ID: 1166040097

View in Genome Browser
Species Human (GRCh38)
Location 19:40197096-40197118
Sequence AGGGTAAACTGATGGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166040087_1166040097 17 Left 1166040087 19:40197056-40197078 CCATTGTGTATTACTGCTCCTGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1166040097 19:40197096-40197118 AGGGTAAACTGATGGAGGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 237
1166040090_1166040097 -1 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040097 19:40197096-40197118 AGGGTAAACTGATGGAGGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166040097 Original CRISPR AGGGTAAACTGATGGAGGCT GGG Intronic
900167115 1:1248238-1248260 AGGCTAGACCGAGGGAGGCTGGG + Intergenic
900167198 1:1248501-1248523 AGGCTAGACCGAGGGAGGCTGGG + Intergenic
900167281 1:1248765-1248787 AGGCTAGACCGAGGGAGGCTGGG + Intergenic
900167581 1:1249623-1249645 AGGCTAGACCGAGGGAGGCTGGG + Intergenic
901640198 1:10689158-10689180 AGAGGAGGCTGATGGAGGCTGGG + Intronic
902143802 1:14379581-14379603 AGGGTATATTGATGGTGGCCTGG + Intergenic
903337555 1:22635214-22635236 AGGGGAAACTGAGGGCAGCTCGG - Intergenic
903369229 1:22824568-22824590 AGGGAAGACGGGTGGAGGCTGGG + Intronic
903909327 1:26710860-26710882 AGGTTAAAATGCTTGAGGCTAGG + Intronic
904495983 1:30887005-30887027 AGGGGAAACTGATTAGGGCTAGG - Intronic
907291078 1:53413302-53413324 AGGATAAACTGTCAGAGGCTGGG - Intergenic
907666543 1:56438097-56438119 AGGGGAAACTGGTCCAGGCTGGG + Intergenic
908295213 1:62706455-62706477 TGGGTGAACTGCTTGAGGCTAGG - Intergenic
908446573 1:64203497-64203519 AGGGGAAACTGTTGTAGGATTGG + Intergenic
911541434 1:99162529-99162551 AGGGTGAGCTGAAGCAGGCTGGG - Intergenic
911864661 1:103002565-103002587 AGGGAAAACTGTTTGAGGGTGGG - Intronic
915067931 1:153242316-153242338 AGGGTAAGAGGATGGAGCCTGGG - Intergenic
916657874 1:166893533-166893555 TGGGGAAACTGATGGAGATTTGG - Intergenic
916873465 1:168942243-168942265 AGGCTAATCTGAGGGAGGCTGGG - Intergenic
917509201 1:175656219-175656241 TTGGCAAACTGATGGATGCTTGG - Intronic
917923285 1:179768505-179768527 AGGGGCAAGTGATGGTGGCTGGG + Intronic
919007403 1:191915463-191915485 CTGGTAAACTAATGGAAGCTAGG + Intergenic
921512054 1:216043949-216043971 AAGGGGAACTGATGGAGGATAGG - Intronic
922553220 1:226512600-226512622 AGAGCACACTGATGGAGGCAAGG + Intergenic
923190995 1:231620549-231620571 AAAGTAAACTGATGGCTGCTGGG - Intronic
923998572 1:239525243-239525265 TGGGTGAACTGCTGGAGTCTAGG + Intronic
924524759 1:244835903-244835925 AGATTAAAATGTTGGAGGCTTGG - Intronic
924852625 1:247845629-247845651 AGGCTGCACTGAGGGAGGCTGGG - Intergenic
1062961983 10:1579070-1579092 AGGGTAAACTGAGGCAGTGTGGG - Intronic
