ID: 1166040096

View in Genome Browser
Species Human (GRCh38)
Location 19:40197095-40197117
Sequence GAGGGTAAACTGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166040090_1166040096 -2 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 259
1166040087_1166040096 16 Left 1166040087 19:40197056-40197078 CCATTGTGTATTACTGCTCCTGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166040096 Original CRISPR GAGGGTAAACTGATGGAGGC TGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG + Intergenic
900167114 1:1248237-1248259 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167197 1:1248500-1248522 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167580 1:1249622-1249644 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
902170142 1:14603721-14603743 GAGGGTAAAGGGATGGAGAGAGG - Intronic
903369228 1:22824567-22824589 GAGGGAAGACGGGTGGAGGCTGG + Intronic
903663005 1:24990094-24990116 GAGGGAAGACTGTGGGAGGCAGG + Intergenic
903670250 1:25031182-25031204 GAGGATGAAGGGATGGAGGCTGG + Intergenic
903790753 1:25891440-25891462 GAGGGAGAAATGATGGAGCCAGG + Intronic
907291079 1:53413303-53413325 GAGGATAAACTGTCAGAGGCTGG - Intergenic
907445057 1:54502099-54502121 GCTGGTAATGTGATGGAGGCTGG - Intergenic
908465724 1:64391995-64392017 GATGGTAAGCTCATTGAGGCAGG + Intergenic
909473572 1:76056850-76056872 GAGAGTAAAATTATGGAGACAGG - Intergenic
910731801 1:90405958-90405980 GAGGGTAAATGGATAGTGGCGGG + Intergenic
911083634 1:93957928-93957950 GAGAGCAAAGTCATGGAGGCTGG - Intergenic
911541435 1:99162530-99162552 GAGGGTGAGCTGAAGCAGGCTGG - Intergenic
911864662 1:103002566-103002588 GAGGGAAAACTGTTTGAGGGTGG - Intronic
913044922 1:115065923-115065945 GAGGGTAGACTGATGGTTACTGG - Intronic
913062410 1:115220444-115220466 GAGGGGAAACAAATGGAGACTGG + Intergenic
913992534 1:143627884-143627906 GAGGGGCACCTGATGGAGCCTGG - Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
916351539 1:163854658-163854680 GAGGGTAGAAAAATGGAGGCAGG - Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
919896763 1:202013798-202013820 GATGGCAAACTGATGGAGGCTGG + Intronic
919956658 1:202424028-202424050 GAGATAAAACTGATTGAGGCTGG - Intronic
923190996 1:231620550-231620572 GAAAGTAAACTGATGGCTGCTGG - Intronic
924466830 1:244305781-244305803 TAGGGTAACCTGAAGGGGGCTGG - Intergenic
1064587339 10:16852065-16852087 GAGGGAAAGATGATGGAGGGAGG - Intronic
1065643927 10:27814883-27814905 GAGGTTGAACTGATAGAGGATGG - Intronic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1068486624 10:57667161-57667183 CAGGGAAAACTCATGGAGACAGG - Intergenic
1069618657 10:69822612-69822634 GTGGGTGGACTGATGGATGCGGG - Intronic
1070732122 10:78837274-78837296 GAGGGTTGACTGATGCAGGTTGG - Intergenic
1070771860 10:79087255-79087277 GATGGTAAAGTGTTGGAGGAAGG + Intronic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1071922934 10:90371792-90371814 GAGGGTGAGCTGAAGCAGGCGGG - Intergenic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072463260 10:95639771-95639793 GGGGGAAAACTGATGGAGAAGGG - Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073287774 10:102398867-102398889 GAGGGGGTACTGATGGAGGGAGG + Intronic
1073577342 10:104638114-104638136 TTGGGGAAAATGATGGAGGCTGG + Intergenic
1075528340 10:123204484-123204506 GAGGGTAAATTGGATGAGGCGGG - Intergenic
