ID: 1166040094

View in Genome Browser
Species Human (GRCh38)
Location 19:40197088-40197110
Sequence CCAGCTGGAGGGTAAACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166040090_1166040094 -9 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040094 19:40197088-40197110 CCAGCTGGAGGGTAAACTGATGG 0: 1
1: 0
2: 1
3: 13
4: 143
1166040087_1166040094 9 Left 1166040087 19:40197056-40197078 CCATTGTGTATTACTGCTCCTGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1166040094 19:40197088-40197110 CCAGCTGGAGGGTAAACTGATGG 0: 1
1: 0
2: 1
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166040094 Original CRISPR CCAGCTGGAGGGTAAACTGA TGG Intronic
901763092 1:11483181-11483203 CCAGCTGGAAGGTACACGGGCGG + Intronic
901781337 1:11596802-11596824 TCACCTGGGGGGTAAACTCAGGG + Intergenic
902652460 1:17845476-17845498 GCAGGTGGAGTGTAAACTGGGGG - Intergenic
902760909 1:18580255-18580277 CCAGCTGGAGCATGAATTGATGG + Intergenic
905570654 1:39001800-39001822 CTAGCTGGCTGGTAAACAGATGG + Intronic
905967958 1:42115382-42115404 CCTGCTAGAGGGTAAGCTGCAGG - Intergenic
907059765 1:51409570-51409592 CCAGCTGGAGGAGCAACTCAAGG - Exonic
910730128 1:90386084-90386106 CCAAATGGAGGATAAACTGGAGG + Intergenic
919871022 1:201821563-201821585 CCTGCTGGACTGTAAACTTAAGG - Exonic
919896760 1:202013791-202013813 ACACCTGGATGGCAAACTGATGG + Intronic
921182597 1:212643534-212643556 CCAGCAGGAAGGAAGACTGAAGG - Intergenic
923124554 1:231023561-231023583 CCTTCAGAAGGGTAAACTGAAGG - Intronic
924106626 1:240655285-240655307 CTAGCTGTAGGGTACACAGATGG + Intergenic
924392117 1:243573045-243573067 ACAGCTGCAGGGTAAACAGCAGG + Exonic
1062858250 10:790279-790301 CCAGCTGCAGGGAAAGCTGTAGG + Intergenic
1063341799 10:5272440-5272462 CCAGAGGGAGGGTAAACTCTGGG + Intergenic
1064633959 10:17345075-17345097 CCTGCTGCAGTGTAGACTGACGG - Intronic
1066577543 10:36843086-36843108 CCAGCTGGAGATTAACCAGAAGG + Intergenic
1069727333 10:70589167-70589189 CCAGCTGAATGGGAGACTGAAGG + Intergenic
1070302061 10:75210830-75210852 GCAGCTGGAGGGCGAAGTGAAGG - Exonic
1071490792 10:86135140-86135162 CCAGCTGGTGAGGAAGCTGATGG + Intronic
1072232061 10:93422389-93422411 CCAGCAGGACAGTAGACTGAAGG - Intronic
1072596142 10:96873930-96873952 CCAGCTGTTGGGTTGACTGAGGG + Intronic
1075036367 10:119071908-119071930 CCAGCTGTTGGGAAGACTGAGGG + Intronic
1075156275 10:119978589-119978611 CCTGTTAGAGGGGAAACTGAAGG - Intergenic
1077118095 11:894452-894474 CCACCTGCAGGGTAGACTCATGG - Intronic
1077365135 11:2158539-2158561 CCAGCTGGAGGGTGAGCTCCTGG + Intronic
1078200110 11:9173602-9173624 CCAGCTGTTTGGTAAGCTGAAGG - Intronic
1081679777 11:44994160-44994182 CCACCTGGAAGGTGAGCTGAGGG - Intergenic
1083651004 11:64204726-64204748 GCAGCTGGAAGGGAATCTGAAGG + Intergenic
1084489754 11:69471826-69471848 GGAGCTGGAGGGGAAAATGAGGG + Intergenic
1085535475 11:77214755-77214777 CCAGCTGCAGGGGTAGCTGATGG - Exonic