1063043053 10:2362567-2362589 ACGGGAGCCTGATGGAGGCTGGG - Intergenic
1066192771 10:33071052-33071074 TGGGTGAACTGATTGAGGCCTGG - Intergenic
1066200150 10:33136699-33136721 AGGGGAAACTGAGGGAGGGATGG + Intergenic
1067332352 10:45333918-45333940 AGGGTGAACTGAGGCAGGGTGGG - Intergenic
1068762108 10:60723913-60723935 AAGGTAAAGAAATGGAGGCTGGG + Intronic
1068991378 10:63154440-63154462 ACGCTAAACTCATGGAGGTTCGG + Exonic
1071397952 10:85241590-85241612 AGGTTAAAGTGATGGAGTCAAGG - Intergenic
1071490327 10:86131875-86131897 TTGGTAAACAGATGGAGGGTGGG - Intronic
1071744280 10:88398279-88398301 AGGGTAAGCAGATGTAGGATTGG + Intronic
1073577343 10:104638115-104638137 TGGGGAAAATGATGGAGGCTGGG + Intergenic
1073886839 10:108049351-108049373 AGGGTAAAGAGATCAAGGCTGGG + Intergenic
1074304269 10:112262322-112262344 AGTGTGATCAGATGGAGGCTGGG - Intergenic
1083503489 11:63133284-63133306 AGGGTAAGCTGAAGCAGGGTGGG - Intronic
1083506961 11:63167028-63167050 AGGGTAAGCTGAAGCAGGGTGGG + Intronic
1084230598 11:67749988-67750010 AGGGTAGCCTGGTGGTGGCTTGG + Intergenic
1084394758 11:68901919-68901941 AGTCAAAACTGATGGAGGTTTGG - Intronic
1084604852 11:70166472-70166494 AGGGTTTCCAGATGGAGGCTGGG + Intronic
1085304011 11:75474947-75474969 AGCCTAAACTGCTGGAGACTAGG - Intronic
1087205118 11:95386364-95386386 AGGATAGACTGGAGGAGGCTGGG + Intergenic
1089051548 11:115550022-115550044 AGGGAAAACTGGAGGTGGCTGGG - Intergenic
1091349129 11:134879081-134879103 AAGATTAACTGATAGAGGCTGGG + Intergenic
1094434879 12:30410273-30410295 AGTTTAAAGAGATGGAGGCTTGG - Intergenic
1095329586 12:40942307-40942329 AGAGGAAGCTGGTGGAGGCTTGG + Intronic
1095601072 12:44013694-44013716 TTGATAAACTGATGGAGGCTCGG - Intronic
1097270778 12:57772592-57772614 AGGGCAAACTCAGGGAGGCGGGG + Exonic
1097349467 12:58532703-58532725 AGGCGAAACTGATGGAGGATTGG - Intergenic
1097898883 12:64853785-64853807 AGGGTAAGCTGAAGCAGGGTGGG - Intronic
1099512686 12:83556525-83556547 AGGGTGAGCTGAAGGAGGGTGGG - Intergenic
1100141842 12:91628521-91628543 AAGGTGAACAGATGGAGGGTAGG + Intergenic
1101823365 12:108201395-108201417 AGGCTAAACTGGAGTAGGCTGGG - Intronic
1101856338 12:108446441-108446463 ATGCTAAGCTGATGCAGGCTTGG - Intergenic
1102655980 12:114482570-114482592 TGGATAACCTGATGGAAGCTGGG - Intergenic
1102680604 12:114687941-114687963 AGGGTAAAAGGATGGTGGGTAGG + Intergenic
1103493353 12:121340853-121340875 AGACAAAAGTGATGGAGGCTGGG - Intronic
1104863727 12:131940256-131940278 CAGGTAAACTGATTGAGCCTAGG - Intronic
1107293734 13:38887893-38887915 AGGGTAAACTGGTTTAGGATTGG + Intergenic
1107853412 13:44591976-44591998 AGGGGAAGCTGAGGGTGGCTGGG + Intergenic
