ID: 1166040095

View in Genome Browser
Species Human (GRCh38)
Location 19:40197091-40197113
Sequence GCTGGAGGGTAAACTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166040090_1166040095 -6 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040095 19:40197091-40197113 GCTGGAGGGTAAACTGATGGAGG 0: 1
1: 0
2: 1
3: 14
4: 168
1166040087_1166040095 12 Left 1166040087 19:40197056-40197078 CCATTGTGTATTACTGCTCCTGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1166040095 19:40197091-40197113 GCTGGAGGGTAAACTGATGGAGG 0: 1
1: 0
2: 1
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166040095 Original CRISPR GCTGGAGGGTAAACTGATGG AGG Intronic
900163672 1:1236320-1236342 GCTGCAGGCTGGACTGATGGAGG - Intergenic
901837981 1:11936423-11936445 CCAGGAGGGTAAGCTGAAGGAGG - Intronic
902652459 1:17845473-17845495 GGTGGAGTGTAAACTGGGGGTGG - Intergenic
903265245 1:22154145-22154167 GTTGTTGGGTAAACAGATGGGGG + Intergenic
904778295 1:32925203-32925225 GCTGTTGTGTAAACTGGTGGAGG + Intergenic
905251107 1:36649012-36649034 GGTGGAGGCTCAACTGATGGAGG - Intergenic
905883892 1:41481451-41481473 GCTGCAGGGGAAACTGAGGCAGG + Intronic
905967957 1:42115379-42115401 GCTAGAGGGTAAGCTGCAGGAGG - Intergenic
906500832 1:46340939-46340961 GCAGGAGGGAAAAGTGAGGGTGG + Intronic
907838884 1:58137482-58137504 GATGGAGGGTAGATAGATGGAGG - Intronic
909022180 1:70444397-70444419 GGTGGAGGGTAGACTGGTGCTGG + Intergenic
910626571 1:89313903-89313925 GCTCGAGGATACAATGATGGAGG - Intergenic
912588120 1:110785561-110785583 GCTGGAGGGTAGAATGAGGAGGG + Intergenic
915129264 1:153685919-153685941 GCAGGAGTGTACTCTGATGGAGG + Intronic
915367068 1:155322644-155322666 GATGCAGGGAAAATTGATGGAGG + Exonic
915552827 1:156645175-156645197 GCTGGAGGGTGGACTAAGGGGGG - Intronic
915600405 1:156920066-156920088 CCAGGAGGCTAAACAGATGGAGG + Intergenic
916991594 1:170250822-170250844 GCTGGAGGGGGAACTCAAGGGGG + Intergenic
917099302 1:171429648-171429670 GCTGGAAGATCAACTGAAGGAGG - Intergenic
917223919 1:172761571-172761593 GCTGCAGAATGAACTGATGGAGG + Intergenic
917602651 1:176593529-176593551 GATGGTGGGTAAACTGAAGATGG + Intronic
917923283 1:179768500-179768522 GCTGCAGGGGCAAGTGATGGTGG + Intronic
919786793 1:201263184-201263206 GCTGGTGGGGAAACTGATCTCGG + Intergenic
919896762 1:202013794-202013816 CCTGGATGGCAAACTGATGGAGG + Intronic
921950271 1:220922330-220922352 GAAGGAGGGGAAACAGATGGAGG - Intergenic
924156429 1:241181575-241181597 GCTAGAAGTTATACTGATGGTGG + Intronic
1064896700 10:20245296-20245318 ACTTGAGGGTAAACTCATGAAGG + Intronic
1068218791 10:54016726-54016748 GCTTGAGGGTGGACAGATGGAGG + Intronic
1069728402 10:70595817-70595839 CCTGGAGGGCAAACGGAAGGAGG + Intergenic
