ID: 1166040099

View in Genome Browser
Species Human (GRCh38)
Location 19:40197110-40197132
Sequence GAGGCTGGGCTCAGCTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 1, 2: 6, 3: 57, 4: 530}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166040093_1166040099 -1 Left 1166040093 19:40197088-40197110 CCAGCTGGAGGGTAAACTGATGG 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1166040099 19:40197110-40197132 GAGGCTGGGCTCAGCTGGAGAGG 0: 1
1: 1
2: 6
3: 57
4: 530
1166040090_1166040099 13 Left 1166040090 19:40197074-40197096 CCTGCATTTGCGGACCAGCTGGA 0: 1
1: 1
2: 0
3: 18
4: 98
Right 1166040099 19:40197110-40197132 GAGGCTGGGCTCAGCTGGAGAGG 0: 1
1: 1
2: 6
3: 57
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166040099 Original CRISPR GAGGCTGGGCTCAGCTGGAG AGG Intronic
900378599 1:2372789-2372811 GAGGCTCGGCTCTGCTGGCCTGG + Intronic
900610219 1:3541574-3541596 GTGCCTGGGCTCCGCGGGAGAGG + Intronic
900662372 1:3791142-3791164 GTGGCTGTGCTCAGCTGGCGTGG - Intronic
900706941 1:4086868-4086890 GAAGCTGGGAGCACCTGGAGTGG + Intergenic
900737560 1:4308731-4308753 GAAGGTGGGCTCAGCTGGAAGGG + Intergenic
900761206 1:4472335-4472357 GAGCGTGGGCTCAGCTGGGTTGG + Intergenic
901012404 1:6209222-6209244 GGGGCTGGGGGCCGCTGGAGCGG + Intronic
901874799 1:12161387-12161409 GAGCCTGGGCTCTGCAGGAAAGG - Intergenic
902343683 1:15800571-15800593 ATGGCTGAGCTCAGCAGGAGAGG - Intergenic
902790120 1:18762140-18762162 TAGGCTTGGCTCTGCTGCAGAGG + Intergenic
902920797 1:19665182-19665204 AAGGCAGGTCTCAGCTGGCGCGG - Intergenic
903215678 1:21842161-21842183 AGGGCTGGGCTCAGCAGGGGTGG + Intronic
903929660 1:26855002-26855024 GAGGCTGGGCTGAGCCCCAGTGG - Exonic
904035980 1:27558724-27558746 TAGGCTGGGCTCAGCAGGAAAGG + Exonic
904094812 1:27968348-27968370 GCTGCTGGGCCCAGCAGGAGTGG + Intergenic
904113300 1:28143604-28143626 CAGGCTGTGCTCAGCTAGGGAGG - Intergenic
904311230 1:29630914-29630936 GAGGATGGGCACAGCTGCGGAGG - Intergenic
904686641 1:32265691-32265713 CAGGCTGGGGTCAGGTGGGGAGG - Intronic
905172458 1:36117191-36117213 GAGGCAGGGCTCAGCTGAGTTGG - Intronic
905286869 1:36886295-36886317 GTGGCTGGATCCAGCTGGAGGGG + Intronic
905430410 1:37918457-37918479 GAGGCTGGGCTTCGAAGGAGAGG - Intronic
905488763 1:38327295-38327317 GAGGCAGGGCTCAGCTCCAGAGG + Intergenic
905800144 1:40837969-40837991 GGGGCGGGGCTTAGCAGGAGAGG - Intronic
905888178 1:41502849-41502871 GAGGCTGGGGTCAGGGGGACAGG + Intergenic
906072185 1:43025082-43025104 GAGGCTGTGGGCAGCTGGCGAGG + Intergenic
906376083 1:45297767-45297789 CTGGCTCGGCTCAACTGGAGAGG + Intronic
906442107 1:45856837-45856859 TGGGCTGGGCTGAGCTGGGGAGG + Intronic