1113507373 13:110826501-110826523 AGGGTCAATTGATGGTGGATGGG + Intergenic
1115648032 14:35383887-35383909 AGGGTAAACTGAGGGAGGGAGGG + Intergenic
1116789200 14:49321712-49321734 AGAGAAAGATGATGGAGGCTTGG + Intergenic
1117882202 14:60323246-60323268 AGGGTGAAGGGATTGAGGCTTGG - Intergenic
1119741687 14:77017892-77017914 AGGGGGAACTGAAGGAGTCTAGG - Intergenic
1120673153 14:87387631-87387653 GGGTTAAACTGATGGTGGCCAGG - Intergenic
1121698692 14:95934716-95934738 AGAGCAAACTGCTGGAGGCCAGG + Intergenic
1124591112 15:31053834-31053856 AGTGTCCACTGATGGATGCTTGG + Intronic
1125137293 15:36358304-36358326 ATAATAAACTGATGAAGGCTTGG - Intergenic
1125219479 15:37317224-37317246 AGGGTGAACTGAAGCAGGGTGGG + Intergenic
1125361529 15:38869648-38869670 AGGCTAAACTTATGGAGGTGGGG - Intergenic
1125537008 15:40446903-40446925 AAGCTGCACTGATGGAGGCTAGG - Intronic
1126314368 15:47353658-47353680 AAGATAAACTGCTGGAGCCTGGG + Intronic
1127754823 15:62081885-62081907 AGAGTAAGATGATGGAGACTGGG + Intergenic
1127871583 15:63078306-63078328 AATGTAAACTGCTGGGGGCTGGG + Intergenic
1129332939 15:74837059-74837081 AGAGTAACCTGAGGGAGGCTGGG + Exonic
1131196367 15:90358511-90358533 AGGGTGAGGTCATGGAGGCTTGG + Intronic
1131261334 15:90889570-90889592 AGGGTGAACCGCTGGAGCCTGGG + Exonic
1131671127 15:94620531-94620553 AGGCCAAACAGATGGAGGCAGGG - Intergenic
1133203105 16:4216784-4216806 AGGGGAAAGGGATGCAGGCTGGG + Intronic
1133780629 16:8936303-8936325 AAGGTGAACTGATGGGGGCGGGG - Intronic
1134063405 16:11212235-11212257 GGGGTAAAGGGATGGGGGCTAGG - Intergenic
1134669855 16:16046897-16046919 AGCTTAAACTGATGCAGGCCAGG + Intronic
1134905528 16:17976635-17976657 AGGGTAAAGTGTTGCAGGCAAGG - Intergenic
1135185833 16:20315052-20315074 AGGGTAACTTGGTGGAGGTTAGG - Intronic
1138189194 16:55000394-55000416 AGGGTAAGGTGATGGCAGCTTGG - Intergenic
1140217563 16:73020738-73020760 AGGGTAAAGTCAGGGAGGCACGG + Intronic
1140404322 16:74698110-74698132 AGGGAGAATTGATTGAGGCTGGG + Intronic
1141846925 16:86616732-86616754 AGGGCAAACTGCTTGAGCCTAGG - Intergenic
1142691918 17:1611788-1611810 CCGGTAAACTGATGCAGGCGAGG + Intronic
1142821898 17:2475751-2475773 AGAGCAAACTGATGGAGTCTGGG + Intronic
1143913488 17:10271719-10271741 AAGGTAAAAAGATGCAGGCTGGG + Intergenic
1145109286 17:20147806-20147828 AGGGAAAATTGCTGGAGGCCTGG + Intronic
1147180333 17:38680693-38680715 AAGGTTAAATGATGGTGGCTGGG - Intergenic
1149932250 17:60768434-60768456 ATGGGAAAATGATGTAGGCTGGG - Intronic
1150201567 17:63362557-63362579 AGGGTAGGCTGAGGGTGGCTTGG - Intronic
1152025225 17:77804669-77804691 AGGGAAAACTGTGGGAGCCTGGG - Intergenic
1155272655 18:24155860-24155882 AGCATAAACTGATGGAAACTGGG - Exonic