1069784364 10:70978418-70978440 GCAGGAGGGGAAACTGAGGCTGG - Intergenic
1070516719 10:77214808-77214830 GCTGGATGGGAAACTGAGGAAGG - Intronic
1072220582 10:93324484-93324506 GCTGGAGGCAGAAGTGATGGGGG + Intronic
1074277061 10:112013308-112013330 GCTGGAGTGTACACTCCTGGAGG - Intergenic
1074763782 10:116686170-116686192 GCTGGAGGTTAAAGTGAAAGAGG + Intronic
1075005728 10:118828762-118828784 TCTGGAGGGTGCAGTGATGGTGG - Intergenic
1075156274 10:119978586-119978608 GTTAGAGGGGAAACTGAAGGAGG - Intergenic
1077159514 11:1106315-1106337 GGTGGATGGTAGACAGATGGTGG - Intergenic
1077159525 11:1106361-1106383 GGTGGATGGTAGACAGATGGTGG - Intergenic
1077159549 11:1106447-1106469 GGTGGATGGTAGACAGATGGTGG - Intergenic
1081914880 11:46724313-46724335 TCTGTAGGGTCAACTGACGGAGG + Intronic
1083661823 11:64254945-64254967 GCTGGAGGAGAAGCTGATGACGG + Exonic
1083707588 11:64526746-64526768 GATGGAGGGGAAACTGAGGCTGG + Intergenic
1086395953 11:86415158-86415180 GAATGAGGGTGAACTGATGGTGG + Exonic
1089456670 11:118629831-118629853 GGGGGTGGGAAAACTGATGGAGG - Intronic
1090177473 11:124663864-124663886 GCTGGATGGTAAACTCTTTGTGG - Intronic
1090440140 11:126718579-126718601 GCTGGAGGGCAAACTGGGGAAGG + Intronic
1092611341 12:10176399-10176421 GCTGGAGGGCAAAAAGATGATGG + Intronic
1097241846 12:57581039-57581061 CCTGGAGGGTGCACTGAAGGAGG + Exonic
1098090325 12:66894307-66894329 GCTGTTGGGTAAATTGATGGAGG - Intergenic
1101020277 12:100546746-100546768 GCTGGAGGGTTAGTGGATGGAGG - Intronic
1101605102 12:106242364-106242386 GCAGGAGGATAAACTGAAGTGGG + Intronic
1102382905 12:112482866-112482888 GCTGGAAGGAGAACTGATGTGGG + Intronic
1102680602 12:114687936-114687958 GGAGGAGGGTAAAAGGATGGTGG + Intergenic
1102891199 12:116559738-116559760 GCTGGAGGGTTGACTGAAGGTGG - Intergenic
1103198837 12:119069773-119069795 GATAGTGGGTAACCTGATGGTGG - Intronic
1105544599 13:21342312-21342334 GCTTGAGGGTGAACTGACTGTGG - Intergenic
1110779379 13:79447020-79447042 GCTGGAGTGAAAACTGATGGTGG + Intergenic
1112625252 13:101096563-101096585 GGTGGAGGCTAAAGGGATGGGGG + Intronic
1114188800 14:20425081-20425103 GGTGGAGGGAAGACTGTTGGGGG + Intergenic
1115648029 14:35383882-35383904 TATGAAGGGTAAACTGAGGGAGG + Intergenic
1116193857 14:41696496-41696518 GCTGAAGGGTAAAGTGACTGTGG - Intronic
1116870366 14:50064146-50064168 GCTGGAGGGTGAGCTGGAGGAGG + Intergenic
1120926710 14:89804238-89804260 GCTGGAGTGTAAACTGGTCAAGG - Intronic
1122823044 14:104356612-104356634 GCTCCAGGGTAAACAGAAGGTGG + Intergenic
1122915574 14:104856849-104856871 GCTGGGGGGTCAGCTGTTGGGGG + Intergenic
1123721667 15:23066401-23066423 GCTGGCGGGTAACCTGAGGTCGG - Intergenic
1125790946 15:42365339-42365361 GCTGGAGGTTAAGCTGGAGGTGG - Intronic