1075629478 10:123992310-123992332 GTGGGGCAACTGAGGGAGGCCGG - Intergenic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076219610 10:128722677-128722699 GAGGGGAAACTGAGTCAGGCTGG + Intergenic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081686664 11:45047799-45047821 AAGGGTAAAGTTCTGGAGGCAGG - Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1084590631 11:70088037-70088059 GAGGGCAACCTCCTGGAGGCGGG + Exonic
1087205117 11:95386363-95386385 GAGGATAGACTGGAGGAGGCTGG + Intergenic
1089051549 11:115550023-115550045 GAGGGAAAACTGGAGGTGGCTGG - Intergenic
1092105798 12:5921065-5921087 GAGCACAATCTGATGGAGGCTGG - Exonic
1092902416 12:13072153-13072175 GGGGGGAACCTGACGGAGGCAGG + Intronic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG + Exonic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099813300 12:87613619-87613641 GAGGGTAAAATGTGGGAGGAGGG - Intergenic
1101771286 12:107753960-107753982 GAGGGTAAGGTGGTGGAGGTAGG + Exonic
1101823366 12:108201396-108201418 GAGGCTAAACTGGAGTAGGCTGG - Intronic
1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG + Intronic
1105855865 13:24371346-24371368 GAGGGTGAGCTGATGAAGGAGGG + Intergenic
1107853411 13:44591975-44591997 GAGGGGAAGCTGAGGGTGGCTGG + Intergenic
1108992845 13:56684956-56684978 AAAGGTAAATTGATAGAGGCTGG - Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110146357 13:72195707-72195729 GAAGGTAGATTGATGGAGGGTGG - Intergenic
1114528968 14:23383379-23383401 AAGAGTAAAATGATGGAGGAGGG - Intronic
1114617025 14:24073711-24073733 GAGGCAAAGCTGATGGAGGTAGG - Intronic
1114860746 14:26517437-26517459 GAATGTAAACTGATAGAGGCAGG + Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115785395 14:36820053-36820075 GAGAGGGAACTGATGGAGACTGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1119824836 14:77649003-77649025 GAGGGTAAAATTCTGGAGGAAGG + Intergenic
1120664979 14:87295057-87295079 GAGAGCAAACTGATTGAGGAAGG + Intergenic
1125361530 15:38869649-38869671 AAGGCTAAACTTATGGAGGTGGG - Intergenic
1126314367 15:47353657-47353679 GAAGATAAACTGCTGGAGCCTGG + Intronic
1128681841 15:69658089-69658111 GTGGGTCAAGAGATGGAGGCAGG - Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG + Intronic
1131261333 15:90889569-90889591 GAGGGTGAACCGCTGGAGCCTGG + Exonic
1131514114 15:93066056-93066078 GTGGGGCAACTGAGGGAGGCCGG + Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1133780630 16:8936304-8936326 CAAGGTGAACTGATGGGGGCGGG - Intronic
1137616331 16:49849670-49849692 GGAGGTAAACAGAGGGAGGCAGG + Intronic
1137771387 16:51018319-51018341 GAGGGTAAAATGAAGGAGCTTGG + Intergenic
1138434428 16:56989299-56989321 GACGGGAAACTGAGGCAGGCGGG - Intergenic
1138575246 16:57903562-57903584 GTGGGTAAAGTGAGGGGGGCAGG + Intronic
1139501493 16:67370023-67370045 GAGGGAAAACTGATGATGCCAGG + Intronic
1140404321 16:74698109-74698131 GAGGGAGAATTGATTGAGGCTGG + Intronic
1140735342 16:77893186-77893208 GAGGGTGAACTGGTGGCAGCTGG + Intronic
1141486927 16:84346625-84346647 AAGAATAAACTGATTGAGGCCGG - Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1142795702 17:2304946-2304968 GAGGGGCAACAGGTGGAGGCAGG - Intronic
1142821897 17:2475750-2475772 TAGAGCAAACTGATGGAGTCTGG + Intronic
1143492082 17:7290418-7290440 GTGGGGCAACTGAGGGAGGCCGG + Exonic