1155384848 18:25266596-25266618 AGGGCAAGCTGATGCAGGGTGGG + Intronic
1157519052 18:48332610-48332632 AGGGTAAACTGATAGAATTTTGG - Intronic
1160359349 18:78258184-78258206 ATGGTAAACTGATGCAGCATGGG + Intergenic
1160775060 19:851570-851592 TGGGTAAACTGAGGCAGGCGAGG + Intronic
1161098836 19:2410148-2410170 TGGGGAAACTGAGGGAGGCTTGG + Intronic
1162073877 19:8171750-8171772 AGGGGAAACTGAGGCAGCCTGGG - Intronic
1163675466 19:18653537-18653559 AGGGTAGACTGATGGAAGGGTGG - Intronic
1163784729 19:19269223-19269245 AAGGTAAATTGAGGCAGGCTAGG - Intronic
1165525399 19:36350371-36350393 AGGGAAAACTACTTGAGGCTAGG + Intronic
1165717625 19:38056511-38056533 GGGGTAAACTGACGAAGGATGGG - Intronic
1166040097 19:40197096-40197118 AGGGTAAACTGATGGAGGCTGGG + Intronic
1166935674 19:46330943-46330965 AGGATAAATGGATGGAGGTTGGG + Intronic
1167594023 19:50418156-50418178 AGAGGAAACTGAGGCAGGCTTGG - Intronic
925835160 2:7937797-7937819 AGGGGAGAATGATGTAGGCTAGG - Intergenic
926825165 2:16898904-16898926 AGGATAAGCAGATGGAGGCTGGG + Intergenic
927593846 2:24379931-24379953 ACATAAAACTGATGGAGGCTCGG - Intergenic
927801142 2:26100970-26100992 AGGGTAAAGTGTTGGAGAATGGG + Intronic
927944840 2:27129438-27129460 AGGGGAAACTGAGGAAGGATAGG - Intronic
929030879 2:37649012-37649034 GGGGTCAGCTGATGGAGGCAGGG + Intronic
930443147 2:51434606-51434628 AAAGTAAAGGGATGGAGGCTGGG + Intergenic
933479931 2:82843467-82843489 AGGGAAAACTGATGGAAGGCCGG - Intergenic
934112840 2:88758278-88758300 TGGGGGAACTGATGGAGGCTTGG + Intergenic
936743783 2:115548627-115548649 ATGGTAAATTCATGGAGGCAAGG - Intronic
938042779 2:128090133-128090155 ATGGAACACTGATGGAGGCCGGG - Intergenic
938249897 2:129806507-129806529 TGGGGAAGCTGAAGGAGGCTGGG - Intergenic
939241941 2:139572639-139572661 ATGCTAAAGTGAAGGAGGCTTGG + Intergenic
940074952 2:149731440-149731462 AAGGAAACCTGAAGGAGGCTTGG + Intergenic
940166174 2:150775310-150775332 ATGGTAAACTGATGGACTTTAGG + Intergenic
940956993 2:159738927-159738949 AGGGGGAACTGAGGGTGGCTTGG - Intronic
940992358 2:160110747-160110769 AGGGTGGCCTGGTGGAGGCTTGG - Intronic
944347293 2:198684601-198684623 AGGGTGAGCTGAAGAAGGCTGGG + Intergenic
944614159 2:201443014-201443036 AGGTGAAACTGATGGAGGATAGG - Intronic
945785186 2:214225399-214225421 GGGGAAAGCTGATGGATGCTTGG + Intronic
946098902 2:217301884-217301906 GGGGTAAACTGAGTGAGGCTTGG - Intronic
1169852097 20:10063660-10063682 AGGGTCACATGAGGGAGGCTAGG - Intergenic
1170452074 20:16493369-16493391 AGGGTAAACTTCTGCAGCCTTGG - Intronic
1170586639 20:17739765-17739787 AGGGTTGGCTGATGTAGGCTGGG - Intergenic
1170727424 20:18942150-18942172 AGGGTAAGCTGAAGCAGGGTGGG - Intergenic
1172387701 20:34545760-34545782 GGGGAGAACTGATGGTGGCTTGG + Intergenic