1128186941 15:65650697-65650719 GATGGAGGGGGAAGTGATGGAGG + Exonic
1129479001 15:75808230-75808252 GCTGGAGGGAGACCTCATGGAGG - Intergenic
1129670115 15:77603015-77603037 CAGGGAGGGGAAACTGATGGGGG + Intergenic
1130217241 15:81983977-81983999 GCAGGAAGGTAAACTGAGGCTGG + Intergenic
1132818927 16:1851473-1851495 GCTGGAGGGTAAACTCCATGAGG + Intronic
1133597744 16:7309552-7309574 GCTGTAAGGAAAACAGATGGCGG - Intronic
1134102553 16:11462225-11462247 GCTGGAGGTGAAACTGGTGACGG - Exonic
1137575088 16:49594111-49594133 GCTGGGGGGTAAACAGAAGTGGG + Intronic
1138278779 16:55756789-55756811 TCTGCTGAGTAAACTGATGGAGG + Intergenic
1138289771 16:55836845-55836867 TCTGCTGAGTAAACTGATGGAGG - Intergenic
1142302522 16:89266839-89266861 ACAGGAGGGTGAGCTGATGGAGG - Intergenic
1144273303 17:13640847-13640869 GCTGGATGGAAAAATGAGGGTGG - Intergenic
1146161926 17:30564749-30564771 CCTGGAGGGAAAACTAATGCTGG + Intergenic
1147522645 17:41189282-41189304 GCTGGAGGGGAAAATGTAGGTGG + Intergenic
1147578327 17:41615163-41615185 CCTGGAGGGAAAACTAATGCTGG + Intronic
1149083335 17:52684430-52684452 GCTGCATGGCAAACTGATGATGG - Intergenic
1150166702 17:62950923-62950945 GCTGGAGGTGGAAGTGATGGGGG - Intergenic
1150612077 17:66741484-66741506 GCTGGAGGACGAAGTGATGGAGG + Intronic
1152161114 17:78669342-78669364 GCTGGAGGGAGAATTGTTGGGGG - Intergenic
1156162209 18:34373165-34373187 GCTGAAGGTGAAACTGTTGGTGG - Intergenic
1157321112 18:46635267-46635289 GCTGGAGAAGCAACTGATGGGGG + Intronic
1160037451 18:75315032-75315054 GCTGTAGGGGAGAGTGATGGAGG - Intergenic
1160729423 19:634207-634229 ATTGGAGGGTAAACTGAAGCTGG - Intergenic
1160802673 19:977497-977519 GAAGGAGGGCAAACTTATGGGGG - Intergenic
1160822449 19:1064862-1064884 GCTGGAGGGTGAGCTGAGGTGGG + Intronic
1160874622 19:1291288-1291310 GCAGGAGGGTAAACTGAGGCAGG - Intronic
1162590108 19:11585882-11585904 GCCGGAGGGTAAGCAGTTGGTGG - Intronic
1166040095 19:40197091-40197113 GCTGGAGGGTAAACTGATGGAGG + Intronic
1167415578 19:49369695-49369717 GCTGGAGGAGAAAGTGAAGGAGG + Intronic
1167609727 19:50501339-50501361 ACCGGAGGGGAAACTGCTGGGGG - Intergenic
1167667673 19:50832170-50832192 GCTGGAGGGCAAGCTGGTGGAGG - Intronic
1167716766 19:51147109-51147131 GCTGGAGGGGTAACTGAGGTGGG - Intronic
1167768005 19:51497066-51497088 GCTGGAGGGGTAACTGAGGCGGG + Intronic
925594167 2:5539011-5539033 GCTGGAGGGTAGACTTCTTGTGG - Intergenic
926953711 2:18271697-18271719 ACTGGAGGGGAAGCTGATGGGGG - Intronic
927553456 2:24017471-24017493 GATGGCGGGAACACTGATGGGGG + Exonic
927944841 2:27129443-27129465 GGTGGAGGGGAAACTGAGGAAGG - Intronic
929088733 2:38194069-38194091 GCTGGAAGGGGAAGTGATGGGGG - Intergenic
929630871 2:43460774-43460796 TCTGGAGGCCAAACTGGTGGGGG + Intronic