1086841509 11:91690613-91690635 CCAGCTGGAGACTAGACTGAGGG - Intergenic
1089702361 11:120253210-120253232 TCAGCTGGAGGGCCCACTGATGG + Intronic
1091955864 12:4641965-4641987 GCAGGAGGGGGGTAAACTGAGGG - Exonic
1093246822 12:16748964-16748986 CCAGCTGAAGGGAAAAGTGTCGG + Intergenic
1093745039 12:22730607-22730629 GCAGCTGCCGTGTAAACTGAAGG + Intergenic
1095659791 12:44718136-44718158 GCAGCCAGAGGGTAAAATGAGGG + Intronic
1096586819 12:52628291-52628313 CCACCTGGAGAGCAACCTGAGGG - Intergenic
1096773684 12:53951582-53951604 CCAGCTGGAGGACGAGCTGAGGG + Intergenic
1096980039 12:55723385-55723407 TTTGCTGGAGGGTAAGCTGATGG - Exonic
1098882389 12:75929698-75929720 CCAGGTGGAGTGTAAAGTGCGGG - Intergenic
1103423771 12:120813083-120813105 GCAGCTGGAGGGTAAATATAAGG + Intronic
1106763199 13:32887928-32887950 CCAGTTGGAGGCTGAAGTGAAGG + Intergenic
1108133810 13:47333380-47333402 GTACCTGGAGAGTAAACTGAAGG + Intergenic
1110779378 13:79447017-79447039 ATAGCTGGAGTGAAAACTGATGG + Intergenic
1113732536 13:112652128-112652150 ACAGCTGGAAGGGAAACTGCAGG - Intronic
1115463087 14:33683974-33683996 ACAGCTGGAGGAAAAAGTGATGG + Intronic
1117481699 14:56152172-56152194 CTAGCTGCAAGGGAAACTGAGGG + Intronic
1119601723 14:75981174-75981196 CCAGGTGGAGGGCAAGCAGAGGG + Exonic
1121440340 14:93944874-93944896 CCAGCTGGAGGAGAAGCTGAAGG - Intronic
1121741191 14:96253454-96253476 CCAGCAGAAGGATAGACTGAAGG + Intronic
1122823043 14:104356609-104356631 GCAGCTCCAGGGTAAACAGAAGG + Intergenic
1126314366 15:47353650-47353672 CCAGCTTGAAGATAAACTGCTGG + Intronic
1127801861 15:62484043-62484065 GCAGCTGGACAGTAAACTGGGGG - Intronic
1128694856 15:69753838-69753860 CCTGGTGGAGGAAAAACTGAAGG + Intergenic
1135568433 16:23529833-23529855 CCAGCTGGTGGGGAAGCTGCAGG - Exonic
1137328537 16:47466565-47466587 CCAGCTGGCTGATAAACTTAGGG - Intronic
1137685749 16:50385597-50385619 CCAGCTGGAGGGGCAAAGGATGG + Intergenic
1138336526 16:56257817-56257839 CCAGCAGGCTGGTAGACTGAGGG + Intronic
1138416940 16:56876975-56876997 TCAGCTGGTGGGGAAACTGAGGG - Intronic
1138922785 16:61553424-61553446 CGAGCTGGAGGGTAAACCAGTGG - Intergenic
1143046908 17:4088689-4088711 CGAGCTGCTGGATAAACTGAAGG + Exonic
1144508235 17:15851871-15851893 TGAGTGGGAGGGTAAACTGAGGG - Intergenic
1144749754 17:17640327-17640349 CCAGCTGGAATGCCAACTGAGGG + Intergenic
1145119874 17:20248506-20248528 TAAGCGGGAGGGCAAACTGAAGG - Intronic
1145172358 17:20669505-20669527 TGAGTGGGAGGGTAAACTGACGG - Intergenic
1145234615 17:21199896-21199918 TAAGCAGGAGGGTCAACTGAGGG + Intronic
1148458266 17:47822437-47822459 CCAGCAGAAGGGTAAAGGGAAGG - Intergenic
1149500546 17:57149195-57149217 GCAGCTGGAGGGTAATGTGGAGG - Intergenic
1150629347 17:66868119-66868141 CCAGCTGGAGAGAGAGCTGACGG - Intronic
1151569759 17:74920427-74920449 CAAGCTGGTGGGTAAGCTGAAGG - Exonic
1152516576 17:80828382-80828404 CCAGCTGGAGGGAAAACCCCAGG - Intronic
1153006948 18:505360-505382 CCAGCTGGAGAGGAAGCTTAGGG - Intergenic