906544462 1:46611642-46611664 GAATCTGGGCTGGGCTGGAGGGG - Intronic
906566476 1:46804634-46804656 GAGGCTGGGTGCAGGTGGGGTGG + Intronic
907159430 1:52359855-52359877 GAGGCTGGTCTCAGGTTGGGAGG + Exonic
908253705 1:62285326-62285348 GAGGGTGGACCCAGCTGGAATGG - Intronic
912445603 1:109733761-109733783 GAGTCTGGGCACAGCTGAACTGG - Intronic
912481265 1:109983963-109983985 AAGGCTTAGTTCAGCTGGAGAGG - Intergenic
914811750 1:151033839-151033861 GAGGCAGGGGTCAGCTTCAGGGG - Exonic
915597184 1:156902376-156902398 GCGGCTGGGCTGCACTGGAGGGG + Intronic
915972654 1:160365471-160365493 GCAGATGGGCTGAGCTGGAGGGG - Intergenic
916951584 1:169785561-169785583 GAGGCTGGGGACGACTGGAGAGG - Intronic
917120116 1:171638332-171638354 GAGGCTGGGCTGGGCTGCACAGG - Intronic
918070533 1:181130774-181130796 GAGGAGGGGCACAGCTGGTGGGG + Intergenic
918816150 1:189186829-189186851 TAGGCTAGGCTCAGCTGGGCTGG - Intergenic
919821615 1:201476543-201476565 GAGGGAGAGGTCAGCTGGAGTGG - Intergenic
919933338 1:202235802-202235824 GAGGCTGGGGTGAGAAGGAGGGG + Intronic
920400888 1:205675765-205675787 TGGGCAGGGCTCAGGTGGAGGGG - Intronic
922553221 1:226512614-226512636 GAGGCAAGGCTCTGCTGCAGTGG + Intergenic
922570939 1:226634358-226634380 GAGGCAGGGCTCATCTGGTAGGG + Exonic
922717347 1:227884547-227884569 GAGGCTAGGCTGAGGGGGAGGGG - Intergenic
922721513 1:227902455-227902477 GAGGCCGGGGCCAGCAGGAGAGG - Intergenic
923079757 1:230642280-230642302 GAGGCGTGGCTGAGCTGCAGGGG - Intergenic
923626417 1:235617322-235617344 GAGGCAGGGATCATCCGGAGTGG + Intronic
923685531 1:236150863-236150885 GAGGGTGGGCACAGCAGCAGCGG - Intronic
924296041 1:242587355-242587377 GAGGCTTGGCTGAGCTGTGGTGG - Intergenic
924613179 1:245590300-245590322 GCGGCTGGGCCCCGCGGGAGGGG + Intronic
1062794207 10:330900-330922 GAGGATGGCCTCAGCTTGAAAGG - Intronic
1062909999 10:1206019-1206041 GCAGCTGGGCTCAGGTGGGGTGG + Intronic
1063372989 10:5533720-5533742 GAGCCTGGGCTCAACTCCAGGGG + Intergenic
1064014727 10:11763154-11763176 GAGGCGGGACTCAGGTGGCGGGG + Intronic
1067004214 10:42645898-42645920 GTGGCTGGGGGCAGCAGGAGTGG + Intergenic
1067476859 10:46573151-46573173 GGGGCTGTGCTCAGGTAGAGAGG - Intergenic
1067556639 10:47277736-47277758 GTGGTTGGGCTCACCTGGGGAGG - Intergenic
1067685916 10:48466074-48466096 GAGGCTAAGCTCACCTGGAAGGG + Intronic
1067761098 10:49047725-49047747 GAGGCTGAGCACACATGGAGTGG - Intronic
1068730519 10:60353071-60353093 GAGGATGGCCTGAGCTGGGGAGG - Intronic
1069832422 10:71289428-71289450 GAGGCTTGGCCCAGCTGCTGGGG - Intronic
1070310810 10:75272531-75272553 GACTCTGGGCCCAGCTGGACTGG - Intergenic
