ID: 1166040090

View in Genome Browser
Species Human (GRCh38)
Location 19:40197074-40197096
Sequence TCCAGCTGGTCCGCAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166040090_1166040095 -6 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040095 19:40197091-40197113 GCTGGAGGGTAAACTGATGGAGG 0: 1
1: 0
2: 1
3: 14
4: 168
1166040090_1166040097 -1 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040097 19:40197096-40197118 AGGGTAAACTGATGGAGGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 237
1166040090_1166040096 -2 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 259
1166040090_1166040098 8 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040098 19:40197105-40197127 TGATGGAGGCTGGGCTCAGCTGG 0: 1
1: 0
2: 23
3: 98
4: 539
1166040090_1166040094 -9 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040094 19:40197088-40197110 CCAGCTGGAGGGTAAACTGATGG 0: 1
1: 0
2: 1
3: 13
4: 143
1166040090_1166040099 13 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040099 19:40197110-40197132 GAGGCTGGGCTCAGCTGGAGAGG 0: 1
1: 1
2: 6
3: 57
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166040090 Original CRISPR TCCAGCTGGTCCGCAAATGC AGG (reversed) Intronic
900003980 1:32077-32099 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900023707 1:202596-202618 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900854279 1:5168243-5168265 TCCAGCTGGGGGGCAAATACTGG + Intergenic
901957346 1:12796168-12796190 TCCAGCTGGTCTCAAACTGCTGG + Exonic
901973741 1:12928420-12928442 CCCAGCTGGTCTGAAACTGCTGG + Intronic
902011437 1:13273347-13273369 CCCAGCTGGTCTGAAACTGCTGG - Intergenic
902128319 1:14236481-14236503 TCAGGCTGCTCCTCAAATGCAGG + Intergenic
905908914 1:41640454-41640476 TGCAGCTGGACCTCAAATGTGGG - Intronic
906551218 1:46668050-46668072 TCCAGCTGCTGCGCAGGTGCGGG - Exonic
907523984 1:55043260-55043282 TCCAGATGCTCTACAAATGCAGG - Intronic
908703821 1:66930019-66930041 TCCAGCTGATCCGCCACTCCAGG - Intronic
910840122 1:91553441-91553463 CCAAGCTGGCCCACAAATGCAGG - Intergenic
911014516 1:93317947-93317969 TCCTGCTGTTCCTCAAATGCTGG + Intergenic
914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
917183458 1:172324286-172324308 TCCAGCTGGTTTGAATATGCCGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923688805 1:236173573-236173595 TGCTGCTGGTCAGCAAATGCAGG - Intronic
1067104363 10:43356153-43356175 GCCAGCTGATCCACAAGTGCAGG + Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1070305489 10:75236497-75236519 TCCATCTGGCCCCCAAAAGCAGG - Intergenic
1073079656 10:100851065-100851087 TCCACCTGACCCTCAAATGCTGG + Intergenic
1082187257 11:49198821-49198843 TCAAGCTGGTCTGCAACTCCTGG + Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1086679081 11:89646602-89646624 TCAAGCTGGTCTGCAACTCCTGG - Intergenic
1088934867 11:114389731-114389753 ACCAGCTGGTCTCCAACTGCTGG + Intergenic
1089014724 11:115156663-115156685 TGCTGCTGGTCAGCAAATGAAGG - Intergenic
1091089388 11:132755959-132755981 TCCAGCTGCTAGGAAAATGCAGG + Intronic
1091377404 12:34128-34150 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1094500670 12:31018265-31018287 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1097300648 12:58015081-58015103 CCCAGCTGGTCCCCAATTCCTGG + Intergenic
1097901596 12:64878815-64878837 ACCAGCGAGTCTGCAAATGCTGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1104109076 12:125688843-125688865 TGCTGCTGGTCCTCACATGCAGG - Intergenic
1104440700 12:128791169-128791191 TACAGCCCGTCCGCAAATTCAGG + Intergenic
1105274425 13:18906330-18906352 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1114168640 14:20248410-20248432 TCCAGCTGGTCTCCAACTCCTGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
1134433861 16:14236934-14236956 TCCAACTTGTCCACAAATCCTGG - Intronic
1136908089 16:34120469-34120491 TCCACATGGTCCTCAACTGCCGG - Intergenic
1139428630 16:66899312-66899334 TCCACCTGCTCCCCAAAGGCCGG + Intergenic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1142263226 16:89052100-89052122 CCCAGATGGTCCCCAAATGTTGG - Intergenic
