ID: 1166037226

View in Genome Browser
Species Human (GRCh38)
Location 19:40177619-40177641
Sequence TCCTGTTCTTCTCACTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166037225_1166037226 11 Left 1166037225 19:40177585-40177607 CCAAATTCTTGGGGATGTGGATT No data
Right 1166037226 19:40177619-40177641 TCCTGTTCTTCTCACTTGACTGG No data
1166037222_1166037226 19 Left 1166037222 19:40177577-40177599 CCTAGCCTCCAAATTCTTGGGGA No data
Right 1166037226 19:40177619-40177641 TCCTGTTCTTCTCACTTGACTGG No data
1166037223_1166037226 14 Left 1166037223 19:40177582-40177604 CCTCCAAATTCTTGGGGATGTGG No data
Right 1166037226 19:40177619-40177641 TCCTGTTCTTCTCACTTGACTGG No data
1166037217_1166037226 30 Left 1166037217 19:40177566-40177588 CCTTGAAAAACCCTAGCCTCCAA 0: 12
1: 44
2: 105
3: 182
4: 415
Right 1166037226 19:40177619-40177641 TCCTGTTCTTCTCACTTGACTGG No data
1166037220_1166037226 20 Left 1166037220 19:40177576-40177598 CCCTAGCCTCCAAATTCTTGGGG No data
Right 1166037226 19:40177619-40177641 TCCTGTTCTTCTCACTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166037226 Original CRISPR TCCTGTTCTTCTCACTTGAC TGG Intergenic
No off target data available for this crispr