1144237770 17:13278664-13278686 AGAGGTAAAATGATGGAGGCAGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1145775037 17:27521738-27521760 AAGGCTACTCTGATGGAGGCAGG + Intronic
1147339287 17:39744316-39744338 GATGGTAAACTGGAGGTGGCTGG - Intronic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1147902899 17:43801629-43801651 GATGGTAAAATGAGGGAGTCTGG + Exonic
1148333976 17:46829507-46829529 GAGGGGAGACTGTAGGAGGCAGG - Intronic
1153558694 18:6347139-6347161 GAGGGTGAAATGATGGTGCCGGG + Intronic
1155091448 18:22515307-22515329 GAGTCCAAACTGATGGAGGGAGG - Intergenic
1155384847 18:25266595-25266617 GAGGGCAAGCTGATGCAGGGTGG + Intronic
1157636987 18:49168511-49168533 TAGGGTACACAGATGGTGGCAGG + Intronic
1157871732 18:51235654-51235676 GACTGGAAACTGATGGTGGCAGG + Intergenic
1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG + Intronic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160716251 19:578144-578166 GGAGGGAAACTGAGGGAGGCGGG - Intronic
1161116824 19:2501870-2501892 GAGCGCAGACTGATGGAGGGAGG - Intergenic
1161899874 19:7110403-7110425 GAGGGAAAAGAGATGAAGGCAGG - Intergenic
1162725809 19:12689259-12689281 GAGGGCAACCTGGTGGTGGCCGG - Exonic
1163213111 19:15856475-15856497 GAAGCTGAAATGATGGAGGCGGG - Intergenic
1165935386 19:39385523-39385545 GAGGGTGAAATCATGGAGGAGGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1167558251 19:50209290-50209312 GAAAGTAAACTTTTGGAGGCAGG + Intronic
1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG + Exonic
1168135655 19:54349492-54349514 GAGGGTGGACGGATGGAGGGAGG + Intergenic
1168451569 19:56470515-56470537 GAGCTTTAACTGATGGAGCCTGG + Intronic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927192976 2:20529595-20529617 GAGTTTGAACTGGTGGAGGCAGG + Intergenic
928830364 2:35475439-35475461 GAGGGTAAAATGAGAGAAGCAGG + Intergenic
929030878 2:37649011-37649033 TGGGGTCAGCTGATGGAGGCAGG + Intronic
929130504 2:38564687-38564709 GAAGGTAAGCTCATGAAGGCAGG + Intronic
929231017 2:39560194-39560216 GAGAGTAGAATGATAGAGGCCGG - Intergenic
931767869 2:65472847-65472869 GGGGGTAAACTGACAGGGGCAGG - Intergenic
932333972 2:70918906-70918928 TAAAGTAAAATGATGGAGGCGGG + Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935405374 2:102703612-102703634 GATGGTAAACTGCTCAAGGCAGG + Intronic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
937627913 2:124064536-124064558 GAGTGAAAATTGATGGATGCAGG - Intronic
938042780 2:128090134-128090156 AATGGAACACTGATGGAGGCCGG - Intergenic
938230622 2:129655633-129655655 CAGGGGAAACTGATGGACTCTGG + Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943157435 2:184201238-184201260 GCGGGAGAACTGCTGGAGGCCGG + Intergenic
943689158 2:190851272-190851294 GTAGGTAAACTGAAGGAGGCTGG - Intergenic
944347292 2:198684600-198684622 GAGGGTGAGCTGAAGAAGGCTGG + Intergenic
944663489 2:201940214-201940236 GAGGAGACACTGATAGAGGCAGG + Intergenic
944708791 2:202317220-202317242 GAGAGTAAACAGGTGGAAGCTGG - Intergenic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
946221025 2:218227099-218227121 GAGGGTAAAGGGATGGTGCCTGG - Intronic
946653419 2:221918731-221918753 GTGGGTAAACAGAGGAAGGCAGG - Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169449364 20:5698239-5698261 GAGGGAAAACTGCTTGAGCCAGG - Intergenic