1173062858 20:39679002-39679024 AGGGTACAGGGATGGAGTCTGGG - Intergenic
1173396258 20:42683040-42683062 GGTGTAAAGTGTTGGAGGCTAGG - Intronic
1175199785 20:57268892-57268914 AGGGTGAGGTGATGGAGGGTGGG + Intergenic
1175533629 20:59691876-59691898 AGGGTCAAAAGCTGGAGGCTTGG - Intronic
1177103423 21:16923603-16923625 ATAATAAGCTGATGGAGGCTAGG - Intergenic
1181956020 22:26588846-26588868 AGGGTTATCACATGGAGGCTAGG + Intronic
1183260935 22:36795441-36795463 AGGGGAAACTGAAGGAGGGTAGG + Intergenic
949226887 3:1705532-1705554 AGGGTGAACTGAAGCAGGGTGGG + Intergenic
951617706 3:24566885-24566907 AGGGTGAACTGAAGCAGGCGGGG + Intergenic
951988754 3:28651585-28651607 AGAGTTAACTAATGGTGGCTTGG + Intergenic
952279299 3:31907937-31907959 AGGCTACAGTGTTGGAGGCTGGG + Intronic
952408210 3:33024600-33024622 AGGGTAAACAGCAGAAGGCTAGG + Intronic
952458192 3:33494455-33494477 AGGGTACAATGATGGGAGCTAGG - Intergenic
952480487 3:33755872-33755894 AGAATAAATTGATAGAGGCTGGG + Intergenic
952887531 3:38020761-38020783 AGAGTGAACTGAAGGAAGCTGGG + Intronic
954498883 3:50990750-50990772 ATGGGAGAATGATGGAGGCTGGG + Intronic
955292973 3:57709643-57709665 TGGGCAAACTAATGGAGTCTGGG + Intergenic
956301988 3:67781910-67781932 AGGGTGAACTGAAGCAGGGTGGG - Intergenic
957047161 3:75385008-75385030 AGGGTAGCCTGGTGGTGGCTTGG + Intergenic
958484730 3:94690331-94690353 AGTGTAAACTCAAGGAGGATGGG + Intergenic
959601689 3:108193918-108193940 AGGATAGACTAATGGGGGCTGGG + Intronic
960242954 3:115366829-115366851 AGAGTAAACAGATGGTGGATTGG + Intergenic
961020335 3:123500581-123500603 TGGGTAAACTGATGGAATATAGG + Exonic
961406719 3:126684931-126684953 AGGCAAAAGTGGTGGAGGCTTGG + Intergenic
961723292 3:128909842-128909864 AGGGAAAACAGAAGGTGGCTGGG + Intronic
962372314 3:134830964-134830986 AGAGAAAGCTGATGGAGGGTAGG - Intronic
962765634 3:138560208-138560230 AGGGCAAACCGAAGGAGGGTGGG + Intronic
964165777 3:153703771-153703793 TGCTTAATCTGATGGAGGCTGGG + Intergenic
964693466 3:159480473-159480495 AGAGTAAAATGATGATGGCTTGG + Intronic
965743472 3:171900768-171900790 AGGGGAAACGGGGGGAGGCTTGG + Intronic
966141298 3:176759489-176759511 AAAATAAACTGATGGAGACTTGG - Intergenic
966241150 3:177756675-177756697 AGGGTAAAGTGATCGAGGACAGG - Intergenic
966493641 3:180556137-180556159 AGGGTAACCTGAAGCAGGGTAGG + Intergenic
967455454 3:189680946-189680968 AGGGTACACTGGTGAAGGCCTGG + Intronic
968951467 4:3696532-3696554 AGTGTAAACTCATGGCTGCTGGG + Intergenic
970093818 4:12439484-12439506 AGGGTATACTGATGGATGAGAGG + Intergenic
972181038 4:36466068-36466090 ATGGTAAACTGATTGTGGCTTGG - Intergenic
972547038 4:40089730-40089752 AGGAAAAACTGATCGTGGCTGGG - Intronic