1070982560 10:80661070-80661092 GAGTCAGGGGTGAGCTGGAGAGG + Intergenic
1071520729 10:86330178-86330200 GAGTCTGGGGTCAGCAGGAAGGG - Intronic
1071966648 10:90858296-90858318 GAGGCTGGGGTCGGCTGGAGGGG - Intergenic
1072200633 10:93155257-93155279 GAGGCTGGGATTAGGGGGAGTGG + Intergenic
1072507421 10:96082579-96082601 GAGGCTTGGCTCAGCTGGCCTGG - Intergenic
1072706607 10:97685728-97685750 GAGGCTAGGCCCTGCTGGTGGGG - Intronic
1073052914 10:100680954-100680976 GAGGCTGGGCTGGGCTGGGCTGG - Intergenic
1073491070 10:103854029-103854051 GCGGCTGGGCTCATATGGGGAGG - Intronic
1074469192 10:113711678-113711700 AAGGCTGTGCACAGCTGGAGAGG + Intronic
1075016974 10:118917005-118917027 TAGGCTGGGCACAGATGGGGTGG - Intergenic
1075550046 10:123385652-123385674 TAGGCTGGGCTCAGCAGGGTTGG + Intergenic
1075847513 10:125556597-125556619 GAAGCTGGGCTGAACCGGAGAGG + Intergenic
1076761218 10:132606706-132606728 GAGTCTGGGCCCAGCTGCACTGG + Intronic
1077118380 11:895706-895728 GAGACTGGGCTCAGCAGGTTCGG - Intronic
1077482301 11:2821477-2821499 ATGGATGGGCTCAGATGGAGTGG + Intronic
1077562024 11:3270148-3270170 GAGGCTTTGCTGAGCTGCAGTGG + Intergenic
1077567918 11:3315968-3315990 GAGGCTTTGCTGAGCTGCAGTGG + Intergenic
1077659787 11:4057346-4057368 CAGGCTGGGCACAGGTGTAGGGG + Intronic
1078649744 11:13178285-13178307 GAGGCTGGAGTGAGCTGTAGTGG - Intergenic
1080855751 11:36110329-36110351 GAGGCAGGGACCAACTGGAGAGG - Intronic
1080962986 11:37181766-37181788 AAGGCAGGGTTCTGCTGGAGTGG - Intergenic
1081962816 11:47150800-47150822 GAGGCAGGGGGCAGATGGAGCGG + Intronic
1083141865 11:60728835-60728857 GAGGCTAGGCAGAGTTGGAGGGG - Intergenic
1083406119 11:62458436-62458458 GAGTCTGGTGTAAGCTGGAGTGG + Intronic
1083720568 11:64601691-64601713 GGGGCAGGGCTCACCTGGAGGGG - Exonic
1084399597 11:68935985-68936007 GAGGCTGGGCTTAGAAGGAAAGG + Intronic
1085024275 11:73227695-73227717 GAGGCTTGGCTCAGCTGTACAGG + Intronic
1085036970 11:73306655-73306677 AAGGCTGGGCAGCGCTGGAGGGG + Intergenic
1085049332 11:73372074-73372096 GAGGCTGGGGGTAGCTGGGGAGG + Intergenic
1085049600 11:73373387-73373409 GAGGGTGGGCTCAGTCTGAGGGG - Intergenic
1085121842 11:73972421-73972443 GGGGCAGGACTCAGGTGGAGTGG + Intergenic
1085283881 11:75347559-75347581 GAGGCTGGGAGCTGCTGGGGAGG + Intronic
1085287699 11:75374901-75374923 GAGGCTAGAGTGAGCTGGAGTGG + Intergenic
1085392657 11:76190347-76190369 GAGGCTGGGCTGAGGTAGATGGG - Intronic
1087064204 11:94011935-94011957 GTGGATGGGCTAAGCTGGAGGGG + Intergenic
1087386717 11:97480503-97480525 GAGGCTGGGGTAGGGTGGAGTGG + Intergenic
1088741928 11:112774357-112774379 TAGGCTGGCCTCAGCAGGATGGG - Intergenic