1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG + Intronic
1145298680 17:21614160-21614182 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145723168 17:27090896-27090918 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1150025382 17:61668780-61668802 TCCAGCTGGTCTGGAACTACTGG + Intergenic
1150679613 17:67274252-67274274 TCCAGCTGGTCTGAAACTCCTGG + Intergenic
1152094496 17:78265263-78265285 TCCTGCAGGTCCCCAAATGTGGG - Intergenic
1152168052 17:78723667-78723689 TGCAGCCTGTGCGCAAATGCTGG - Intronic
1152333936 17:79689568-79689590 TCCACATGGTCTGCAGATGCCGG - Intergenic
1152475744 17:80516891-80516913 TCCAGCCAGTCCACAACTGCCGG - Intergenic
1154466114 18:14643585-14643607 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG + Intronic
1160635732 19:73686-73708 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
934952362 2:98585616-98585638 GCCAGCTCGTCCGCACAGGCAGG + Intronic
935863756 2:107362819-107362841 TGCAGCAGGTCGGCAGATGCTGG + Intergenic
936038871 2:109133963-109133985 TCCAGCTGGTCAGCTAGTGGAGG + Intronic
936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
936680087 2:114760096-114760118 TCCAGCTGGTCTCCACAGGCAGG + Intronic
941153418 2:161943261-161943283 TCCAGCTGTTCCGGATCTGCTGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
946730192 2:222702004-222702026 TCCAGGTGCTAGGCAAATGCAGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1171561901 20:26134415-26134437 TCCAGCTGGCCAACAATTGCTGG + Intergenic
1171903522 20:30879033-30879055 TCCACATGGTCCTCAACTGCCGG - Intergenic
1176808471 21:13515011-13515033 TCCAGCTGGCCAGGAACTGCTGG + Intergenic
1177182129 21:17755920-17755942 TCCAGCTGGTCTCCAACTCCTGG + Intergenic
1180336917 22:11584992-11585014 TCCACATGGTCCTCAACTGCTGG - Intergenic
1182191744 22:28468240-28468262 TGCAGCTGATCTACAAATGCTGG + Intronic
1183377625 22:37474249-37474271 TTGATCTGGTCCTCAAATGCCGG - Intronic
1183618673 22:38960148-38960170 CCCAGCTCCTCCCCAAATGCTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
969607275 4:8208768-8208790 TGCAGGTGGTCAGCAAATGCGGG + Intronic
974075352 4:57163885-57163907 TCCAGATGGTCCGCACCTGGCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984348281 4:178559623-178559645 TCTAGCTGGTCTTCAACTGCCGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
992187963 5:74262099-74262121 TCCAGATGGACTGCACATGCTGG - Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1000648810 5:163790200-163790222 TGCAGCTGCACAGCAAATGCTGG + Intergenic
1006719154 6:36138872-36138894 TCCAGCAGGTCCGCAGCTGCAGG - Exonic
1009591126 6:65672493-65672515 TGGAGCTGGTCCACAAATACTGG + Intronic
1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG + Intergenic
1017249016 6:152260082-152260104 TCCAGGAGGTCTGCAGATGCCGG + Intronic
1025275970 7:57581278-57581300 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1031822027 7:126514165-126514187 CCCAGCAAGTCCGCAGATGCTGG + Intronic
1032188218 7:129745909-129745931 TCCTGGTGGTCTGCAAAAGCAGG + Intronic
1032954196 7:136951446-136951468 TACAGCTGGTCAGCAAAGCCAGG - Intronic
1034079282 7:148261608-148261630 TGGAGCTGGTCCGGAATTGCTGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1037719117 8:21427653-21427675 TCCAGCTTCTCTGCAAATACAGG - Intergenic
1042344840 8:67716873-67716895 GCCAACTGCTCCACAAATGCAGG + Intronic
1043013495 8:74909502-74909524 TCCAGCTAGTGCCCACATGCTGG + Intergenic
1043476481 8:80610679-80610701 TGCAGCTGGTCCGCAGATTATGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1048573105 8:135671038-135671060 TCCAGCTGGTTAGCAAAGCCAGG - Intergenic
1049886674 9:31859-31881 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1059031458 9:110702146-110702168 TCCAACTAGCCCGGAAATGCTGG + Intronic
1060085811 9:120700284-120700306 TTCAACTTGTCCGCAAAGGCAGG - Intronic
1061329934 9:129885945-129885967 TCCAGCGGGTCAGGAAATACCGG - Intergenic
1062204482 9:135328604-135328626 TCCAGCTGGCCCCCAACTGTGGG - Intergenic
1194978409 X:100415581-100415603 TCCAAGTGGACCCCAAATGCTGG + Intergenic
1197763532 X:130044329-130044351 TCCAGCTGGGCAGAAAATGAAGG + Intronic