ID: 1166040098

View in Genome Browser
Species Human (GRCh38)
Location 19:40197105-40197127
Sequence TGATGGAGGCTGGGCTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 23, 3: 98, 4: 539}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166040090_1166040098 8 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040098 19:40197105-40197127 TGATGGAGGCTGGGCTCAGCTGG 0: 1
1: 0
2: 23
3: 98
4: 539
1166040093_1166040098 -6 Left 1166040093 19:40197088-40197110 CCAGCTGGAGGGTAAACTGATGG 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1166040098 19:40197105-40197127 TGATGGAGGCTGGGCTCAGCTGG 0: 1
1: 0
2: 23
3: 98
4: 539
1166040087_1166040098 26 Left 1166040087 19:40197056-40197078 CCATTGTGTATTACTGCTCCTGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1166040098 19:40197105-40197127 TGATGGAGGCTGGGCTCAGCTGG 0: 1
1: 0
2: 23
3: 98
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166040098 Original CRISPR TGATGGAGGCTGGGCTCAGC TGG Intronic
900274639 1:1816344-1816366 ATATGTAGGATGGGCTCAGCAGG - Intronic
900319646 1:2076218-2076240 TGCTCGAGTGTGGGCTCAGCAGG + Intronic
900434091 1:2619210-2619232 TGACCTAGGTTGGGCTCAGCTGG - Intronic
900954738 1:5879618-5879640 TGCTCTAGGCTGGGCTCTGCAGG - Intronic
901190154 1:7405081-7405103 TGTTGGAGGCTGGTCTCTGTGGG + Intronic
901245041 1:7723636-7723658 TGATGGAGGCTGACCTCTCCAGG + Intronic
901505681 1:9683905-9683927 TGACGAAGGTTGGGCTCAGGTGG + Intronic
901677136 1:10892086-10892108 TGATGGTGGCTCGGCCCAGGCGG - Intergenic
902099121 1:13971037-13971059 TGATTTAGGCTGTGCTCAGCAGG + Intergenic
902276074 1:15340426-15340448 TGATCTAGACTGGCCTCAGCTGG + Intronic
902609394 1:17588299-17588321 GGAGGGAGGCGGGGCTCAGCAGG + Intronic
902732546 1:18378826-18378848 TGATCTAATCTGGGCTCAGCTGG + Intergenic
902749747 1:18499478-18499500 TGATGGAGGTGGCTCTCAGCAGG - Intergenic
902856725 1:19211543-19211565 AGATGCAGGCTGGGCGCAGTGGG - Intergenic
903003926 1:20285997-20286019 TGATCCTGGCTGGGCTCTGCTGG + Intergenic
903082790 1:20825151-20825173 GGAGGGAGGCTGACCTCAGCTGG - Exonic
903270428 1:22185126-22185148 TGATGGAGGCTTTGCACACCTGG - Intergenic
903745905 1:25586409-25586431 TGATGGACGCTGGTGTCTGCAGG - Intergenic
904415744 1:30360153-30360175 GGCTGGAGGATGGGCTGAGCAGG - Intergenic
904755841 1:32768114-32768136 AGCTGGAGGCAGGGCTCACCTGG - Exonic
904818877 1:33227479-33227501 GGCTGAAGGCTGGGCTTAGCTGG - Intergenic
905318753 1:37100656-37100678 TGATCTAGGCTGGGCTTTGCTGG - Intergenic
905370824 1:37481910-37481932 AGCTGGGGGCTGGGCTCTGCGGG + Intronic
905533006 1:38696820-38696842 TGATCCAGGCTGGGCTTAGCTGG + Intergenic
905670697 1:39788570-39788592 GCAAGGAGGCTGGGCTCGGCGGG + Exonic
906096288 1:43226391-43226413 TCTGGGAGGCTAGGCTCAGCTGG + Intronic
906662143 1:47590583-47590605 AGAGGGAGGCTGGGGTCAGGGGG + Intergenic
906733527 1:48103140-48103162 TGATGGAGTCTGGGCTTTGTGGG + Intergenic
906860503 1:49353909-49353931 TGATGGAGGTGGCTCTCAGCAGG - Intronic
907663581 1:56415385-56415407 TGATGGTGGCTGGGCCCAGGGGG - Intergenic
907700815 1:56786220-56786242 TGATCTGGGCTGGGGTCAGCTGG - Intronic
908398140 1:63745139-63745161 TGATCTAGGATGGCCTCAGCTGG - Intergenic
909396021 1:75171689-75171711 TGGTGAAGGCTGGGGTGAGCAGG + Intergenic
910112641 1:83699136-83699158 GGATTTAGGCAGGGCTCAGCTGG - Intergenic
910424222 1:87102475-87102497 TGTTGGAGGCTGGGCTTGGTGGG - Intronic
911014469 1:93317557-93317579 CAATCTAGGCTGGGCTCAGCTGG - Intergenic
911068617 1:93814167-93814189 TGGTGGAGGCTGTCCTCTGCTGG + Intronic
911169279 1:94754275-94754297 TGACGGAGGATGAGCTGAGCTGG + Intergenic
912429355 1:109620906-109620928 TGATGGTGGCTGGGCCTGGCGGG - Exonic
913085770 1:115435183-115435205 TGATGGATGCTGTTTTCAGCTGG + Intergenic
914916049 1:151819860-151819882 GGATGGAGGATGGGCTGACCAGG - Intronic
915007435 1:152652494-152652516 TGACCTAGGCTGGGCTCAGCTGG - Intergenic
915023726 1:152806449-152806471 TGAAGGAGGATGTGCTCAGGAGG - Intronic
915038389 1:152947431-152947453 TGTGGGAGGCTGGGCTGAGCAGG + Intergenic
915109549 1:153554343-153554365 TGGTGGAGACTAGCCTCAGCTGG - Intergenic
917048502 1:170891089-170891111 GGATGGATGCTGTGCTCAGCTGG + Intergenic
917839375 1:178965033-178965055 GGATTCAGGCAGGGCTCAGCTGG - Intergenic
917964183 1:180168119-180168141 TGGGAGAGGCTGGGCACAGCAGG + Intronic
918011666 1:180592623-180592645 TGCTGAAGGATGGGTTCAGCTGG - Intergenic
919052943 1:192533738-192533760 TGATGGTGGCTTGGCTCAAATGG + Intergenic
919429990 1:197480747-197480769 TGACTGAGGCCGGGTTCAGCAGG - Intergenic
919503974 1:198374505-198374527 CAATCTAGGCTGGGCTCAGCTGG - Intergenic
919782289 1:201228749-201228771 GGAGGGAGGGTGGGCACAGCTGG + Exonic
919878774 1:201888973-201888995 TGGTGGGGGCTGGGCGCGGCCGG - Exonic
920219691 1:204387763-204387785 TGATGGAGGCTTGGACCAGGGGG - Intergenic
920377633 1:205517759-205517781 TGATGGTGGCTGGGACCAGCGGG - Intronic
920446145 1:206020350-206020372 TGATGAAGGCTGTGCCCTGCTGG + Intronic
920515778 1:206583858-206583880 TGCTGGTGGCTGGCATCAGCTGG + Intronic
920631739 1:207659305-207659327 AGCCGGAGGCTGGTCTCAGCAGG + Intronic
921253703 1:213320777-213320799 TGATTGAGGCTGAGGTCAGATGG - Intergenic
922467007 1:225851233-225851255 TGATGAGGGCAGGGATCAGCCGG - Intronic
923105857 1:230853156-230853178 TGATCGGAGCAGGGCTCAGCTGG - Intronic
923362616 1:233226554-233226576 TGATGGAGGCTGGGCATGGTGGG - Intronic
924476073 1:244382991-244383013 TGATGGTGGCTGGGACCAGCAGG + Intronic
924665601 1:246068491-246068513 TGATGGATGCAGAGCTCAGGAGG + Intronic
924890744 1:248276187-248276209 TGAAGGAGGCAGAGCTCAGTGGG + Intergenic
1063469847 10:6275462-6275484 TGATGGAGTCAGGCCTCTGCCGG + Intergenic
1064104348 10:12488827-12488849 TGACGGAGGCGGAGCTCAGGCGG + Intronic
1064648486 10:17484395-17484417 TGCAGGAGGCTGAGCTCAGCAGG - Intergenic
1065129046 10:22602004-22602026 TGACGGAGGCTTGGCTCACTGGG + Intronic
1065356043 10:24842757-24842779 TGTTGGAGGTGGGGCTCAGTGGG - Intergenic