1089315995 11:117591860-117591882 GAGCCTGGGCTGACCTGGTGAGG - Intronic
1089353325 11:117833769-117833791 GAGGCTGGGCAAAGCAGGGGTGG - Intronic
1089614732 11:119688788-119688810 GAGTCTGGGCTCTGTAGGAGGGG + Intronic
1089708167 11:120295710-120295732 GTGGATGGGCACAGCTGAAGGGG + Intronic
1089838952 11:121397482-121397504 GAGGATGGCCTCAGCTTGGGAGG + Intergenic
1090350869 11:126106967-126106989 GAGGCTGTTCTCAGCTTCAGAGG - Intergenic
1090405286 11:126472933-126472955 GGGGCTGGGCTTAGGTAGAGGGG - Intronic
1091331537 11:134735137-134735159 GAGGCTGGGGTGGGCTGGAGAGG + Intergenic
1091387314 12:103463-103485 GAGGCGGGGCTCAGGAGGGGAGG + Intronic
1091785791 12:3242680-3242702 GACTCAGGCCTCAGCTGGAGGGG + Intronic
1091918970 12:4289392-4289414 GAGCCAGGACTCAGCTGCAGTGG + Intronic
1092182411 12:6454775-6454797 GAGGATGTGCTGAGCTGGAGAGG - Intronic
1092629677 12:10364129-10364151 GTGGCTGGGGGCAGCAGGAGTGG + Intergenic
1092857233 12:12685415-12685437 CAGGCAGGGCTGAACTGGAGAGG + Intronic
1093236833 12:16619718-16619740 TTGGCTGTGCTCAGCTGGGGTGG + Intergenic
1094108011 12:26833413-26833435 GACGCTGGGCGGCGCTGGAGGGG + Intergenic
1095839019 12:46671305-46671327 TAGGCTGGCCTCATCTGGAGAGG - Intergenic
1095954516 12:47798527-47798549 GGGGCTGGGCTGGGCTGGGGTGG + Intronic
1096521284 12:52186142-52186164 CAGGCTGAGCTCGGCTGGACAGG - Intronic
1096755093 12:53792722-53792744 GAGGCTGGTCTCAGCGGGGTGGG - Intergenic
1096785869 12:54017036-54017058 GAAGCTGGGGGCAGCTGGGGAGG + Intronic
1097246797 12:57611533-57611555 GAGGCCGGAGACAGCTGGAGCGG + Intronic
1097308423 12:58093800-58093822 GAAGCTGGGCTGGGCTGGACTGG - Intergenic
1097915324 12:65014699-65014721 GAGACTGGGCACCTCTGGAGTGG + Intergenic
1098977315 12:76916560-76916582 GTGGCTTGGCACAGCAGGAGAGG - Intergenic
1100518624 12:95352184-95352206 GATTCTGGGCTCATCTTGAGTGG - Intergenic
1100685784 12:96985083-96985105 CAGGCTGTGCTCAGCTCTAGGGG + Intergenic
1101802680 12:108035906-108035928 TAGGCTGGGGTCAGCTGGGTTGG - Intergenic
1102300465 12:111767319-111767341 GAGGCTGGGCGAAGACGGAGAGG - Intronic
1102657668 12:114496472-114496494 ATGGCTGGGCTCAGCTGGGAGGG + Intergenic
1103706373 12:122875753-122875775 GAGGCTGGAATCAGTCGGAGAGG - Intronic
1104007650 12:124905311-124905333 GAGGATGGCTTCAGCTGGGGAGG + Intergenic
1104526381 12:129526924-129526946 AAGGCTGGCCACAGCTGGAATGG - Intronic
1104595950 12:130120103-130120125 CAGGGAGGGCGCAGCTGGAGAGG - Intergenic
1104719957 12:131039726-131039748 GAGCCTGGGCTTAGCGGCAGGGG - Intronic
1104746673 12:131215185-131215207 GTGGGTGGGCTCCGCTGCAGAGG + Intergenic
1104878723 12:132054649-132054671 GTGGCTGGACTCAGGTGGTGAGG + Intronic