1154197864 18:12279454-12279476 CCAGATGGTGGGGAAACTGTGGG + Intergenic
1156312443 18:35937221-35937243 GCAGCAGGAGGGCACACTGAGGG + Intergenic
1160325160 18:77939858-77939880 CCAGCTGGGGGCTAACCAGACGG - Intergenic
1161428686 19:4218097-4218119 CCAGCTGGAGGGGCAGCTGGAGG + Exonic
1163362271 19:16854435-16854457 CCAGCTGGAGGGTACCCAGGTGG - Intronic
1165999157 19:39867497-39867519 TCAGCTGGTGGGTCAGCTGAAGG - Intronic
1166040094 19:40197088-40197110 CCAGCTGGAGGGTAAACTGATGG + Intronic
925128485 2:1477873-1477895 CCGGCTGGAGGGTAAGCAGGTGG - Intronic
926018736 2:9475980-9476002 CCTGCTGGAAGGAAAACTGGAGG - Exonic
926145287 2:10393542-10393564 CCAGCTGAAGGGGAAAATGCTGG - Intronic
926510624 2:13773390-13773412 CAAGCTGAAGTGTAAACTTAAGG + Intergenic
928195357 2:29212510-29212532 GAAGCTGGAGGGAGAACTGAAGG + Intronic
931736998 2:65204975-65204997 GCAGCTGGAGGGCGAAGTGAAGG - Intergenic
935210099 2:100932111-100932133 TAAGATGGAGGATAAACTGAAGG + Intronic
936117395 2:109713020-109713042 CCAACTTGAGGGTACACTGAGGG + Intergenic
941131058 2:161651010-161651032 CCACCTGGAGTGAAAACTTATGG + Intronic
942867001 2:180688751-180688773 CCAGCTGGAATGAAAACTTAGGG + Intergenic
943263490 2:185696357-185696379 GCAGCTGGCTGGTAAACTGTAGG - Intergenic
946989329 2:225310436-225310458 CTAGTTGGAGGGAAAACTGGTGG - Intergenic
948420735 2:237858878-237858900 GCAGCTGCATGGAAAACTGATGG - Intronic
1170370329 20:15640903-15640925 CCAGCTGGCGGGTAAGCTGTGGG - Intronic
1170706519 20:18749101-18749123 ACAGATGGAGGGGAAGCTGAAGG + Intronic
1172295213 20:33805181-33805203 ACAGCTGTGTGGTAAACTGAGGG - Intergenic
1172446339 20:34995395-34995417 GCAGCTGGAGGGGAAGGTGAAGG + Exonic
1176173908 20:63708691-63708713 CCAGCTGCAGGGGGACCTGAAGG + Exonic
1176248467 20:64108902-64108924 CCAGCCTGAGGGTACACTGTGGG + Intergenic
1181794142 22:25291621-25291643 CCAGCTGAAGGATAAATTTATGG - Intergenic
1183598836 22:38828407-38828429 CCAGCTGGAGGGGCAGCTGCTGG - Exonic
1184193343 22:42909562-42909584 CCAGCTGGAGAGTAATTTCAGGG + Intronic
954459997 3:50620912-50620934 CCAGTTAGAGGGAAAGCTGAAGG - Intronic
954629876 3:52041995-52042017 CCAGCTGGAGGACAAGGTGAGGG + Intergenic
959190868 3:103109327-103109349 CTAGCCGGAGGGAAAACAGAAGG - Intergenic
966763746 3:183439885-183439907 CCTGCTTGAGGGTGAACTGTGGG + Intergenic
968772320 4:2515216-2515238 CCTTCAGAAGGGTAAACTGAAGG - Exonic
969589046 4:8110853-8110875 CCAGCTGGAGGGAAGCCTGTAGG - Intronic
970098720 4:12495665-12495687 CCAGCTGAACAGTAAAGTGAAGG + Intergenic
971137304 4:23883195-23883217 CAAGGTGGAGGGAACACTGAAGG - Intronic
971158341 4:24106808-24106830 CCAGCTGGTGGGTCAGCTGGGGG - Intergenic
971377629 4:26067928-26067950 ATAGCTGGAGGGTAGAGTGAGGG + Intergenic
975136121 4:70876021-70876043 CCAGCTATTGGGGAAACTGATGG - Intergenic
978726718 4:111977766-111977788 CCAGCTCCAAAGTAAACTGAAGG + Intergenic
993556794 5:89349404-89349426 ACAGCTGGAGGGTTCACTGGGGG + Intergenic