1065768499 10:29054589-29054611 TGATTCAGGCTGGGCTTAGCTGG + Intergenic
1066200935 10:33142258-33142280 GTTTGGTGGCTGGGCTCAGCTGG - Intergenic
1066620361 10:37343410-37343432 TGGAGAAGGTTGGGCTCAGCTGG - Intronic
1066623678 10:37384256-37384278 TGGAGAAGGCTGGGCTCAGCTGG - Intergenic
1067661487 10:48239204-48239226 TCATTTAGGCTGTGCTCAGCTGG - Intronic
1068121453 10:52785604-52785626 TCATGGATGCAGGGCTGAGCTGG + Intergenic
1069548806 10:69348007-69348029 TGGGGGAGGCTGGGCACAGAGGG - Intronic
1069695837 10:70384762-70384784 TATTTGAGGCTGGGCTTAGCTGG + Intergenic
1069706269 10:70460601-70460623 TGATGGTGGCTGGGACCAGGTGG - Intergenic
1069872635 10:71542595-71542617 GCAGGGAGGCTGAGCTCAGCAGG + Intronic
1070732120 10:78837264-78837286 TGATGCAGGTTGGCCTCGGCTGG - Intergenic
1070960052 10:80492401-80492423 TGGTGGACACTGGGCTCAGCAGG + Intronic
1071204655 10:83260080-83260102 TGATCTAGGCTGGGCTCAGCAGG - Intergenic
1071259460 10:83906947-83906969 GGCTGGAGGCTGGGCTCAGCTGG - Intergenic
1071270513 10:84002526-84002548 GCTAGGAGGCTGGGCTCAGCTGG - Intergenic
1071275784 10:84053679-84053701 TGATGGAGTCTGGGCCAAGTTGG - Intergenic
1071328964 10:84541914-84541936 TTGTCAAGGCTGGGCTCAGCAGG - Intergenic
1071516810 10:86303446-86303468 TGACAGAGACTGTGCTCAGCAGG + Intronic
1071523055 10:86342643-86342665 TCCTGGAGGATGGGCCCAGCTGG - Intronic
1072725178 10:97808276-97808298 TAATGGGATCTGGGCTCAGCTGG + Intergenic
1073008001 10:100339445-100339467 TGATGGAGGGTGGGGTCATGGGG - Intergenic
1073115505 10:101089545-101089567 TGGTGGAGGCAGGGGTCAGAGGG - Exonic
1073443005 10:103564028-103564050 TGCCCTAGGCTGGGCTCAGCTGG - Intronic
1073458539 10:103652314-103652336 TGGGGGAGCCAGGGCTCAGCAGG - Intronic
1075016977 10:118917010-118917032 TGATCTAGGCTGGGCACAGATGG - Intergenic
1075446300 10:122515812-122515834 TGATGAGGGCTGTGCTCAACTGG - Intergenic
1075550044 10:123385647-123385669 CCATCTAGGCTGGGCTCAGCAGG + Intergenic
1075844966 10:125538056-125538078 GGATTCAGGCAGGGCTCAGCCGG + Intergenic
1076783127 10:132735434-132735456 TGCTGGAGGCTGGGGGCAGGCGG + Intronic
1077030060 11:461491-461513 GGATGGAGGGTGAGCTCATCTGG - Intronic
1077065684 11:640087-640109 TGGGGGAGGCTGGGCGCGGCGGG - Exonic
1077108349 11:851473-851495 AGAAGGAGCCTGGGCTCAGGAGG - Intronic
1077285049 11:1761907-1761929 TGATGGGGGCTGGGTACAGTGGG - Intronic
1077631749 11:3816026-3816048 TGATAGTGGCTGAGGTCAGCTGG - Intronic
1078056926 11:8016678-8016700 ACTTGAAGGCTGGGCTCAGCTGG + Intergenic
1078926680 11:15881453-15881475 TGATTTAGGCTGGGCTCAGCTGG - Intergenic
1079660918 11:23035579-23035601 TGATGGAGGTGGCTCTCAGCAGG - Intergenic
1080995330 11:37593141-37593163 CTATGTGGGCTGGGCTCAGCCGG + Intergenic
1081523732 11:43908421-43908443 TGCTAGTGACTGGGCTCAGCTGG + Intronic
1081685703 11:45041688-45041710 TGGGGGAGGCTGGCCCCAGCTGG - Intergenic
1081872364 11:46389310-46389332 TCCTGGCGGCTGGGCTGAGCCGG + Intergenic
1082267452 11:50134847-50134869 CACTGGAGGCTGGGATCAGCTGG + Intergenic
1082288635 11:50343719-50343741 CACTGGAGGCTGGGATCAGCTGG - Intergenic
1083491581 11:63018163-63018185 TGACGGAGGCAGGGCTCTTCTGG - Intergenic
1084339746 11:68488646-68488668 TGATGGTGGCTGGACACATCAGG + Intronic
1084374307 11:68765436-68765458 TGATGGCGGCTGGTCACAGTGGG - Intronic
1084709890 11:70837353-70837375 AGATGGAGGGTAGGCACAGCAGG - Intronic
1084858382 11:72003119-72003141 TCCTGGTGGCTGGGCCCAGCAGG - Exonic
1085321600 11:75577554-75577576 CACTGGATGCTGGGCTCAGCTGG + Intergenic
1088128256 11:106455516-106455538 TGATGCAGGCTCAGCTCAGCAGG - Intergenic
1088397502 11:109384768-109384790 TGATTTAGGATGGGCTCATCTGG + Intergenic
1088402703 11:109438750-109438772 TGATGGAGAATGAGCTCACCAGG + Intergenic
1088423883 11:109679343-109679365 TGATTGAGGCTGGGCCAAGTAGG + Intergenic
1088436548 11:109819501-109819523 TGATTTAGGCTGGGCTTGGCTGG + Intergenic
1089001986 11:115059846-115059868 TGCTGGAGGCTGGGCAGTGCAGG - Intergenic
1089112831 11:116070832-116070854 TGATGGAGACAAGGCTGAGCAGG + Intergenic
1090357018 11:126147068-126147090 CGATAGAGGCTGGGCTTGGCTGG - Intergenic
1090829583 11:130411570-130411592 AGATGGAGGCTGGGCACCGTGGG - Exonic
1092208710 12:6632613-6632635 TGCTGGAGGCTCAGCACAGCTGG - Intronic
1092451565 12:8607166-8607188 TGATGGATTCCAGGCTCAGCAGG - Intronic
1093112154 12:15165159-15165181 TAATGCAGCCAGGGCTCAGCAGG - Intronic
1093769108 12:22999003-22999025 TGATGGAGGTGGTGCTCAGCAGG - Intergenic
1093805548 12:23428928-23428950 TGACCCAGGCTGGGCTCGGCTGG + Intergenic
1094284316 12:28775523-28775545 AGATCTAGGCTGAGCTCAGCGGG + Intergenic
1095730284 12:45498930-45498952 ATATGTAGGCTGGGCACAGCAGG - Intergenic
1095990097 12:48028605-48028627 TGATGGGGGCTGCCCTGAGCTGG + Intergenic
1096378275 12:51132843-51132865 TGTTTGATGCTGGGCTCTGCTGG - Intronic
1096980255 12:55724490-55724512 TGGTGGATGCTGTGCTCACCTGG + Exonic
1097240167 12:57569651-57569673 AGCTGGAGGCTGAGCTGAGCCGG + Exonic
1098917922 12:76276314-76276336 AGCTGGAAGCTGTGCTCAGCTGG - Intergenic
1099243259 12:80163605-80163627 TGATCTCAGCTGGGCTCAGCTGG + Intergenic
1099509642 12:83518021-83518043 TGATGGAGGTGGCTCTCAGCGGG - Intergenic
1100228564 12:92584121-92584143 TGATTTAGGCTGAGCTCAGCTGG - Intergenic
1100810396 12:98331520-98331542 TCATCTGGGCTGGGCTCAGCCGG - Intergenic
1101522317 12:105495358-105495380 TGATGGAGCCTGGGCTCAGTGGG + Intergenic
1101574763 12:105987236-105987258 TGCTGTGGACTGGGCTCAGCTGG + Intergenic
1101802682 12:108035911-108035933 TGATCTAGGCTGGGGTCAGCTGG - Intergenic
1102436504 12:112928499-112928521 TGATCCAGGCTGGGCTCAGCTGG + Intronic
1102524732 12:113504099-113504121 TGATCCAGACTGGGCCCAGCTGG - Intergenic
1102656618 12:114487397-114487419 ACTTGGAGGCTGGGCTCACCTGG + Intergenic
1102657665 12:114496467-114496489 TGCTCATGGCTGGGCTCAGCTGG + Intergenic
1102800896 12:115732771-115732793 TCTAGAAGGCTGGGCTCAGCTGG + Intergenic
1103293550 12:119867024-119867046 GCTTGGAGGCTGGGCCCAGCTGG - Intronic