929766540 2:44848408-44848430 TCTGGTGGGTGAACTGAGGGAGG + Intergenic
930164342 2:48189477-48189499 GCGGGGGGGTAAAGTGATGGAGG + Intergenic
932374729 2:71226239-71226261 GCTGGAAGGTGAACTGAGAGAGG - Intronic
935237356 2:101150597-101150619 CCCGGAGGGGAAACTGAGGGTGG - Intronic
939743394 2:145938136-145938158 GCTGCAGTGGAAAGTGATGGAGG - Intergenic
946908563 2:224439015-224439037 GCAGGAGGGTAAAGGAATGGTGG - Intergenic
947575767 2:231272995-231273017 GCTGGAGGGAAGGCTGAAGGAGG + Exonic
947941202 2:234057156-234057178 GCTGCAAGGTAAACAGATTGGGG - Intronic
948420732 2:237858875-237858897 GCTGCATGGAAAACTGATGGGGG - Intronic
1173148984 20:40549854-40549876 GCTGGAGGGTAGATGGATGGTGG - Intergenic
1174035655 20:47666749-47666771 GCTTGCGGGTAAACAAATGGCGG + Intronic
1175917012 20:62430657-62430679 GCTGGGGGGCATCCTGATGGCGG + Intergenic
1183339357 22:37271056-37271078 GCTGCAGGGGAGACTGATGGGGG + Intergenic
1184912798 22:47547502-47547524 CCTGGAGGGTAACCCAATGGGGG - Intergenic
952409506 3:33034506-33034528 GCTGGTGGGCAGGCTGATGGAGG - Intronic
955239281 3:57165146-57165168 GCTGGAGGGTAAGGCGAGGGCGG - Exonic
955674857 3:61437397-61437419 GCTGGAGGGAATGCTGGTGGAGG - Intergenic
960048479 3:113219253-113219275 CCTGGAGGGCAAACTGAGGTTGG + Intronic
962297574 3:134205674-134205696 GCTGAAGGGTGACCAGATGGTGG - Intronic
962648947 3:137468466-137468488 GAAGGAGGGTAAAGAGATGGTGG + Intergenic
964357788 3:155866221-155866243 GCTAGAGAGTAGAGTGATGGGGG + Intergenic
965416084 3:168394590-168394612 GCTGGAGGGCAAAATTATGAAGG + Intergenic
967115555 3:186334342-186334364 TCTAGATTGTAAACTGATGGAGG + Intronic
967449213 3:189603933-189603955 GCTGGAGTGTTAACTTTTGGGGG - Intergenic
983917732 4:173310461-173310483 AGTGGAGGGTAGACTGAAGGGGG - Intronic
985632265 5:1020021-1020043 TCTGGATGGTAAGCTGAGGGTGG + Intronic
985670160 5:1202832-1202854 GCTGGAGGCGAAACTGATTCAGG - Intronic
986199776 5:5570273-5570295 GCTAGAGGGCATACTGCTGGTGG + Intergenic
986517245 5:8576442-8576464 GCTGGAGGGGAAGGTGATTGAGG - Intergenic
987987627 5:25169097-25169119 GCTGGAGGGTAAAGAGATTTAGG + Intergenic
989423720 5:41271266-41271288 ACCGGAGGGTAAACTGATTCAGG + Intergenic
991949917 5:71937790-71937812 GGTGGAGGAAAAACGGATGGAGG - Intergenic
994406556 5:99352625-99352647 ACTGGAGTGAAAACTTATGGTGG - Intergenic
998500816 5:142630950-142630972 GCTGGACTGTAAGCTGCTGGAGG + Intronic
1000064027 5:157679985-157680007 ACTGGAGTTTAAACTGGTGGTGG - Exonic
1000641590 5:163709356-163709378 GCTGGAGGAGAAACTGAAGGAGG - Intergenic
1001840295 5:174870535-174870557 GGCAGAGGGTGAACTGATGGAGG - Intergenic
1002104677 5:176874268-176874290 GCTGGATGGTGAGCAGATGGGGG - Exonic
1004107086 6:12675915-12675937 GATGGAGGGCAAATGGATGGTGG + Intergenic
