ID: 1166038792

View in Genome Browser
Species Human (GRCh38)
Location 19:40190100-40190122
Sequence CTTGTAAGAGGCAAAATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166038792_1166038795 13 Left 1166038792 19:40190100-40190122 CCCAGAATTTTGCCTCTTACAAG No data
Right 1166038795 19:40190136-40190158 AAGAAGTCACTGAACCTCTGCGG No data
1166038792_1166038796 14 Left 1166038792 19:40190100-40190122 CCCAGAATTTTGCCTCTTACAAG No data
Right 1166038796 19:40190137-40190159 AGAAGTCACTGAACCTCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166038792 Original CRISPR CTTGTAAGAGGCAAAATTCT GGG (reversed) Intergenic
No off target data available for this crispr