1103880500 12:124162536-124162558 TAATCCAGGCTGGCCTCAGCAGG - Intronic
1103896010 12:124273756-124273778 TGATCTAGGCTGACCTCAGCAGG + Intronic
1103984368 12:124757532-124757554 TGATTGAGGCTGGGCTTGGCTGG - Intergenic
1104393070 12:128407571-128407593 TGATGCAGGATGGCCTCAGCTGG + Intronic
1104464556 12:128979804-128979826 TGAGGTAGGCTGGGCTAAGCCGG - Intronic
1104750279 12:131234040-131234062 TGCTGGTGGCTCGGCTGAGCTGG - Intergenic
1104756664 12:131273725-131273747 GGATGGAGGGTGGGCTGGGCAGG + Intergenic
1104782439 12:131430421-131430443 TGCTGGTGGCTGGGCTGAGCTGG + Intergenic
1105740691 13:23319955-23319977 GGAGGGAGGTTGGCCTCAGCTGG - Intronic
1106603842 13:31209418-31209440 TGCTGGAGGCTGGAGCCAGCTGG + Intronic
1106769348 13:32946623-32946645 TGATGGAGGCAGGGCATAGTGGG + Intergenic
1106837022 13:33645403-33645425 TGATTCGGGCTGAGCTCAGCTGG - Intergenic
1106989109 13:35395246-35395268 TGTTGGAGGTTGGGCTCGGTGGG + Intronic
1107907408 13:45074069-45074091 TGTTGGAGGCGGGGCTTAGTGGG - Intergenic
1108346459 13:49551342-49551364 TGATGTGTGCTGGGCTTAGCAGG + Exonic
1110996935 13:82122406-82122428 CTGTGTAGGCTGGGCTCAGCTGG - Intergenic
1111881733 13:93965802-93965824 TGATTTTGGCTGGGCTCAGCTGG - Intronic
1112283389 13:98082410-98082432 TGAGGGAGGGTGGTCTTAGCGGG + Intergenic
1112310873 13:98316547-98316569 TGCTGGAGGCTGAGCTCTCCAGG - Intronic
1112820754 13:103332146-103332168 AGATGGAGGAGGGGCTGAGCAGG + Intergenic
1113531657 13:111031960-111031982 GGATGGAGGAAGGGGTCAGCTGG + Intergenic
1113584803 13:111457934-111457956 TGATGGAGGCGGGGCGCTGGGGG + Intergenic
1113734705 13:112670356-112670378 GGATGGAGGCTGGGATCCTCAGG - Intronic
1113747727 13:112756608-112756630 TGGTGGCGGCTGAGCTCAGGTGG + Intronic
1113957131 13:114104997-114105019 AGATGGAAGCTGGGCTCGGGGGG - Intronic
1114276462 14:21150147-21150169 TGGAGAAGGCTGGGCTCAGCTGG + Intergenic
1114535761 14:23421259-23421281 TGATGGGGCCTGGGCTCTACAGG + Intronic
1114537261 14:23430823-23430845 TGCTTGTGGCTGGACTCAGCTGG - Intronic
1114616562 14:24071682-24071704 TTATGGAGACTGGGCCAAGCTGG - Intronic
1114664283 14:24368962-24368984 TGATGCGTGCTGGGCCCAGCCGG - Intronic
1115961418 14:38838422-38838444 TCAGGGAGCCTGGGCTGAGCAGG + Intergenic
1116795372 14:49384593-49384615 TGGTGGGGGCGGGGCTCAGGGGG - Intergenic
1117289210 14:54316222-54316244 TGATGGAGGGTGGCATCAGCTGG - Intergenic
1118535071 14:66753374-66753396 TGCTCCAGGCTGGGCTCAGCTGG - Intronic
1119867852 14:77989075-77989097 AGATCTGGGCTGGGCTCAGCTGG + Intergenic
1121279187 14:92687382-92687404 TGAAGGAGGCTGGGCGCAGTCGG - Intronic
1121620195 14:95341358-95341380 TGATGTAGGATGGGCTCAGCTGG + Intergenic
1122767913 14:104084524-104084546 TGAAGGAGGGTGGGCTCTGTAGG + Intergenic
1122844029 14:104480973-104480995 TGATTCAGGCTGGGCCCATCTGG + Intronic
1122960082 14:105090256-105090278 TGAAGAGGGATGGGCTCAGCTGG + Intergenic
1123084733 14:105712180-105712202 TGAGCTAGGCTGGGCTGAGCTGG - Intergenic
1123109637 14:105859896-105859918 TGAGCTAGGCTGGGCTGAGCGGG - Intergenic
1123136324 14:106030804-106030826 TTATGGAGGCTGCGCTCTGAGGG + Intergenic
1123192768 14:106586806-106586828 CCATGGAGTCTGGGCTGAGCTGG - Intergenic
1123197638 14:106631633-106631655 CCATGGAGTCTGGGCTGAGCTGG - Intergenic
1123200429 14:106658158-106658180 TGATGGAGTTTGGGCTGAGCTGG - Intergenic
1123222261 14:106868072-106868094 TCATGGAGTCTGGGCTGAGCTGG - Intergenic
1124249528 15:28097742-28097764 TGATGGATGGTGGGATCAGTGGG - Intronic
1125284876 15:38081868-38081890 TGATTAGGGCTGGGCTCATCTGG + Intergenic
1125531254 15:40414999-40415021 TGAGGGAAGCTGGGCTCTGTCGG + Intronic
1125624505 15:41096262-41096284 TGATGGAGGCTGCACTGAGCTGG - Exonic
1125627957 15:41124437-41124459 TGATGTTGGCTGGGCTCCGTGGG - Intergenic
1126081256 15:44964873-44964895 TAATGGTGGCTGGGCGCAGTGGG + Intronic
1127690178 15:61387687-61387709 TAATGTAGGCTGGGCTCATCTGG + Intergenic
1127895153 15:63291949-63291971 TGATAAAGGCTGGGATCAGCTGG - Intronic
1128151186 15:65364466-65364488 CCCTGGAGGCTGAGCTCAGCAGG - Intronic
1129464164 15:75714556-75714578 GGATGGAGGCTGTGCTAGGCTGG + Intergenic
1129510952 15:76122057-76122079 TGATTTAGGCTAGGCACAGCTGG + Intronic
1129741178 15:77990338-77990360 TGCCGGAGGCTGGGCTGTGCTGG + Intronic
1129844536 15:78762214-78762236 TGCTGGAGGCTGGGCTGTGCTGG - Intronic
1130049072 15:80468248-80468270 AGATGGAGGCTGGGACCAGCAGG - Intronic
1130206492 15:81880342-81880364 TTATGTAGGCTGGTCTCAGCTGG + Intergenic
1130257286 15:82331649-82331671 TGCTGGAGGCTTGGCTGTGCTGG + Intergenic
1130560557 15:84955105-84955127 ACTTGCAGGCTGGGCTCAGCTGG - Intergenic
1130597664 15:85258340-85258362 TGCTGGAGGCTGGGCTGTGCTGG - Intergenic
1130992179 15:88882135-88882157 TGCTGTAGGATGGCCTCAGCTGG - Intronic
1131648689 15:94375290-94375312 TGGTGGAGGTGGGGCCCAGCAGG - Intronic
1131741772 15:95400596-95400618 TGATGTAGGTGGGGCTCAGCTGG + Intergenic
1131952351 15:97694611-97694633 ACAAGGAGGCTGGGTTCAGCGGG + Intergenic
1132143689 15:99414500-99414522 TGATGCAGGCTGGACTCGCCCGG - Intergenic
1132543438 16:521981-522003 TGATGGGGTCTGGGCCCACCCGG - Exonic
1132906731 16:2286324-2286346 TGATGGAGGGTGAGCAGAGCAGG - Intronic
1133014750 16:2934169-2934191 AGGGGGAGGCTGGGCTGAGCAGG - Intronic
1133025566 16:2987668-2987690 TCAGAGAGGCTGGGCACAGCTGG + Intergenic
1133270400 16:4608510-4608532 TGCTGGAGGCCGGGCTCAGAGGG + Intergenic
1133428854 16:5718328-5718350 TGACTTAGGCTGGGCTCAGCTGG - Intergenic
1133984754 16:10660170-10660192 TGAGGGAGGCTGGGCTAGGGTGG - Intronic
1134616014 16:15651388-15651410 TGATGGAGGCTGGGGTGGTCGGG - Intronic
1134692951 16:16203083-16203105 TAATGTGGGCTGGGCTCAGCTGG - Intronic
1134978897 16:18591612-18591634 TAATGTGGGCTGGGCTCAGCTGG + Intergenic
1135609548 16:23854405-23854427 TAATTTGGGCTGGGCTCAGCTGG + Intronic
1135909951 16:26551043-26551065 GGGTGGAGGCTGGGCTGAGCTGG + Intergenic
1135978097 16:27124425-27124447 TTCCGGAGGCTGGGCTCAGGGGG - Intergenic
1135994894 16:27240436-27240458 TGATGGATGCTGGGCTGAGCTGG - Intronic