974491716 4:62572210-62572232 AGGGTAAGCTGAAGCAGGGTGGG - Intergenic
980881059 4:138710258-138710280 TGGGTAATGTAATGGAGGCTGGG - Intergenic
981564947 4:146090553-146090575 AGGCTAAACTTTTGGAGGTTGGG + Intergenic
981795030 4:148585891-148585913 AGGGTAAGCTGAAGCAGGGTGGG - Intergenic
983024902 4:162724517-162724539 AGGGTAAACAGATGGGGGCTGGG - Intergenic
984802700 4:183729496-183729518 TGGGTAGACTGATAGAGCCTAGG + Intergenic
986006563 5:3673304-3673326 AGGGTAAATTCAGGGAGTCTTGG + Intergenic
986241427 5:5963418-5963440 AGGGTGAACTGAAGCAGGCAGGG + Intergenic
986805127 5:11301967-11301989 TGGGTAAACTGGAGGAGGGTGGG + Intronic
991949916 5:71937785-71937807 AGGAAAAACGGATGGAGGCATGG - Intergenic
992530655 5:77648681-77648703 AGGGGAAAATGATGGCTGCTTGG + Intergenic
996090483 5:119346244-119346266 AGTGGAAGCTGCTGGAGGCTGGG + Intronic
997895752 5:137715397-137715419 TGGGTATACTTATGGAGGCCTGG - Intronic
999121815 5:149215652-149215674 AGGGGAAACTGATGGATGTTAGG - Intronic
999770727 5:154773713-154773735 AGAGGAAACTAATGGAGGGTGGG + Intronic
999844322 5:155461833-155461855 ATTGTAAGCTGCTGGAGGCTGGG + Intergenic
999933216 5:156456182-156456204 TGGGATAACGGATGGAGGCTAGG + Intronic
1001602870 5:172940238-172940260 AGGAAAAACTGTTGTAGGCTAGG - Intronic
1003558939 6:7165280-7165302 AGTGTGGACTGTTGGAGGCTAGG + Intronic
1005979780 6:30828122-30828144 TGGGTCAACAGATGGAGGCAGGG + Intergenic
1006491943 6:34395106-34395128 AGGCTTAACTAAAGGAGGCTGGG + Intronic
1006829200 6:36958611-36958633 AGGGTAAAGGCATGGGGGCTGGG + Intronic
1010003835 6:70974316-70974338 AGGGCAAACTGAAGCAGGGTGGG + Intergenic
1015545954 6:134361513-134361535 AGGGTAAGGTGATGGAGACAGGG - Intergenic
1015861836 6:137689552-137689574 AAGTTCAACCGATGGAGGCTGGG - Intergenic
1015873460 6:137799889-137799911 AGGTTGAACTGGTGGAAGCTTGG + Intergenic
1019071975 6:169354149-169354171 AGGGTGAGCTGAAGGAGGGTGGG - Intergenic
1020314292 7:6894017-6894039 AGGGTAGCCTGGTGGTGGCTTGG + Intergenic
1022067866 7:26879301-26879323 AGGGTTAACTGATTCAGGCCAGG + Intronic
1022640425 7:32177638-32177660 AGGGTAAGCTGATTTAGGATTGG - Intronic
1024998603 7:55295207-55295229 AGGGTGAACTGAAGCAGGGTGGG - Intergenic
1025209765 7:57013835-57013857 AGGGGTCCCTGATGGAGGCTGGG + Intergenic
1025662188 7:63563016-63563038 AGGGGTCCCTGATGGAGGCTGGG - Intergenic
1026531251 7:71199441-71199463 AGGGTAAACAGATGGATGAATGG - Intronic
1026830422 7:73607057-73607079 GGGGGAAAGTGATGGAGGATGGG - Intronic
1027606467 7:80305826-80305848 AGGGTGAGCTGTTGGAGGCAGGG + Intergenic
1028569717 7:92273614-92273636 AGGGAAAACAGATGGAAGATGGG + Intronic
1031853311 7:126891694-126891716 AGGGAGAACTGATGTAGCCTAGG - Intronic