1170586640 20:17739766-17739788 GAGGGTTGGCTGATGTAGGCTGG - Intergenic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1172452401 20:35036184-35036206 GAAGGTTAAATGATGGAGTCAGG - Intronic
1173434020 20:43016442-43016464 GAGGGGACGCTGATGCAGGCAGG - Intronic
1174280726 20:49437294-49437316 GAGGGAGAACTGATGGGGGCTGG + Intronic
1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG + Intronic
1177567400 21:22843234-22843256 GAGGGGCAAATGATAGAGGCAGG - Intergenic
1178125303 21:29509595-29509617 GAGGGCAAAGTGAGGTAGGCTGG + Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181980033 22:26759771-26759793 GAGGATAAAATAATTGAGGCGGG + Intergenic
1182058817 22:27382186-27382208 GAGGGCAGAGTGAAGGAGGCTGG + Intergenic
1182852057 22:33483735-33483757 TCTGTTAAACTGATGGAGGCAGG + Intronic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
959116496 3:102184469-102184491 GAGGGTAAACTGAGGCAAGTGGG + Intronic
959232356 3:103670931-103670953 GAGTGTAAATTCATTGAGGCAGG - Intergenic
960111951 3:113853857-113853879 GAGGCTTAAATGATGGGGGCGGG + Intronic
962374034 3:134845753-134845775 GTGGGTAAAATGATAGTGGCAGG - Intronic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963240994 3:143002097-143002119 GGAGGGAAACTGAGGGAGGCCGG - Intronic
966885340 3:184374712-184374734 GAGGCTTAAATGATGGAAGCAGG + Intronic
967115557 3:186334346-186334368 GATTGTAAACTGATGGAGGGTGG + Intronic
969025205 4:4167270-4167292 GAAGGACAACTGATGGAGGAAGG - Intergenic
969838997 4:9866807-9866829 GTGGGTAAACTGATGCATGAGGG + Intronic
970964505 4:21912951-21912973 GAGAGTAAACTGAAGAAGACAGG + Intronic
973607019 4:52598014-52598036 GATGGTAAACTGATGGGTCCTGG + Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
976385013 4:84447073-84447095 GAGTGTAAACTCATGAGGGCAGG - Intergenic
976827674 4:89278867-89278889 GAGGGGAAACCTATGGAAGCAGG + Intronic
976834690 4:89357805-89357827 GAGAGTGAACTGATGGAGAAAGG - Intergenic
977235083 4:94498708-94498730 GAGGGGAAACTGATGTGGGTGGG + Intronic
981564946 4:146090552-146090574 GAGGCTAAACTTTTGGAGGTTGG + Intergenic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
982036464 4:151350657-151350679 GTGGGAGAACTGATTGAGGCAGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985186922 4:187327562-187327584 GAGTGTAAACTTAGGGAGACAGG - Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986404902 5:7416028-7416050 GAGGGTACACTGCTGTAGGGAGG + Intronic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
987447497 5:18038479-18038501 GAGGGAAGACTGATGGAGTGGGG - Intergenic
989176210 5:38529075-38529097 AAGGGTAAACTGATGAAAGTGGG + Intronic
989251405 5:39319740-39319762 GAGGCTGAACTCATGAAGGCTGG - Intronic
990509318 5:56476046-56476068 GAGGTCAAACTGGTGCAGGCTGG - Intronic
990936219 5:61152805-61152827 GAGTTTGAACTGGTGGAGGCAGG - Exonic
996322906 5:122239409-122239431 GAGAGTAAAATGGTGGTGGCTGG - Intergenic
996949036 5:129102791-129102813 GAAAGGAAACTGCTGGAGGCAGG - Intronic
997723208 5:136097432-136097454 GAGGGAGCACTGATGGAGGGAGG + Intergenic
1000425623 5:161087641-161087663 GAGAGTAGAATGATAGAGGCTGG - Intergenic
1001400167 5:171441666-171441688 GAGTGTAAACTTCTGGAGGGTGG + Intronic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006491942 6:34395105-34395127 GAGGCTTAACTAAAGGAGGCTGG + Intronic