1135994902 16:27240469-27240491 TGATGGATGCTGGGGTGGGCTGG - Intronic
1136139775 16:28281323-28281345 TGAGGGAGGCTTGGCTGAGCTGG - Intergenic
1137388465 16:48061419-48061441 GGATCGAGGCTGGGGACAGCTGG - Intergenic
1137722932 16:50638432-50638454 TGTTGGGGGCTGGGTGCAGCTGG - Exonic
1138212874 16:55177990-55178012 TGATCTAGGCTGGGCTCAGCTGG + Intergenic
1138375536 16:56561258-56561280 TGATGGTGGCTGGAATCAGGTGG + Intergenic
1138381374 16:56605162-56605184 GGCTGGAGGCTGGGCTCAGCTGG - Intergenic
1138686145 16:58727576-58727598 TAATGCAGGCTGGGCACTGCAGG + Intronic
1141125807 16:81400109-81400131 CAATGTGGGCTGGGCTCAGCTGG - Intergenic
1141225873 16:82114422-82114444 TGAGGCAGGTTGGCCTCAGCAGG + Intergenic
1141293231 16:82740569-82740591 TGATCTAGGCTGGGCTCAGCTGG + Intronic
1141715767 16:85725966-85725988 GTATGGAGGCCGGGCTGAGCTGG - Intronic
1141808182 16:86356025-86356047 TAATCCAGGTTGGGCTCAGCTGG + Intergenic
1142103339 16:88287412-88287434 TGGAGGTGGCTGGGCTCCGCTGG - Intergenic
1142191569 16:88720588-88720610 TGATGGCGGCCGGGGGCAGCTGG - Intronic
1142203078 16:88770326-88770348 TGATGCAGGCGGGGCCCGGCTGG - Intronic
1142252808 16:89000468-89000490 CGATGAAGGCTGGGCTGTGCAGG - Intergenic
1142973001 17:3625512-3625534 GGCTGGAGGCTGGGCTCACCTGG - Intronic
1143082897 17:4394632-4394654 GGATGGGGGCTAGGCTTAGCTGG - Intergenic
1143108854 17:4542558-4542580 AGGTGCAGGCTGGGCTGAGCAGG + Intronic
1143668051 17:8375965-8375987 GGAAGGAGGCTGGTTTCAGCTGG - Exonic
1143735634 17:8910365-8910387 TGATGGAGGCTAAGCTCATAGGG - Intronic
1144092402 17:11869856-11869878 TGTTGAGGGCAGGGCTCAGCTGG + Intronic
1144669554 17:17125296-17125318 GGATGGAGGCTGGGCTCACAGGG - Intronic
1144685972 17:17226721-17226743 TGATGGAGGCTGGGGGCAGTGGG - Intronic
1145243169 17:21251461-21251483 TGGTGCTGGCAGGGCTCAGCTGG - Intronic
1145994536 17:29097828-29097850 TGATGGAGGCCCGTCTCATCCGG - Exonic
1146650922 17:34605752-34605774 TGCTTTAGGCTGGGTTCAGCTGG + Intronic
1146915511 17:36676004-36676026 GGGAGGAGTCTGGGCTCAGCTGG - Intergenic
1147038010 17:37696060-37696082 TGTTGGAGGTGGGGCTCAGTGGG + Intronic
1147191160 17:38738941-38738963 AGAAGGTGGCTGGGCTCACCTGG - Intronic
1147606621 17:41777313-41777335 AGGGGGAAGCTGGGCTCAGCAGG + Intronic
1147626110 17:41901232-41901254 TGATCAAGGCTGGGCACAGGTGG - Intronic
1148070108 17:44903804-44903826 TGAAGGAGGCAGGGGTCAGAGGG - Exonic
1148166392 17:45486824-45486846 TCAGGGAGGCAGGGCTCAGATGG + Intronic
1148632058 17:49118658-49118680 TGATCTAGGCTGGGCTTAGCTGG + Intergenic
1148758624 17:49987803-49987825 TGGTAGAAGATGGGCTCAGCAGG + Intergenic
1148867456 17:50635968-50635990 TGCTGGAGGCTGGAGTCAGCAGG - Intronic
1149806182 17:59620019-59620041 GGGGGGAGGCTGGGCTCAGCAGG - Exonic
1150397563 17:64833224-64833246 TCAGGGAGGCAGGGCTCAGATGG + Intergenic
1150473308 17:65455925-65455947 GGATGGAGGCTGGGGTCCCCAGG + Intergenic
1150605869 17:66690338-66690360 TGGTGGAGACTGGGGTGAGCTGG + Intronic
1150806239 17:68321381-68321403 ATGTGGAGGCTGGGCTGAGCTGG + Intronic
1151338262 17:73453289-73453311 TGATTTAGGCTGGGCTTGGCTGG - Intronic
1151804453 17:76396914-76396936 TGATGGCGACTGGGCTCATGAGG + Intronic
1151836743 17:76586821-76586843 TGAAGGAGGCGGAGCTCAGGCGG + Intronic
1152339768 17:79717667-79717689 TGAGGTCGGCTGGGCTGAGCTGG + Intergenic
1152401963 17:80071762-80071784 TGAGGGAGGCTGGGCTGAGCCGG + Intronic
1152625003 17:81384064-81384086 TGGGGGAAGCTGGCCTCAGCTGG + Intergenic
1152721140 17:81924347-81924369 TGGTGGGAGCTGGGCTGAGCTGG - Intronic
1152754229 17:82080426-82080448 GGGTGGGGGCTGGGCTCTGCTGG + Exonic
1152813028 17:82391155-82391177 TGTTGGAAGCTGGGCTCTCCTGG - Intronic
1153595400 18:6720274-6720296 TCAGGGAGGCAGGGCTCACCTGG - Intergenic
1153845218 18:9043290-9043312 GACTGGAGGCTGGGCTCAGGTGG - Intergenic
1153969760 18:10215586-10215608 CCATGGAGGCTGGGGGCAGCGGG - Intergenic
1154345964 18:13543854-13543876 TGTTGGAGGTAGGGCTCAACAGG - Intronic
1155322081 18:24629609-24629631 AGATGGAGGCTGACCTCAGCTGG - Intergenic
1155358200 18:24974104-24974126 TGATTCAAGCTGGGCTCAGCTGG - Intergenic
1155601736 18:27556759-27556781 CAATGTAGGCTGAGCTCAGCAGG + Intergenic
1156267481 18:35501662-35501684 TGAGGGAGGAGGGGCACAGCTGG - Intergenic
1156460094 18:37316775-37316797 TGAGGGAGGCAGGGCTAGGCTGG - Intronic
1156678235 18:39557371-39557393 TGTTGGAGGCGGAGCTCAGGGGG + Intergenic
1156874091 18:41985069-41985091 TGATAAAGGGTGGGCTTAGCCGG - Intronic
1157157538 18:45282398-45282420 TGATCTATGATGGGCTCAGCTGG + Intronic
1158458727 18:57629675-57629697 TGATGTGGGCTGAGTTCAGCTGG - Intergenic
1160096937 18:75882064-75882086 TGAGAGAGGCGGGGCTCAGGTGG + Intergenic
1160426052 18:78780020-78780042 TGGAGGAGGCTGGGGTCAGAGGG + Intergenic
1160588592 18:79927230-79927252 AGCTGCAGGCAGGGCTCAGCAGG + Intronic
1161361460 19:3852315-3852337 TGGTGGAGGTGGGCCTCAGCTGG + Intronic
1161635712 19:5387641-5387663 TAATGGAAGCTGGGCTTTGCAGG + Intergenic
1162416047 19:10538187-10538209 TGATGGATGCTGGACCCAGGAGG + Intergenic
1163183505 19:15620255-15620277 TGATTTAGGATGGCCTCAGCTGG + Intronic
1163274790 19:16276806-16276828 GAATGGAGGCTGGGGCCAGCGGG - Intergenic
1164311398 19:24049492-24049514 TTCTGGGGGCTGGGCTCAGGCGG - Intronic
1164653683 19:29904231-29904253 TAATTGAGGCTGTGCTCTGCAGG - Intergenic
1165124728 19:33585906-33585928 TGATGTAGGGTGGGAACAGCTGG - Intergenic
1165771900 19:38385127-38385149 AGAGGGAGGCTGGTCCCAGCTGG - Intronic
1165803862 19:38568447-38568469 TGAGGGAGGCTGGGCACGGTGGG + Intronic
1166040098 19:40197105-40197127 TGATGGAGGCTGGGCTCAGCTGG + Intronic
1166752882 19:45173046-45173068 GGATGGAGGCCTGGCGCAGCAGG + Intronic
1167306216 19:48711333-48711355 GCATGAAGGCTGGGCCCAGCTGG - Intergenic
1167693295 19:51000392-51000414 TGATGGGGGCAGAGGTCAGCTGG - Intronic
1168681996 19:58322830-58322852 TGATCTGGGCTGGGCTCAGCTGG - Intergenic
925414527 2:3660071-3660093 TGTTGGAGGTGGGGCCCAGCGGG + Intronic