1105239270 13:18595881-18595903 GAGGATGGGCTGAGGTGGCGGGG - Intergenic
1105902753 13:24771239-24771261 GAGGATTGCTTCAGCTGGAGAGG - Intronic
1108163409 13:47666624-47666646 GATGCTGGCCTGGGCTGGAGGGG - Intergenic
1108623040 13:52202744-52202766 GAGGCAGGGCTGATCTTGAGGGG - Intergenic
1108663685 13:52608298-52608320 GAGGCAGGGCTGATCTTGAGGGG + Intergenic
1108784409 13:53877880-53877902 AAGGCTGGTCTTAGCTGGAATGG + Intergenic
1113307443 13:109093829-109093851 GAGGCTGAGTGCGGCTGGAGAGG - Intronic
1113575328 13:111391101-111391123 GGGGCTGGGGTCAGCAGGACGGG + Intergenic
1113808395 13:113123042-113123064 GAGGCTGGGCTCGGATGGCTGGG + Intronic
1113930679 13:113967420-113967442 CAGGCTTGGGTGAGCTGGAGAGG + Intergenic
1114163895 14:20199123-20199145 GAGGCTAGGATCAGCTGAAGCGG - Intergenic
1114460530 14:22883552-22883574 GGGGCTGGGCTAGGGTGGAGGGG + Intronic
1114508646 14:23237916-23237938 GAGGCTGGGCGCAGCCGAGGCGG - Intronic
1114548524 14:23520285-23520307 GAAGCTGGGCTGGGCTGGACTGG + Intergenic
1117231444 14:53723441-53723463 GGGGCTGGGGTAAGGTGGAGAGG - Intergenic
1117252895 14:53953564-53953586 GAGGTTGGCCTCGCCTGGAGGGG - Intronic
1117416450 14:55500947-55500969 TGGGCTGGGCTCAGCTGGGATGG - Intergenic
1117461671 14:55951579-55951601 AAGGCCGGGCTCAGCTGGGATGG - Intergenic
1117803223 14:59465327-59465349 GGAGCTGGGCTCGGCCGGAGGGG + Exonic
1117991269 14:61436188-61436210 GAGCATGGGCTCAGCTTGCGTGG + Intronic
1118516068 14:66530182-66530204 GCGGCTTGGCTGAGCTGCAGAGG + Intronic
1118690445 14:68333930-68333952 GAGGCTGGGGTGTGGTGGAGAGG - Intronic
1118778868 14:68992805-68992827 GAGGATGGGAGCAACTGGAGAGG - Intergenic
1119897214 14:78230443-78230465 GAGGCTGGGGTGACATGGAGGGG + Intergenic
1121109671 14:91303628-91303650 GAGGCTGGGCCCAGGGGGAAAGG - Intronic
1121449070 14:93996401-93996423 GGGGCTGGGCTCAGGGGCAGGGG - Intergenic
1121680776 14:95791200-95791222 GAGGGTGGTCTGGGCTGGAGGGG - Intergenic
1122044987 14:99016957-99016979 GGGGGTGGGCCCAGCGGGAGTGG - Intergenic
1122551376 14:102551975-102551997 GAGGCAGGGAACAGCTGGACAGG + Intergenic
1122769779 14:104092801-104092823 GAGGCTGGGCACTGCTGGCCAGG + Intronic
1122819760 14:104335513-104335535 GGGGCTGGGCTGGGCTGGGGAGG - Intergenic
1122898193 14:104770834-104770856 AAGGGTGGGCTGAGCTGCAGAGG + Exonic
1123044125 14:105503205-105503227 GTGGGTGGGCTCAGCCGGGGTGG + Intergenic
1123059940 14:105590072-105590094 TAGACTGGGCTGAGCTGGACTGG - Intergenic
1123059991 14:105590267-105590289 TGGGCTGGGCTGAGCTGGACTGG - Intergenic
1123060201 14:105590997-105591019 TAGGCTGGGCTGGGCTGGACTGG - Intergenic
