ID: 1166037223

View in Genome Browser
Species Human (GRCh38)
Location 19:40177582-40177604
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166037223_1166037226 14 Left 1166037223 19:40177582-40177604 CCTCCAAATTCTTGGGGATGTGG No data
Right 1166037226 19:40177619-40177641 TCCTGTTCTTCTCACTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166037223 Original CRISPR CCACATCCCCAAGAATTTGG AGG (reversed) Intergenic
No off target data available for this crispr