925655520 2:6143972-6143994 AGACCTAGGCTGGGCTCAGCTGG + Intergenic
925834513 2:7930964-7930986 TGATGGAAACGGGGCTCGGCAGG - Intergenic
926286493 2:11492879-11492901 TGCTGGGGGCTGGTCACAGCTGG + Intergenic
927146865 2:20171919-20171941 TGGCCCAGGCTGGGCTCAGCAGG - Intergenic
927577038 2:24208675-24208697 TGAAGGAAGCTGGGAACAGCGGG + Intronic
928201386 2:29249763-29249785 CCACGGAGGCTTGGCTCAGCAGG + Intronic
928654825 2:33439750-33439772 TGGAGGAGGCTGGGTTCAGAAGG + Intronic
929192225 2:39150156-39150178 GGTAGGAGCCTGGGCTCAGCTGG - Intergenic
930479056 2:51924262-51924284 TGTTGGAGGCTGGGCTTAGTGGG + Intergenic
931746476 2:65295648-65295670 TTGGGGAGGCTGGGCTCTGCTGG + Intergenic
933049799 2:77589730-77589752 TGATGGGGGCTGGGTCCAGGTGG + Intronic
933258743 2:80108514-80108536 TGAATGAGCATGGGCTCAGCAGG - Intronic
934112841 2:88758287-88758309 TGATGGAGGCTTGGCTAACATGG + Intergenic
934516872 2:94993845-94993867 TGAGGGAGGCTGGGCAGAGGTGG + Intergenic
934819552 2:97360335-97360357 TGACTGAGGCTGGGCAGAGCGGG - Intergenic
936714008 2:115162932-115162954 GGAGGGAGGCTGCGCTGAGCCGG + Intronic
937130574 2:119509238-119509260 TGATCCAGGCTGGGCTCTCCCGG - Intronic
937311529 2:120906060-120906082 GGCAGGAGGCTGGGCTCAGGTGG - Intronic
937325954 2:120989670-120989692 TGATGGTGCTGGGGCTCAGCTGG - Exonic
937484068 2:122295558-122295580 TGTTGGTGGCAGGGCTCATCTGG - Intergenic
937712108 2:124990008-124990030 TGATTGTGGCTGGCTTCAGCAGG - Intergenic
937953977 2:127408713-127408735 TGGAGGAGGCGGGCCTCAGCTGG - Intergenic
937956130 2:127422705-127422727 GGATGGAGGCTGGGCGCGGGCGG + Intronic
938069666 2:128301784-128301806 CCATGGAGGCTGGGCCCAGCGGG - Intronic
939466262 2:142561568-142561590 TGATGGAGGCAGGGGCCATCTGG + Intergenic
939590849 2:144061977-144061999 TGATGGAGGTGGCTCTCAGCAGG - Intronic
939676038 2:145072775-145072797 TGCTGGATTCTGGGCACAGCAGG + Intergenic
939929766 2:148218210-148218232 TCATCCAGGCTGGGCTCAGCTGG + Intronic
940659105 2:156524351-156524373 TGAGGATGGATGGGCTCAGCTGG + Intronic
940905232 2:159163236-159163258 TGAAGGAGGCCAGGCACAGCTGG - Intronic
941372356 2:164681268-164681290 TGATCTAGGCTGGCCTCAGTTGG + Intronic
941802388 2:169674289-169674311 TGATCTAGGCTGGAATCAGCTGG - Intronic
942385286 2:175436378-175436400 AAATAGAGGCTGGGCTCAACTGG - Intergenic
943683759 2:190794732-190794754 TGCTAAAGGCTGGGCTTAGCTGG - Intergenic
945377565 2:209097035-209097057 TGATGGAGGTGGCTCTCAGCAGG - Intergenic
945708179 2:213261898-213261920 TGATTTAGGCTAGGTTCAGCTGG - Intergenic
945992941 2:216412084-216412106 TGATGGCAGCCGGGCGCAGCGGG + Intergenic
946414998 2:219535660-219535682 TGGTGGAGGCTGCCCTCAACAGG + Intronic
946609405 2:221441463-221441485 TGATGGAGGTGGCTCTCAGCGGG - Intronic
947107203 2:226679948-226679970 CGAAGGAGGCTGTGCTCAGCTGG + Intergenic
947519882 2:230837421-230837443 TGATGTAGGCTGGGCTTAGTGGG - Intergenic
948682972 2:239648825-239648847 TGGTGGCAGCTGGGCCCAGCGGG + Intergenic
948856662 2:240733417-240733439 TGATGGTGGCTGGGCTGAGGAGG - Intronic
948870824 2:240797100-240797122 TGTGGCTGGCTGGGCTCAGCGGG - Intronic
949007047 2:241655685-241655707 TGTTGGAGGCTGCCCTCCGCGGG + Intronic
1169197381 20:3690620-3690642 TTCTGTGGGCTGGGCTCAGCTGG - Intronic
1169298547 20:4421745-4421767 TGATCTCGGCTGGACTCAGCTGG - Intergenic
1169391452 20:5194514-5194536 GGATGGAGGCTGTTCTCATCTGG + Exonic
1169741628 20:8901224-8901246 TAATCTAGGCTGGGCTCAGTTGG + Intronic
1169848420 20:10022340-10022362 TGATCTTGGCTGAGCTCAGCTGG + Intronic
1169848432 20:10022419-10022441 TGATCTAGGATGGCCTCAGCTGG + Intronic
1169856251 20:10106514-10106536 TAATGTGGGCTGGGCTCAGCTGG - Intergenic
1169866066 20:10201493-10201515 TGGTTGAAGCTGGCCTCAGCAGG + Intergenic
1170148901 20:13207164-13207186 TGACCTAAGCTGGGCTCAGCTGG + Intergenic
1170396101 20:15927000-15927022 GGATGGAGGATGGCCCCAGCCGG + Intronic
1170396270 20:15929119-15929141 TGATGTAGGCTGGGCTCAGTGGG + Intronic
1170414844 20:16128648-16128670 CAATGTGGGCTGGGCTCAGCTGG + Intergenic
1170586637 20:17739756-17739778 TGATGTAGGCTGGGCTCAGTGGG - Intergenic
1170647789 20:18212346-18212368 TAACTGAGGCTGGGCTCAACTGG + Intergenic
1170711134 20:18792094-18792116 CCATGTAGGCTGAGCTCAGCTGG - Intergenic
1171294060 20:24001937-24001959 TCATCTGGGCTGGGCTCAGCTGG + Intergenic
1171416003 20:24980848-24980870 TGATGGAGGCCGAGCGAAGCTGG - Intronic
1171445140 20:25197334-25197356 TGCTGGAGGGTGGCCTCAGCAGG + Intronic
1171521024 20:25774391-25774413 TGCAGGAGCCTGGGCTGAGCAGG - Exonic
1171961845 20:31500432-31500454 TGCTGGAGGCTGGAATCACCAGG + Intergenic
1172434633 20:34920461-34920483 AAATGGAGGCTGGGCAGAGCTGG - Intronic
1173148827 20:40548549-40548571 GGCTGGAAGCTGGACTCAGCTGG - Intergenic
1173312478 20:41910728-41910750 TGACTGGGGCTGGGTTCAGCTGG + Intergenic
1173753315 20:45493576-45493598 TGATCTAGGCTGGGCTCAGCTGG + Intergenic
1173887984 20:46478790-46478812 TGCTGGTGGCTGGGCCCTGCTGG + Intergenic
1173920296 20:46739632-46739654 TGTTTGAGGCTGAGCTCATCAGG - Intergenic
1174119239 20:48249905-48249927 TGAGGGAGGCTCAGCTCGGCAGG + Intergenic
1174122298 20:48275309-48275331 GGATCCAGGCTGGGCTCTGCTGG + Intergenic
1174305334 20:49610848-49610870 GGATGGCGGCTGGGCTTGGCGGG + Intergenic
1175191911 20:57217063-57217085 GGATGGAGGCAGGACTCAGCTGG + Intronic
1175813026 20:61868890-61868912 AGCTGGAGGCTTGGCTCAGTGGG - Intronic
1176123643 20:63465438-63465460 TGATGGAGTGTGGGCCCTGCAGG - Intronic
1176199528 20:63854215-63854237 TGAAGGAGCCTGGGCTAAACTGG + Intergenic
1176232743 20:64040392-64040414 TGGACGTGGCTGGGCTCAGCTGG + Intronic
1176863206 21:14025803-14025825 AAATTTAGGCTGGGCTCAGCTGG - Intergenic
1177905116 21:26965500-26965522 CGATGGAGGCCAGGGTCAGCAGG + Exonic
1178094301 21:29197515-29197537 TGATGGAGGTGGCTCTCAGCAGG - Intronic
1179628406 21:42661494-42661516 TGAAGGAGGCCAGGCACAGCAGG - Intronic
1180255846 21:46626894-46626916 ACATGAAGGCTGGGCTCACCTGG + Intergenic
1181260179 22:21591773-21591795 CGAAGGAGGCAGGGCTCAGCTGG + Intronic