1123060247 14:105591159-105591181 TAGGCTGGGCTGAGCTGGGCTGG - Intergenic
1123084663 14:105711880-105711902 TGGGCTGGGCTGAGCTGGACTGG - Intergenic
1123084668 14:105711900-105711922 TGGGCTGGGCTAAGCTGGACTGG - Intergenic
1123084704 14:105712045-105712067 TAGTCTGGGCTGAGCTGGACTGG - Intergenic
1123084716 14:105712105-105712127 TGGGCTGGGCTGAGCTGGACTGG - Intergenic
1123084721 14:105712125-105712147 TGGGCTGGGCTGAGCTGGACTGG - Intergenic
1123084726 14:105712145-105712167 TAGTCTGGGCTGAGCTGGACTGG - Intergenic
1123084731 14:105712175-105712197 TAGGCTGGGCTGAGCTGGGCTGG - Intergenic
1123448292 15:20345068-20345090 GAGGCTGGGCCCATCTAGCGTGG - Intergenic
1124594514 15:31081874-31081896 GAGGCATGGCTCACCTGGGGAGG + Intronic
1125514248 15:40309008-40309030 TGGGCTGGGCTGAGCTGGACTGG - Intergenic
1126554105 15:49966523-49966545 GAGGCTTTGCTGAGCTGCAGTGG - Intronic
1128280125 15:66387369-66387391 GGGGCCGGGTTCAGCTGGATGGG - Exonic
1128513266 15:68326619-68326641 GAGCTTGGGCTCTGCTGGTGGGG + Intronic
1129448221 15:75633751-75633773 GAGGCAGGGCCCAGGTGCAGTGG - Intergenic
1129608107 15:77034628-77034650 GAGGGAGGGCTCAGGTGCAGGGG - Intronic
1131561101 15:93440763-93440785 GAGGCAGTGCTCAGATGTAGAGG + Intergenic
1132672707 16:1108264-1108286 GAGGCTGGACCCAGCAGGAGGGG - Intergenic
1132850096 16:2020990-2021012 AAGGTGGGGCTCAGGTGGAGGGG - Intergenic
1132871261 16:2116741-2116763 GAGCCTGGGCTGAGGAGGAGGGG - Intronic
1133069341 16:3235413-3235435 TAGACTGGCCGCAGCTGGAGAGG - Intronic
1134438848 16:14285674-14285696 GAGTCGGGGCGCGGCTGGAGCGG - Intergenic
1134521265 16:14920153-14920175 GAGCCTGGGCTGAGGAGGAGGGG + Intronic
1134708940 16:16318804-16318826 GAGCCTGGGCTGAGGAGGAGGGG + Intergenic
1134716150 16:16358838-16358860 GAGCCTGGGCTGAGGAGGAGGGG + Intergenic
1134950665 16:18349841-18349863 GAGCCTGGGCTGAGGAGGAGGGG - Intergenic
1134958603 16:18393321-18393343 GAGCCTGGGCTGAGGAGGAGGGG - Intergenic
1135984468 16:27173892-27173914 GAGGCTGGGATCTGCAGCAGCGG - Intergenic
1136006925 16:27337160-27337182 GGTGCTGGGCCCAGGTGGAGAGG + Intronic
1136010421 16:27359932-27359954 GAGGCTGGGCTGGGCTGGGCTGG + Intronic
1136139774 16:28281318-28281340 GAGGCTTGGCTGAGCTGGCCCGG - Intergenic
1137382607 16:48012994-48013016 TAGGCTGGGCTTAGCTTGGGGGG + Intergenic
1137674983 16:50299684-50299706 AAGCCTGGGCAGAGCTGGAGGGG + Intronic
1137686508 16:50390561-50390583 GAGGCTGCCCTGAGCAGGAGGGG - Intergenic
1137705926 16:50535824-50535846 GAGGCTGGGGTCGGCAGGAGAGG - Intergenic
1139345165 16:66298174-66298196 GAGGAAGTGCTCAGGTGGAGTGG + Intergenic
1139789046 16:69417556-69417578 GAAGCTGGGCTGGGCTGGTGGGG + Intergenic