1032322469 7:130897628-130897650 CGGGTCATCTGAGGGAGGCTGGG + Intergenic
1032663917 7:134016016-134016038 AGGGTAAAGTGAAGGAGTCAAGG + Intronic
1032842223 7:135723350-135723372 AGGGCAAGCTGATGGAGGGCTGG - Intronic
1035768342 8:2126771-2126793 AGGAGAGGCTGATGGAGGCTGGG + Intronic
1035850108 8:2910538-2910560 GAGGTAAACTGAGGGAGGCTAGG + Intergenic
1036289422 8:7474127-7474149 AGGGTAAAAAGATGGGTGCTGGG + Intronic
1036755447 8:11468027-11468049 AGGGCAAGCTGCTGGTGGCTTGG - Intronic
1038150746 8:24941127-24941149 AGTGTAAACTCATGGGGGCGAGG - Intergenic
1042627243 8:70771207-70771229 AGGGTAAGCTGAAGCAGGGTGGG - Intronic
1044826949 8:96207875-96207897 AGGGAACAATGATGGTGGCTTGG - Intergenic
1048003915 8:130402799-130402821 AGGTAAGAATGATGGAGGCTTGG - Intronic
1048745635 8:137611655-137611677 AGGCTGAACTGTTGGAGTCTGGG + Intergenic
1048986084 8:139735808-139735830 AGAGAAAGCTGATGAAGGCTTGG + Intronic
1051787543 9:20761719-20761741 AGAGTAAAAAAATGGAGGCTTGG - Intronic
1051814242 9:21087069-21087091 AGGGTAAGCAGAAGGAGGGTGGG + Intergenic
1053148036 9:35725257-35725279 AGGGTATATGGCTGGAGGCTGGG - Exonic
1053264646 9:36701939-36701961 AGAGAAAACTGATGGAGGCCAGG - Intergenic
1058380223 9:104369799-104369821 ATGGTAAATTAATGGAGGCTTGG + Intergenic
1058805165 9:108583501-108583523 TGGGTGAACAGATGGAGGCCAGG - Intergenic
1059260953 9:112976194-112976216 AGGGAAGACTGCTTGAGGCTAGG + Intergenic
1060782850 9:126425839-126425861 AGGATAAAATGATGGTCGCTTGG + Intronic
1061589362 9:131588737-131588759 AGGGTAAACTGAGAAAGGCACGG + Intronic
1061740808 9:132704422-132704444 AAGTTAAATGGATGGAGGCTGGG - Intergenic
1189632465 X:42969584-42969606 ATAGGAAACTGATGAAGGCTGGG + Intergenic
1189719387 X:43899741-43899763 AGGGAACAGTAATGGAGGCTGGG + Intergenic
1190632476 X:52401242-52401264 AGGGTAAACTCTTGGAGTCCAGG - Intergenic
1193591512 X:83393493-83393515 AGGGAAAATTGAGAGAGGCTAGG + Intergenic
1194884879 X:99301716-99301738 AGGGTTATGTGATGGAGGATGGG + Intergenic
1195129692 X:101840223-101840245 AGGGCACACTGGAGGAGGCTTGG + Intronic
1195176546 X:102319606-102319628 AGGGCACACTGGAGGAGGCTTGG - Intronic
1195182318 X:102367487-102367509 AGGGCACACTGGAGGAGGCTTGG + Intronic
1195202413 X:102564298-102564320 AGGGCACACTGGAGGAGGCTTGG - Intergenic
1198725865 X:139676294-139676316 AGGGTGAACTGAAGCAGGGTGGG - Intronic
1198871813 X:141183933-141183955 TGGGTAAACTCATGGATACTAGG - Intergenic
1199715563 X:150505325-150505347 AGGGTGAAGGGATGGAGGGTGGG - Intronic
1200405948 Y:2811579-2811601 AGGGTAAGCTGAAGCAGGGTGGG - Intergenic
1200765390 Y:7076608-7076630 ATGATAAAATGATAGAGGCTGGG + Intronic
1201681775 Y:16653871-16653893 AGTTTGAATTGATGGAGGCTAGG + Intergenic