1181512379 22:23394705-23394727 AGATGGTGGCACGGCTCAGCAGG - Intergenic
1181614036 22:24039621-24039643 TGTTGGATGCTGGGCCCACCTGG - Intronic
1181659965 22:24339121-24339143 GGATGGGGCCTGGGCTCAGCAGG + Intronic
1181821285 22:25477645-25477667 TGAGCCAGGCTGGGCTCAGCTGG + Intergenic
1182054197 22:27337066-27337088 TGATTGAGACTGGCCTCAGTGGG + Intergenic
1182079067 22:27516368-27516390 TGATCTAGGATGGCCTCAGCTGG - Intergenic
1182420400 22:30245981-30246003 TGGTGGGGGCCGGGGTCAGCGGG + Intronic
1182427992 22:30284990-30285012 GGCTGGGGGCTGGGCTCACCTGG - Intergenic
1182794040 22:32977382-32977404 TGAGGCAGGGTGAGCTCAGCTGG + Intronic
1182934942 22:34211920-34211942 GGATTGAGACAGGGCTCAGCTGG + Intergenic
1183001019 22:34859186-34859208 TAATTAGGGCTGGGCTCAGCTGG + Intergenic
1183330767 22:37219880-37219902 GGTTGGAGGCTGGGCTCAGCTGG + Intergenic
1183408035 22:37639926-37639948 TGGGGGAGGCTGGGGACAGCTGG + Intronic
1183658996 22:39207379-39207401 GGAAGAAGGCTGGGCACAGCGGG - Intergenic
1183861461 22:40673394-40673416 TGGTGGGGGCTGAGCGCAGCAGG + Intergenic
1184205354 22:42998975-42998997 TGATGGAGGTGGCTCTCAGCAGG - Intronic
1184379686 22:44137576-44137598 CAATTTAGGCTGGGCTCAGCTGG + Intronic
1184402131 22:44280421-44280443 CGCTGGGGACTGGGCTCAGCAGG - Intronic
1184418142 22:44363985-44364007 GGATGGAGGATGGGGTGAGCAGG - Intergenic
1184425946 22:44409416-44409438 TGAGGGCTGCTGGGCTCAGCAGG - Intergenic
1184845738 22:47084465-47084487 TGCAGGAGGCGGGGCCCAGCAGG + Intronic
1185380712 22:50506435-50506457 GGTGGGAGGCTGGCCTCAGCGGG + Exonic
949512046 3:4774911-4774933 TGATGGAAGCTGGGGTGGGCAGG + Intronic
950205595 3:11077899-11077921 TGATCTAGGATGGCCTCAGCTGG - Intergenic
950259028 3:11530605-11530627 TGCTGGAGGGTGGGGTCAGGAGG - Intronic
950637255 3:14323827-14323849 TGATGGAGGATGGGAACTGCAGG + Intergenic
950656023 3:14436850-14436872 TGATGGAGACGGGGCTCAGGAGG - Intronic
950668557 3:14511770-14511792 TGCTGGGGGATGGGCTGAGCAGG - Intronic
950907745 3:16554344-16554366 TGACATAGGCAGGGCTCAGCTGG - Intergenic
951265121 3:20556190-20556212 TAATTGAGGCTGTGCTCAACAGG + Intergenic
951365579 3:21777951-21777973 TGATCAAGGCTTGGCTCAGCTGG - Intronic
951550230 3:23869971-23869993 AGTTTGGGGCTGGGCTCAGCTGG + Intronic
951838843 3:27011835-27011857 TGACTGAGGCTGGGCTCAGCTGG + Intergenic
952377350 3:32778895-32778917 AGAGGGAGACTGGGCTGAGCAGG - Intergenic
952745802 3:36777594-36777616 TGATTTAGGCAGGGCTCAGATGG + Intergenic
953207673 3:40846110-40846132 CCATCTAGGCTGGGCTCAGCTGG - Intergenic
954001753 3:47563106-47563128 AGAGGAAGGCCGGGCTCAGCAGG - Intronic
954789294 3:53119330-53119352 TGGTGGAGCCTGTGCTCTGCTGG + Intronic
955038720 3:55293754-55293776 TGATGGAGGTAGGGCTCAGCGGG - Intergenic
955588357 3:60506785-60506807 TGGTCTTGGCTGGGCTCAGCTGG - Intronic
956686245 3:71830793-71830815 TGATCTAGGCTGGGCCCATCTGG - Intergenic
957181335 3:76882031-76882053 TGTGGGTGGCTGGGCTCAGCAGG + Intronic
959773252 3:110125347-110125369 TGATGGAGGTTGCTCTTAGCGGG - Intergenic
960395410 3:117131192-117131214 TGATGGAGGCGGCTCTCAGTGGG - Intronic
960814450 3:121658562-121658584 TGATGTGGGCTGGGCCCACCTGG + Intronic
961029109 3:123586341-123586363 TGAGGGAGGCGGAGCTCAGGAGG + Intergenic
961064755 3:123865997-123866019 ACTTGAAGGCTGGGCTCAGCTGG - Intronic
961540407 3:127595564-127595586 AGATGGTGGATGGGGTCAGCTGG - Intronic
962087282 3:132205011-132205033 TGATCTAGGCTGGGCTCTGCTGG + Intronic
962443271 3:135442872-135442894 GGATGAAAGCTGGGATCAGCTGG - Intergenic
963318397 3:143785528-143785550 CAATTTAGGCTGGGCTCAGCTGG - Intronic
963764511 3:149320213-149320235 TGATGGAAGCAGTGCTCAGCAGG + Exonic
964247170 3:154667005-154667027 TGGTGGAGGCGGCTCTCAGCAGG + Intergenic
966220544 3:177546889-177546911 TGATCGAGACTGGACTCAGCTGG + Intergenic
966819596 3:183914429-183914451 AGATGAAGGCAAGGCTCAGCAGG + Intergenic
968410116 4:383269-383291 AAATTTAGGCTGGGCTCAGCCGG - Intronic
968477673 4:820120-820142 AGCTGCAGGCTGGGCTGAGCTGG - Intronic
968477684 4:820160-820182 AGCTGCAGGCTGGGCTGAGCTGG - Intronic
968477695 4:820200-820222 AGCTGCAGGCTGGGCTGAGCTGG - Intronic
968477706 4:820240-820262 AGCTGCAGGCTGGGCTGAGCTGG - Intronic
968510132 4:991899-991921 GGATGGACGCTGGGCCCTGCTGG + Intronic
968966053 4:3769595-3769617 GGATCTGGGCTGGGCTCAGCAGG - Intergenic
969028372 4:4192276-4192298 GCTGGGAGGCTGGGCTCAGCCGG - Intronic
969097725 4:4746619-4746641 TGTTTTAGGCTGGGCTCAGCTGG + Intergenic
969316303 4:6383248-6383270 TGCTGGAGGCTGGGCTTGGCCGG - Intronic
969350419 4:6595015-6595037 TGATGGAGGCCGCTCCCAGCAGG - Intronic
969475252 4:7418772-7418794 CAATGTGGGCTGGGCTCAGCTGG + Intronic
969521942 4:7683356-7683378 TGATCTTGTCTGGGCTCAGCTGG + Intronic
969521947 4:7683389-7683411 TGATCTTGTCTGGGCTCAGCTGG + Intronic
970408008 4:15782031-15782053 CGATGGCTCCTGGGCTCAGCTGG + Intronic
970543546 4:17103771-17103793 TGATCCAGGCAGGACTCAGCTGG + Intergenic
971013324 4:22462871-22462893 TCCTGGTGGCTGGGCTCAGCTGG + Intronic
971287392 4:25303669-25303691 TGGTTTTGGCTGGGCTCAGCTGG - Intergenic
973745457 4:53959496-53959518 TGAGGGAGGCCGGGCTGAGAGGG - Intronic
974935155 4:68402957-68402979 TGAGGAAGGCTGGGCACAGTGGG + Intergenic
974999438 4:69202949-69202971 TGATGGTAGCTGGACTCCGCAGG + Intronic
975717179 4:77216387-77216409 TGAAGGTGGCTGAGCTCAGGTGG + Intronic
977270801 4:94915829-94915851 TGCTGGAGGCTGGGCCTAGTGGG + Intronic
980241209 4:130178350-130178372 TGATGGAGAGGAGGCTCAGCAGG - Intergenic
982253279 4:153428631-153428653 TGGTGGAGTCTGGGCCCTGCAGG - Intergenic
982375238 4:154682606-154682628 TGATGGAGGCTGGCCTCTCTGGG - Intronic
983781436 4:171674698-171674720 TGATGGAGGTGGCTCTCAGCAGG - Intergenic
984180933 4:176481344-176481366 TGAAGAATGCTGGGCTCAACCGG + Intergenic
984644840 4:182208782-182208804 TGGTGGAGTCTGGGCTCTGCAGG - Intronic
985125850 4:186693640-186693662 CGATTTGGGCTGGGCTCAGCTGG - Intronic
985559839 5:579457-579479 AGATGGAGGCTGAGCTATGCGGG + Intergenic