1140202513 16:72906048-72906070 GAGTTTGGGCGTAGCTGGAGAGG - Intronic
1140405677 16:74709614-74709636 GAGGCCGGGAACAGGTGGAGAGG + Intergenic
1140809536 16:78564128-78564150 TGGGCTGGGCTCAGCTGGGCAGG - Intronic
1141256032 16:82403333-82403355 GAGGATGGTGTCAGGTGGAGAGG - Intergenic
1141473466 16:84255198-84255220 AAGGCTGGGCTCAGCTGGGACGG + Intergenic
1141710466 16:85695981-85696003 GATGCTGCACTCAGCGGGAGAGG - Intronic
1141748716 16:85944026-85944048 TAGGCAGGGCTCAGCTGGCTGGG + Intergenic
1141772538 16:86099488-86099510 GAGGCGGAGCTCAGGTGGCGAGG + Intergenic
1141808185 16:86356030-86356052 CAGGTTGGGCTCAGCTGGGATGG + Intergenic
1141943409 16:87293757-87293779 GAGGAGGAGCTCAGTTGGAGGGG - Intronic
1142103338 16:88287407-88287429 GTGGCTGGGCTCCGCTGGTGCGG - Intergenic
1142132857 16:88438758-88438780 GAAGCTGGGCTTGGCTGGGGTGG - Exonic
1142149842 16:88507819-88507841 GGGGCTGGGCCCATCTGCAGAGG - Intronic
1142670297 17:1484971-1484993 GTGGCTGAGCCCAGCTGGGGTGG - Intronic
1143361874 17:6377556-6377578 GTGGCGGGGATCAGCTGTAGTGG - Intergenic
1143576469 17:7796674-7796696 GAGGCTGGGCCAAGCAGAAGGGG - Intronic
1143622562 17:8089073-8089095 GAGGCAGGGCTGAGCTCCAGTGG + Intergenic
1143782794 17:9238166-9238188 GAGGGCAGGCTCAGCTGGGGTGG + Intronic
1144334266 17:14255136-14255158 AGGGCTGGGGGCAGCTGGAGTGG - Intergenic
1144991742 17:19237942-19237964 CAGGCTGGGCTCAGGAGGAAGGG - Intronic
1145207791 17:20993960-20993982 GTGGCGGGGCTCAGCTGGGTGGG + Intergenic
1146386463 17:32380707-32380729 GGGGCTGGGCCCAGCTGAGGCGG + Exonic
1146693205 17:34890788-34890810 GAGGCTGAGCTGAGTTAGAGAGG + Intergenic
1147140778 17:38459563-38459585 GATGCTGGGGGCAGCAGGAGGGG - Intronic
1147533597 17:41302795-41302817 GATGGTGGGCACAGCTGGAATGG + Exonic
1147623300 17:41882735-41882757 CAGCCTGGGCTCAGCTGGGCGGG - Intronic
1147970251 17:44215597-44215619 GAGGCTGGGAGCAGCTGGTGTGG - Intronic
1148135485 17:45289138-45289160 GAGCCCGGGGTCAGCAGGAGCGG + Intronic
1148356124 17:46977146-46977168 GAGGCTTGGCACAGGTGGGGTGG - Intronic
1148643839 17:49207602-49207624 GAGTCTGGGCTCAGGAGGGGAGG + Intronic
1148794605 17:50191013-50191035 GAGGCAGGGCAGAGCTGCAGAGG - Intronic
1148855779 17:50578641-50578663 GAAGCTGAGCTCAGGAGGAGGGG - Intronic
1148894652 17:50832812-50832834 GAAGGTGGGCCCAGCGGGAGCGG - Intergenic
1149646850 17:58247409-58247431 GGGGCTGGGGGCCGCTGGAGGGG - Intronic
1150210238 17:63437803-63437825 GTGGCTGTGCGCATCTGGAGGGG - Intronic
1150306829 17:64092541-64092563 GAGTCTGGGCCCAGCTGGCTAGG + Intronic
1151453933 17:74215041-74215063 CAGGCTGGGCTCTGGGGGAGGGG - Intronic