1004411968 6:15389532-15389554 CATGGAGGGTACACTGCTGGGGG - Intronic
1006608999 6:35281300-35281322 GCGGGAGGGCAAGGTGATGGTGG - Intronic
1007644600 6:43370091-43370113 ACTGGAAAGTAAACTGATGCGGG - Intergenic
1012042225 6:94222744-94222766 GCTTGAGGGTGAAGTGTTGGGGG - Intergenic
1013652658 6:112211813-112211835 GCTGGAGGAGAAACTCCTGGAGG + Intronic
1015262936 6:131259330-131259352 GCTGGAGTGTGACCTGAGGGAGG + Intronic
1015891056 6:137970059-137970081 GATGGTGGATAAATTGATGGAGG + Intergenic
1018851168 6:167591156-167591178 GGTGGAGGGTATAATGATAGTGG - Intergenic
1020439551 7:8202761-8202783 ACTGCAGAGTAAAATGATGGAGG + Intronic
1020618746 7:10493635-10493657 GCTGGAGGGTGAAGAGATTGGGG - Intergenic
1022565685 7:31398660-31398682 GGTGAAGAGTAAACTGGTGGAGG - Intergenic
1022703857 7:32785390-32785412 AGTGGAGGGTAGACTGATGATGG - Intergenic
1022908100 7:34875519-34875541 GGTGGAGGGTAGACTGATGATGG - Intronic
1023234139 7:38066080-38066102 GCAGCAGGGTAAAGTGGTGGGGG - Intergenic
1026550839 7:71367285-71367307 GCCTGAGGATAAACTGATGAAGG + Intronic
1028345560 7:89777930-89777952 GCAGGAAGGTAAACTTATAGTGG - Intergenic
1030059645 7:105612567-105612589 CCTGGAGGCTAAACTGCTGGTGG - Intronic
1030736791 7:113058631-113058653 GTTGGAGGGCAAAGTGGTGGAGG - Intergenic
1032080079 7:128854329-128854351 GGAGGAGGTTTAACTGATGGGGG + Intronic
1032842225 7:135723355-135723377 ACTAGAGGGCAAGCTGATGGAGG - Intronic
1032964877 7:137084751-137084773 ACTGGGGGATAAGCTGATGGAGG - Intergenic
1033755865 7:144398189-144398211 TCTGGAGGGTAGACTGAGGCAGG - Intronic
1036196909 8:6726402-6726424 GCTGGCAGGTAAACTGAAGAAGG - Intronic
1042497114 8:69467609-69467631 GCTGCAGGGAAAGCAGATGGAGG + Intronic
1049258358 8:141625668-141625690 CCTGGTGGGTAAAATGGTGGTGG + Intergenic
1053160028 9:35807491-35807513 CCTGGAGGGAAAACTGATCATGG - Intronic
1053199417 9:36142590-36142612 GTAGGAGGGTAAACTGAGGCTGG - Intronic
1056738223 9:89227641-89227663 GCTGGAGGGTCAAGAGATGCTGG - Intergenic
1057614892 9:96580555-96580577 GGTGGACTGTAAATTGATGGGGG + Intronic
1058691212 9:107522148-107522170 GCGGGAGGGTAACCTGAGGTTGG + Intergenic
1058920271 9:109607730-109607752 GCTGAAGGTTAAAGTGATTGTGG - Intergenic
1060860121 9:126947159-126947181 GCTGGAAGGTGAAGTGGTGGTGG + Intronic
1061641845 9:131964397-131964419 GCTGGAGGTGATAGTGATGGTGG + Intronic
1061798429 9:133101703-133101725 GCTGGAGGCTGAGCTGATGCCGG + Exonic
1061893618 9:133635626-133635648 GCTGCAGGGTGCACTGCTGGGGG - Intergenic
1186827900 X:13360304-13360326 GCTGGCTGGCAAGCTGATGGAGG + Intergenic
1190296432 X:49030304-49030326 GCTGGAGGACATTCTGATGGAGG - Exonic
1196004031 X:110816593-110816615 GCAGGAGGGGAGAGTGATGGGGG + Intergenic
1197487852 X:127075462-127075484 GAGGGAGGGTAAAGTGATGACGG - Intergenic