985583372 5:712089-712111 AGATGGATGCTGGGCTCTGAGGG + Exonic
985596885 5:796387-796409 AGATGGATGCTGGGCTCTGAGGG + Exonic
985670999 5:1206657-1206679 TGATGGGGGCTTGGCTCTGCTGG + Intronic
985723168 5:1501325-1501347 TGGTGGACGCTGGGCTCAGAAGG + Intronic
986083385 5:4417373-4417395 TGATATAGGCTGGACTCAGCCGG + Intergenic
986691680 5:10318562-10318584 TGATGTAGACTGGGCTTGGCTGG - Intergenic
987044171 5:14090951-14090973 TGATCCAGGCTGGGCTCAGCTGG - Intergenic
987242004 5:16009718-16009740 TAATACAGACTGGGCTCAGCTGG + Intergenic
987491897 5:18592183-18592205 TACTGGAGGCTGGACTCATCTGG + Intergenic
987902787 5:24035344-24035366 TGTTGAAGGCTGGGGTCAGTTGG - Intronic
987926590 5:24350186-24350208 TGATGGAGGTGGCTCTCAGCAGG + Intergenic
988861177 5:35281633-35281655 GGATGGTGGCTGGGGTCTGCTGG + Intergenic
991352222 5:65731109-65731131 TGATGTAGGATGGCCACAGCTGG + Intronic
991725374 5:69530576-69530598 TGTTGGAGTCTGGCATCAGCTGG + Intronic
992160086 5:73992640-73992662 TGATGGAGGTGGCTCTCAGCAGG + Intergenic
993085674 5:83360768-83360790 TTATCTAGACTGGGCTCAGCTGG - Intergenic
994097648 5:95861485-95861507 TCATGAATGCTGGGCTCATCAGG - Intergenic
995312962 5:110734209-110734231 TGATGTTGGCTGGGTTCACCTGG + Intronic
996672532 5:126135090-126135112 TGATGGAGGTGGTTCTCAGCAGG + Intergenic
998406212 5:141876197-141876219 TCCTGGAGGCTGGGCGCTGCCGG - Intronic
998765275 5:145479422-145479444 TGATGTATGCTGGGCTCTGCAGG - Intronic
1000852873 5:166362102-166362124 TGATGGAGGTGGCTCTCAGCAGG + Intergenic
1001392261 5:171388391-171388413 TCCTGGAGGCTGGGTTCACCGGG + Intronic
1001419515 5:171575868-171575890 TATTCTAGGCTGGGCTCAGCTGG - Intergenic
1001784407 5:174399602-174399624 TCAGGAGGGCTGGGCTCAGCAGG + Intergenic
1001847300 5:174933637-174933659 GCATGTAGGCTGGGCTTAGCTGG + Intergenic
1001854397 5:174998521-174998543 TGACTTAGGCTGGGCTCAGCTGG + Intergenic
1001867192 5:175116067-175116089 TGAAGGAAGCTGGGCTCAAAAGG - Intergenic
1002290496 5:178197121-178197143 TGGTGGGGGCTGGGTTTAGCTGG + Intergenic
1002534582 5:179869273-179869295 TGCAGGGGGCAGGGCTCAGCAGG - Intronic
1003222748 6:4175989-4176011 TTTGGGAGGCTGAGCTCAGCAGG + Intergenic
1003316210 6:5014334-5014356 CAATTTAGGCTGGGCTCAGCTGG + Intergenic
1003461203 6:6330029-6330051 TGATTTTGGCAGGGCTCAGCAGG - Intergenic
1005559503 6:27023853-27023875 TGGTCTAGGCTGGGCTCAGCTGG - Intergenic
1005674148 6:28137000-28137022 TGAACGAGGCTCGGCGCAGCCGG + Intergenic
1006511030 6:34521265-34521287 TGCTGGTGGCTGGGAGCAGCTGG + Intronic
1006841852 6:37033533-37033555 TGTTGGAGGGTGGGCAGAGCTGG - Intergenic
1007100529 6:39243199-39243221 AGATGGAGGCTGGGGACAGCAGG + Intergenic
1007317681 6:41002673-41002695 GGATGGAGCCTGGGCTCATTGGG - Intergenic
1008124647 6:47654626-47654648 TGATGGAGGCTGGCCTGGTCAGG - Intergenic
1008522445 6:52375172-52375194 TGAGGGAGGTGGGGCTCAGGAGG - Intronic
1010704822 6:79095292-79095314 ACATGAAGACTGGGCTCAGCTGG - Intergenic
1010749816 6:79605255-79605277 GGCTGCAGGCTGGGCTCACCCGG - Intergenic
1013313769 6:108922087-108922109 TGATGGAGGAAGGGCACAGAGGG + Intronic
1013706034 6:112835233-112835255 TGATTCAGGCTGGGCTCAGCTGG + Intergenic
1014067227 6:117141791-117141813 TGATCTAGGCTTGGCTCATCTGG + Intergenic
1015421352 6:133013084-133013106 GGATGGATGCTGGGCAGAGCTGG + Intergenic
1015524296 6:134160780-134160802 TGATGGAAGTTGGGCCCACCAGG + Intergenic
1015926326 6:138313315-138313337 TGAAGGAGGCTGGGACCAGGAGG - Intronic
1016635379 6:146283170-146283192 TGATTTAGGCTGGGTTCTGCTGG - Intronic
1016979472 6:149840936-149840958 TGATGGAATCCGGGCTGAGCTGG + Intronic
1017697327 6:157030086-157030108 CGATTTGGGCTGGGCTCAGCTGG + Intronic
1017716640 6:157217927-157217949 TGCAGGGGTCTGGGCTCAGCAGG + Intergenic
1018514742 6:164566834-164566856 TGTTGGAGTCTTGGCTAAGCAGG + Intergenic
1018672783 6:166193452-166193474 TGCTGGAGGCTGTGGGCAGCCGG + Intergenic
1018731987 6:166658261-166658283 GGATGCACCCTGGGCTCAGCAGG - Intronic
1019028221 6:168990447-168990469 TGATGGCGGCAGGCCTCAGAGGG - Intergenic
1019034261 6:169041427-169041449 TGATGGAGGCTGAGCTGGGAGGG - Intergenic
1019419655 7:945172-945194 TGACTGAGGCTGGGCTGGGCAGG + Intronic
1019507912 7:1402448-1402470 TGATGTGGGCTTGGCTCTGCAGG - Intergenic
1019766730 7:2856962-2856984 TGATCTAGGCTGTGCTCAGCTGG - Intergenic
1019922834 7:4173811-4173833 TGAGGGAGGGTGGGGTCAGCTGG + Intronic
1019993857 7:4710792-4710814 TCATAGAAGCTGAGCTCAGCTGG + Intronic
1021258727 7:18427567-18427589 TGGTGGAGGCCAGGATCAGCAGG - Intronic
1022206008 7:28164188-28164210 TGATTGAGGCTGGGTTCAGCTGG - Intronic
1022808737 7:33848709-33848731 TGCTGGAGGCTTGGGACAGCGGG - Intergenic
1023037846 7:36148595-36148617 TGTGGGTGGCTGGGCTCAGCTGG + Intergenic
1023122069 7:36919733-36919755 TGATCGATGCTGGGCTCACGGGG + Intronic
1023232734 7:38051347-38051369 TGATGGTGGCTGTGATCAGCTGG + Intergenic
1025030925 7:55556173-55556195 TGTGGCAGGCTGGGCTCAGAAGG - Intronic
1026112006 7:67465838-67465860 AGATGGATACTTGGCTCAGCAGG + Intergenic
1026277043 7:68889096-68889118 TCCTCCAGGCTGGGCTCAGCAGG - Intergenic
1026590261 7:71688342-71688364 TGATGGACGCAGGGCCCAGGAGG - Intronic
1026608449 7:71836151-71836173 TGATCCAGGCTGGGCTCAGCTGG - Intronic
1027164181 7:75823059-75823081 TGATGGAGGCTGTGCAAAGCTGG - Intronic
1028698822 7:93751847-93751869 TTACGTAGGCTGGGTTCAGCTGG - Intronic
1028959907 7:96737113-96737135 TGATATAGGTTGGGCTTAGCTGG - Intergenic
1030386561 7:108874243-108874265 TGATGGAGGTGGCTCTCAGCAGG - Intergenic
1031666188 7:124485352-124485374 TGATCTAGGCTGGGCTAAGATGG + Intergenic
1032893826 7:136228397-136228419 TGATCGAGGCTGGCCTTAGCTGG + Intergenic
1033761358 7:144439728-144439750 TGGTGGTGGCTGTGCTCAGCTGG - Intergenic
1033976039 7:147101620-147101642 TGATGGAGGTGGCTCTCAGCGGG + Intronic
1034300807 7:150013818-150013840 TGATGGAGGCTTGGGTGACCAGG + Intergenic
1034415445 7:150962117-150962139 TGCAGGGGGCTGGGCCCAGCTGG + Intronic
