 CCGGGTGCACAAGCCCTCCCAGG + Intronic
1180087682 21:45515379-45515401 CTGCGTCCACCAGGCCTCACTGG - Exonic
1180182972 21:46126233-46126255 CCGCGCCCACACGCTCACCCGGG - Exonic
1181539748 22:23566777-23566799 CCGCGTCCGCGCCCCCTCCCCGG - Intergenic
1181859308 22:25805877-25805899 CTGCCCCCACAAGCCTTCCCTGG + Intronic
1182575439 22:31269913-31269935 CTGACTCCACCCGGCCTCCCAGG - Intronic
1183749992 22:39714464-39714486 CTGGGGCCACAAGCCCTCACCGG + Intergenic
1183986650 22:41573946-41573968 CTGCGTGCCCACTCCCTCCCTGG - Intronic
955972037 3:64445578-64445600 CGGCATCCCCCCGCCCTCCCGGG + Intergenic
957752773 3:84443925-84443947 CTGCATCCACAGGCAATCCCAGG + Intergenic
960994559 3:123332379-123332401 CTGTGTCCTCACGCCCTGCGTGG - Intronic
962943140 3:140143822-140143844 CACCCTCCACACGCCTTCCCTGG - Intronic
963027359 3:140933225-140933247 CTGCTTCCACTCGCCCTCCGTGG - Intergenic
964378113 3:156069477-156069499 CTGCTTCAACTCGCCCTCCGTGG + Intronic
968597087 4:1491219-1491241 CTGCAGCCACACGGCCACCCGGG - Intergenic
968996106 4:3946745-3946767 TTGAGTCCCCACGCCCACCCGGG - Intergenic
969488489 4:7485651-7485673 CTGGGTCCACACGGCCTGGCCGG - Intronic
969524587 4:7697722-7697744 CTGTGTCCACAGCCCCTGCCAGG - Intronic
969720791 4:8892364-8892386 CTCCGCAAACACGCCCTCCCCGG + Intergenic
969757878 4:9161953-9161975 GTGAGCCCACACGCCCACCCGGG + Intergenic
972668881 4:41195107-41195129 CTCCGTCTTCACCCCCTCCCTGG + Intronic
984702517 4:182827369-182827391 AGGCGCCCCCACGCCCTCCCAGG + Intergenic
985577187 5:678843-678865 CTGCGTCCCCAAGCCCTGCCTGG - Intronic
985592104 5:770893-770915 CTGCGTCCCCAAGCCCTGCCTGG - Intergenic
985616704 5:927127-927149 CTGCGTCTACACCCGCGCCCAGG + Intergenic
985880829 5:2637877-2637899 CTGCATGCAAACTCCCTCCCCGG + Intergenic
988687572 5:33539973-33539995 CTGCTTCCGCTCGCCCTCCATGG - Intronic
989130425 5:38101623-38101645 CTTCTTCCTCACCCCCTCCCAGG - Intergenic
989390488 5:40895515-40895537 CTGCTTCTGCTCGCCCTCCCTGG - Intergenic
991090544 5:62689995-62690017 CGGAGTCCCCATGCCCTCCCGGG - Intergenic
991173584 5:63658370-63658392 CTCTCTCCACACTCCCTCCCTGG - Intergenic
992038965 5:72809329-72809351 CTGCTTCGACTCGCCCTCCGTGG + Intergenic
992658153 5:78930896-78930918 CTGCGTTCCCAGGCCCTCCACGG + Intronic
992877217 5:81068821-81068843 CTGAGTCCTCCCTCCCTCCCAGG + Intronic
994160281 5:96549558-96549580 CTGCTTCCACTCGCCCACCATGG - Intronic
997216558 5:132116613-132116635 CTGCTTCCGCTCGCCCTCCGTGG - Intergenic
1000194860 5:158947492-158947514 CTGCTTCTGCTCGCCCTCCCTGG + Intronic
1002066049 5:176652256-176652278 CGGCTTCCCCATGCCCTCCCAGG + Intronic
1002101447 5:176860084-176860106 CTGCCCCCACACGCCCAGCCAGG + Intronic
1005895221 6:30172054-30172076 CTTCCTCCTCACCCCCTCCCCGG - Exonic
1006328065 6:33368773-33368795 CTGCGCCCCCACCCCCTCCCTGG - Intergenic
1009740327 6:67734852-67734874 TTGCTTCGACACGCCCTCCATGG + Intergenic