994141385 5:96345666-96345688 CCATCTGAAGGCTTAACTGAGGG + Intergenic
996566308 5:124882679-124882701 ACAGCTGGAAGGATAACTGAAGG - Intergenic
996836336 5:127797150-127797172 CCGGCTGGAGGAAAAACTGGAGG + Intergenic
1000641591 5:163709359-163709381 ACTGCTGGAGGAGAAACTGAAGG - Intergenic
1002320104 5:178369995-178370017 CCAGCTGGAGGAACCACTGAGGG + Intronic
1004507322 6:16257528-16257550 CCAGCTGGAAAGTAAAGAGAAGG - Intronic
1005449544 6:25959468-25959490 CCACCTGTAGGATATACTGATGG - Intergenic
1013051615 6:106541183-106541205 CCAGCTGAAGGATGAACTGAGGG + Intronic
1013615484 6:111839214-111839236 CCAGCAGCAGAGTAAACAGAAGG - Intronic
1014831786 6:126111285-126111307 CAAGCTGCAAGGAAAACTGAGGG + Intergenic
1015262935 6:131259327-131259349 CCAGCTGGAGTGTGACCTGAGGG + Intronic
1016995029 6:149955340-149955362 ATAGCGGGAGGGGAAACTGAAGG - Intergenic
1017549882 6:155494876-155494898 CCAGCTGAAGGGTAAAAAGAAGG + Intergenic
1018653525 6:166010740-166010762 GCAGCTGGAGGGAAAGCTGACGG + Intergenic
1019887322 7:3916771-3916793 TCAGCTGGAAGGTAAAATGAAGG - Intronic
1023027256 7:36061947-36061969 CCATCTGGAGGGCAAATTGGGGG + Intergenic
1023336270 7:39174118-39174140 CCACCTCCAGGGTGAACTGAAGG - Intronic
1028637722 7:93008358-93008380 AGAGCTGGAGGGAGAACTGAGGG - Intergenic
1033359912 7:140631587-140631609 TCAGCTGGAGGGTAAACAGAGGG + Intronic
1034434028 7:151054582-151054604 CAAGCCGGAGGGTAAAGGGAGGG - Intronic
1035548133 8:499459-499481 CCAGCTCCAGGGTCATCTGATGG - Intronic
1039000555 8:32974829-32974851 CCAGCTGGAAGGTCAGCTGGGGG + Intergenic
1039040860 8:33407627-33407649 CCAGCTGGAGGGTTTGCTGAAGG - Intronic
1039844748 8:41317971-41317993 CCAGTAGGAGGCTAAACAGAGGG + Intergenic
1039844896 8:41319077-41319099 CCAGTGGGAGGCTAAACAGAGGG - Intergenic
1040534396 8:48295708-48295730 CCAGGTGGAAGGTAAAAAGATGG - Intergenic
1042173419 8:66015078-66015100 ACAGCTGGAGGGTAACTGGAGGG + Intergenic
1042454800 8:68988726-68988748 CTACCTGGAGAGTAAAGTGAAGG - Intergenic
1046253229 8:111661959-111661981 CCAGATGGAGGGTAAAGCCAAGG - Intergenic
1047421618 8:124712353-124712375 GCAGCTTCAGGGTAACCTGAAGG - Intronic
1050741607 9:8826684-8826706 CCAGCAGGAGAGTAAAATAATGG - Intronic
1050846424 9:10226373-10226395 CCACCTGGAGAGGAAACTGGAGG - Intronic
1056828735 9:89896789-89896811 CCAGGCGGAGGGTAAGCGGAGGG + Intergenic
1057447836 9:95130649-95130671 CCGGCTGCTGGGTAAACTGGAGG - Intronic
1060913788 9:127371557-127371579 ACAGCTGGCAGGTAAACAGATGG - Intronic
1061759797 9:132842748-132842770 CCATCTGGAGGCTTGACTGAGGG + Intronic
1189129030 X:38479331-38479353 CCTGCTGCAGGGTAACGTGAAGG - Intronic
1189990455 X:46589139-46589161 GCAGCTGGCTGGTAAACTGAGGG + Intronic
1190296065 X:49028792-49028814 CCCCATGGAGGGTATACTGAGGG - Exonic
1190757411 X:53412961-53412983 CAAGGTGGAGGATGAACTGAAGG - Exonic
1195626114 X:107006907-107006929 CCAGCTGTAGGGTGCACTGGTGG - Intergenic
1198108967 X:133485793-133485815 CTGGCTGAAGGGGAAACTGAGGG + Intergenic