1034805244 7:154083482-154083504 TGATGGAGGCTTGGGTGACCAGG - Intronic
1034994639 7:155570342-155570364 TCATGGAGCCAGGGCACAGCGGG + Intergenic
1035026880 7:155831946-155831968 CTATGGAGGCTGGAATCAGCTGG + Intergenic
1035984773 8:4415221-4415243 TGATGGAGGCTGAGTTCAGTGGG - Intronic
1036080254 8:5547540-5547562 TCTTTTAGGCTGGGCTCAGCTGG + Intergenic
1036612153 8:10359711-10359733 AGATGGAGGATGGTCTCAGATGG + Intronic
1036612158 8:10359745-10359767 AGATGGAGGATGGTCTCAGATGG + Intronic
1036642484 8:10593012-10593034 TGCTGGGGGCTGGGCTCGGCGGG - Intergenic
1036648440 8:10626245-10626267 TGGGGGAGGCTGGGCTTTGCAGG + Intronic
1037271101 8:17131465-17131487 TGGTGGTGGCTGGGCACTGCTGG + Intergenic
1037628266 8:20627806-20627828 TGAGGGAGCCAGGACTCAGCAGG + Intergenic
1038439119 8:27559369-27559391 TGAGGGAAGCTGGCCCCAGCAGG - Intergenic
1038446129 8:27605467-27605489 TGCTGGGGGCTGGTCCCAGCTGG - Intronic
1038931869 8:32202631-32202653 TGATGGAGGTGGCTCTCAGCAGG + Intronic
1039128371 8:34230721-34230743 TGATCTAGGCTGTGTTCAGCTGG + Intergenic
1039215592 8:35266770-35266792 TGGTGAAGGCTGGGCTCAGCTGG + Intronic
1039418177 8:37413639-37413661 TGAAGAAGAGTGGGCTCAGCAGG + Intergenic
1039484853 8:37902425-37902447 TGAAGTAGGAGGGGCTCAGCTGG + Intergenic
1040956804 8:52988084-52988106 TGATGGAGGCTGGGCTTCTTTGG + Intergenic
1043518295 8:81017073-81017095 TAGTTTAGGCTGGGCTCAGCTGG - Intronic
1044340762 8:91044113-91044135 TGCTGGGGGCTAGGCTCAGCTGG + Intergenic
1046088856 8:109473733-109473755 TGATCTAGGCTGGGCTCTGCTGG + Intronic
1046962551 8:120125931-120125953 TGATGGAGGATGGGGACAGTAGG + Intronic
1047092144 8:121586270-121586292 TTTTGAAGCCTGGGCTCAGCTGG + Intergenic
1047371168 8:124257211-124257233 TAATGGAGGCTGAGCACAGATGG - Intergenic
1047381331 8:124366506-124366528 GGATATAGGCAGGGCTCAGCTGG - Intronic
1048215861 8:132494019-132494041 GGTTGGATACTGGGCTCAGCTGG + Intergenic
1049185458 8:141249538-141249560 TGGTGGTGGCTGGGGGCAGCGGG + Intronic
1049358091 8:142198614-142198636 AGCTGGAGGCTGGGCTGGGCAGG - Intergenic
1049518813 8:143077860-143077882 TGTTGGAGTCTGGGGCCAGCGGG + Intergenic
1049530711 8:143153431-143153453 TGGTGGATGCTGGCCTGAGCGGG + Intergenic
1049701080 8:144012956-144012978 TGATGGAGGCAGGTCACCGCAGG - Intronic
1049772850 8:144391752-144391774 AGCAAGAGGCTGGGCTCAGCAGG - Intronic
1051535646 9:18154424-18154446 AGCTAGAGGCTGGGTTCAGCTGG + Intergenic
1052888766 9:33676701-33676723 TGCTGGTGGCGGGGCTCTGCAGG + Intergenic
1055121392 9:72664721-72664743 TGATGGAGGTGGCTCTCAGCAGG - Intronic
1055862772 9:80773273-80773295 GGATGTAGTCTTGGCTCAGCAGG - Intergenic
1056798868 9:89677599-89677621 TCATGAAGGCAGGGCTCAGGGGG - Intergenic
1056983745 9:91341830-91341852 TGATGGAGGCTGGGGGAAGCAGG + Intronic
1057669088 9:97072781-97072803 CGATGGAAGCTGGGGTCTGCAGG + Intergenic
1058424982 9:104868615-104868637 CCAAGGAGGCTGAGCTCAGCAGG - Intronic
1058427989 9:104892495-104892517 TGAGGGAGTCCTGGCTCAGCTGG - Intronic
1058910443 9:109515870-109515892 TGTTGGAGGTTGGGCCCAGTGGG - Intergenic
1059449528 9:114361771-114361793 TGATGGAGGCAGGGCAGGGCTGG + Exonic
1059841562 9:118223242-118223264 TGATTGAGGCTGGGCTTCACTGG + Intergenic
1060023301 9:120150551-120150573 TGATGGAGTCTGGACCCAGGAGG + Intergenic
1060039225 9:120285377-120285399 GGATCAAGGCTGGACTCAGCTGG + Intergenic
1060470379 9:123943297-123943319 TGCTGGAGGCTGGGCCCCCCAGG - Intergenic
1060745910 9:126130908-126130930 TGATGCCAGCTTGGCTCAGCGGG + Intergenic
1061009083 9:127944703-127944725 GGATGGAGGCTGAGCGCGGCAGG + Intronic
1061425126 9:130493774-130493796 TGATGGAGGCTGGGACCAAGGGG - Intronic
1062076691 9:134593563-134593585 GGATGGAGCCTCAGCTCAGCAGG - Intergenic
1062102451 9:134735546-134735568 TGAAGGAAGCTGGGAACAGCTGG - Intronic
1062577296 9:137214688-137214710 TGGCCGAGGCTGGGCTCACCTGG - Exonic
1062579744 9:137223937-137223959 AGATGGAGCCTGGGTTCGGCTGG + Intergenic
1203786685 EBV:132222-132244 TGCTGGTGGCTGGGCTCCCCTGG + Intergenic
1186421435 X:9430106-9430128 TCATGGAGGCTGGTCCCTGCAGG - Intergenic
1187323093 X:18258975-18258997 TGAGGGAAGCTGGGCGCAGTTGG + Intronic
1187561145 X:20404691-20404713 GGTTGGGGCCTGGGCTCAGCTGG - Intergenic
1187572176 X:20515916-20515938 TGATCTAGGCTGGGCTCTGCTGG + Intergenic
1187739830 X:22343556-22343578 TGATCTGGGCTGGGTTCAGCTGG + Intergenic
1187756655 X:22534861-22534883 TGACATAGGCTGAGCTCAGCTGG - Intergenic
1187819856 X:23275877-23275899 TAATGGAGGCTGGGTTCAATGGG + Intergenic
1188050765 X:25482993-25483015 GAATCTAGGCTGGGCTCAGCTGG + Intergenic
1188055086 X:25531348-25531370 TAATGTAGTCTGGACTCAGCTGG - Intergenic
1188258428 X:27992140-27992162 TAATGAAGGCAGGGGTCAGCAGG - Intergenic
1188481483 X:30640800-30640822 AGATATAGGCTGGGCTCAGATGG - Intergenic
1188918878 X:35947269-35947291 TGATCTAGGCTGGGCTCATCTGG + Intronic
1189175965 X:38957523-38957545 TAATGCAGGCTGGGTTCAGCTGG + Intergenic
1189422110 X:40865223-40865245 TGATTTAGGCTGGGTGCAGCTGG - Intergenic
1190320672 X:49177556-49177578 TGGTGGGGGCAGGGCTTAGCAGG + Intronic
1194665571 X:96673980-96674002 TGATGCAGGCCGGGCCCAGGTGG + Intergenic
1194752158 X:97697205-97697227 TGATGGAGGTGGCTCTCAGCAGG - Intergenic
1195202668 X:102565332-102565354 TGAGTGAGGCTGGGCTCAGGAGG - Intergenic
1195475772 X:105283457-105283479 TGATGGTGGCTTGGGTCAGAAGG + Intronic
1195735149 X:108005032-108005054 TGTTGGAGGTTGGGCCCAGTTGG + Intergenic
1196603752 X:117631679-117631701 TGATCTAGGCTGGGCTCAGCTGG - Intergenic
1196785521 X:119418611-119418633 TGGTGAAGGAAGGGCTCAGCTGG - Intronic
1197202517 X:123760364-123760386 TGATGCAGGCTGGGCACAGTGGG + Intergenic
1198614379 X:138439680-138439702 TGATCTAGGCTAGGCTCATCTGG + Intergenic
1199558861 X:149141061-149141083 TGATGAAAGGTGGGCTCAACTGG + Intergenic
1200074041 X:153542525-153542547 AGGTGGAGGCTGAGCCCAGCAGG - Intronic
1200268259 X:154658281-154658303 TGATGTAGGCTGGCCTCATATGG + Intergenic
1200797073 Y:7350575-7350597 TGAGGGAGGATGGGCTCGGGAGG + Intergenic