1011693058 6:89887579-89887601 CTGCGTCAGCTCACCCTCCCGGG - Intergenic
1018677530 6:166235976-166235998 CTTCTTCCACACACCCTCCCGGG - Intergenic
1019316058 7:387484-387506 CTGTGTCCAGGTGCCCTCCCCGG + Intergenic
1019417881 7:935549-935571 CTCCGTCCACCCTCCCTCCGGGG - Intronic
1020320382 7:6935155-6935177 CTGAGCCCCCACGCCCACCCGGG - Intergenic
1024426222 7:49229441-49229463 CTGCCTCCACCCGCTCTCCCAGG - Intergenic
1026116706 7:67501983-67502005 CTGCTTCCTCAGCCCCTCCCAGG + Intergenic
1032279116 7:130486745-130486767 CTGGCTCCACCCGCCCTCCTGGG + Intronic
1032348806 7:131141136-131141158 CTGCTCCTACACACCCTCCCAGG + Intronic
1034179624 7:149126909-149126931 GAGCGTCCACACTCCCTCCTTGG + Intronic
1034432015 7:151045846-151045868 CTGTGTCCCCACTCCCTCCATGG + Intronic
1034670539 7:152854343-152854365 CGGCCTCCACCCTCCCTCCCAGG - Intronic
1035053985 7:156021668-156021690 CTGCTGCCACACGCCCTGCCCGG + Intergenic
1036195377 8:6708914-6708936 CGGCGTCCACCCGAGCTCCCGGG + Intronic
1036643051 8:10595957-10595979 CTGCTTCCACATGTCCTTCCAGG - Intergenic
1038544129 8:28412370-28412392 CGGCGTCCCCACGGCCTCTCCGG + Intronic
1048251698 8:132871481-132871503 CTGCGTCCACACACCAGCACTGG - Exonic
1049742246 8:144246784-144246806 CTACTTCCACACCTCCTCCCTGG - Intronic
1052989118 9:34508367-34508389 CTCCTGCCATACGCCCTCCCCGG + Intronic
1054780730 9:69163911-69163933 CAGCGTTCACATGCCCCCCCAGG - Intronic
1056547905 9:87628111-87628133 CTGCTTTCACACAACCTCCCTGG + Intronic
1057489050 9:95507887-95507909 GTGTATACACACGCCCTCCCTGG - Intronic
1058012903 9:99998274-99998296 CTGCGTGCACCAGCCCTCCGTGG - Intronic
1059328600 9:113520280-113520302 GGGAGTCCACATGCCCTCCCCGG + Intronic
1059384137 9:113950866-113950888 CTGCTTCCACACTCACTGCCTGG - Intronic
1061896631 9:133651817-133651839 CTGCCACCACACGACCTCCTGGG + Intronic
1062187746 9:135227686-135227708 CTGCGTCCACCTGCCCTCTCAGG + Intergenic
1062294691 9:135818189-135818211 CCGCGTCCCCACCCCATCCCGGG + Intronic
1062427912 9:136514523-136514545 CTGCGTCCACGGGGCCTGCCGGG - Exonic
1062574721 9:137200783-137200805 CCGCGGCCACGCCCCCTCCCGGG + Exonic
1062582000 9:137232928-137232950 GTGGGTGCACACTCCCTCCCCGG + Intronic
1062677830 9:137758304-137758326 CCACGGCCAGACGCCCTCCCTGG + Intronic
1187166191 X:16806337-16806359 CTGCCTCCACTGCCCCTCCCAGG + Intronic
1187363741 X:18650207-18650229 CTGCCTGGACAGGCCCTCCCAGG - Intronic
1189039851 X:37530759-37530781 CTGCTTCTACTCGCCCTCCGTGG + Intronic
1189236943 X:39494519-39494541 GTGCTTCCCCAAGCCCTCCCTGG - Intergenic
1190673793 X:52764604-52764626 CCGCGCCCACCCGCCCACCCAGG - Intronic
1193376379 X:80766777-80766799 CTGCTTCCACTCGCCCTCCGAGG - Intronic
1193548052 X:82853087-82853109 CTGCTTCAACTCGCCCTCCATGG + Intergenic
1195127519 X:101822812-101822834 CTGCTTCCGCTCGCCCTCCATGG + Intergenic
1200079017 X:153566387-153566409 CTGAGGCCACACCCCTTCCCAGG + Intronic