1006829199 6:36958610-36958632 GAGGGTAAAGGCATGGGGGCTGG + Intronic
1006857863 6:37148208-37148230 GGGGGTAAAATGTTGGAGGTGGG + Intergenic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1009735327 6:67669758-67669780 GAGAGGAAAATGATAGAGGCAGG - Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1013207518 6:107958218-107958240 GAGGGAAAACTGAGCGGGGCGGG - Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG + Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015510893 6:134037313-134037335 GAGGGTAAGCCTATGGAGGAGGG - Intronic
1015545955 6:134361514-134361536 CAGGGTAAGGTGATGGAGACAGG - Intergenic
1016205820 6:141467132-141467154 GAGGGGGAAATGATAGAGGCAGG - Intergenic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019125698 6:169838941-169838963 GAGGGTGAAACGATGGATGCCGG + Intergenic
1021294066 7:18882004-18882026 GAGGTTAATCTGATGGTAGCTGG - Intronic
1022948176 7:35308529-35308551 GAGGGTAAAGTGAGGAGGGCAGG + Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025209764 7:57013834-57013856 GAGGGGTCCCTGATGGAGGCTGG + Intergenic
1025662189 7:63563017-63563039 GAGGGGTCCCTGATGGAGGCTGG - Intergenic
1026830423 7:73607058-73607080 GGGGGGAAAGTGATGGAGGATGG - Intronic
1027606466 7:80305825-80305847 AAGGGTGAGCTGTTGGAGGCAGG + Intergenic
1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG + Intronic
1032322468 7:130897627-130897649 GCGGGTCATCTGAGGGAGGCTGG + Intergenic
1032578089 7:133076850-133076872 TAAGATAAACTAATGGAGGCAGG - Intronic
1032787738 7:135213891-135213913 GAGGGTACACTTGTGGAGACAGG - Intergenic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034943203 7:155245222-155245244 GAGGATGAGCTGATGCAGGCAGG - Intergenic
1035407222 7:158607051-158607073 GAAGGTAAGGTGATGGAGGATGG + Intergenic
1042016258 8:64316639-64316661 GAGGGTAACCTGAATGAGTCAGG - Intergenic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1045272876 8:100676832-100676854 GAAGATAAAATGATGCAGGCAGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1051335387 9:16061272-16061294 GATGGAAAACTGAGGCAGGCAGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052156604 9:25200651-25200673 GAGGGTAAAATGAAGAAGCCAGG + Intergenic
1053493119 9:38526547-38526569 GAATGTAAAATGATAGAGGCTGG + Intergenic
1057646074 9:96876488-96876510 AAAGGCAAACTGATGGAGGGAGG - Intergenic
1057673354 9:97115457-97115479 GAATGTAAAATGATAGAGGCTGG + Intergenic
1058342153 9:103911621-103911643 TGGGGTAAACTGATGGATTCAGG + Intergenic
1058748200 9:108012722-108012744 GTGGGTTAAGTGAAGGAGGCAGG - Intergenic
1059139156 9:111835704-111835726 GAGAGTTAACTGATGGAATCAGG - Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187902077 X:24034760-24034782 GAGGGTAAAGCCATGCAGGCAGG + Intergenic
1188013687 X:25084702-25084724 GGGTGTTAACAGATGGAGGCAGG - Intergenic
1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG + Intronic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1194123496 X:89987865-89987887 GAGGGAAAATTGATGGCAGCAGG - Intergenic
1197346948 X:125335723-125335745 GTGGGTAGACTGTTGGAGACAGG + Intergenic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200476381 Y:3645482-3645504 GAGGGAAAATTGATGGCAGCAGG - Intergenic
1201354643 Y:13084146-13084168 GGGGTTAAAGTGATGGTGGCTGG - Intergenic