1151474441 17:74337837-74337859 GAGCCAGAGCTGAGCTGGAGAGG - Intronic
1151671456 17:75573729-75573751 GAGGGTGGGCTGAGCTCGTGGGG - Intronic
1152013436 17:77734835-77734857 GGGGCGGGGCTGAGCGGGAGTGG + Intergenic
1152138504 17:78522217-78522239 GTGGCTCGGCTCAGCTGGGCTGG - Intronic
1152464185 17:80456544-80456566 GAGGGGGGGCTCACCGGGAGGGG - Intergenic
1152730536 17:81967604-81967626 GGGGCGGAGCTCAGCTGCAGGGG - Intergenic
1152808561 17:82370760-82370782 GAGGCGAGGCTGGGCTGGAGAGG - Intergenic
1153348387 18:4052494-4052516 GAGGCTGGGCACAGCATGGGGGG + Intronic
1154449526 18:14462756-14462778 GAGGATGGGCTGAGGTGGGGGGG + Intergenic
1155030209 18:21977713-21977735 GAGGATGGGTTCAGCTAGGGAGG - Intergenic
1155314529 18:24558384-24558406 TCGGCTGGGGGCAGCTGGAGAGG - Intergenic
1155345486 18:24853072-24853094 GGGGCTGGGCTCACCTTGGGAGG + Intergenic
1155932768 18:31724363-31724385 GAGTCAGAGGTCAGCTGGAGCGG - Intergenic
1156481574 18:37439741-37439763 GAGGCAGGGCTCAGTTTGTGTGG + Intronic
1157281867 18:46351552-46351574 GGGGCTGGGCTTAGCAGGAAGGG - Intronic
1157366322 18:47067811-47067833 GGAGCTGGGCTCAGCTGGGCTGG + Intronic
1157556516 18:48616298-48616320 GAAGCTGGCCTCCGCTGGATGGG - Intronic
1159306273 18:66647006-66647028 GAGGCTGGGCACAGCTGGACTGG - Intergenic
1159903044 18:74066004-74066026 GAGGCAGGGCTTAGAAGGAGTGG + Intergenic
1160744384 19:703920-703942 GAGGCGGGGCTGAGGTGCAGGGG + Intergenic
1160785936 19:900340-900362 GAGGGTAGGGTCAGCTGGATGGG - Intronic
1160954964 19:1686930-1686952 CTGGCTGGGCTCATCCGGAGGGG - Intergenic
1161301698 19:3545814-3545836 GGGGGTGGGCCCAGCTGGAAGGG - Intronic
1161381394 19:3966953-3966975 GAGGGTGGGCTCAGCTCTTGGGG - Intronic
1161469300 19:4448265-4448287 GGTGCTGGGATGAGCTGGAGGGG + Intronic
1161847066 19:6718222-6718244 GAGGCTGGGGGCGGCTGGAGAGG - Intronic
1163190268 19:15672437-15672459 GAAGCTGGGCTCAGCTTAGGAGG - Intergenic
1163202793 19:15780412-15780434 GAGGCTGGGCTGCGCTGGGCTGG + Intergenic
1163443097 19:17331442-17331464 CAGGCTAGGCACAGGTGGAGGGG - Intronic
1163522936 19:17802667-17802689 GAGGCAGGGCTGAGCTTGGGTGG + Intronic
1163534698 19:17870402-17870424 AACGCTGGACCCAGCTGGAGCGG + Intergenic
1163804231 19:19386291-19386313 GAGGCGGGGGTCCCCTGGAGAGG - Intronic
1163840557 19:19606310-19606332 GAGGCTGCTCTCAGCTTTAGAGG - Intronic
1164053573 19:21603629-21603651 GTGGCTGGGGGCAGCAGGAGTGG + Intergenic
1164762003 19:30735255-30735277 AAAGCTGAGCTAAGCTGGAGAGG - Intergenic
1164929644 19:32165647-32165669 GACACTGGGGACAGCTGGAGAGG - Intergenic
1164970802 19:32530980-32531002 TTGGCTGGGCTCAGCTGGGCGGG - Intergenic
1164995853 19:32720147-32720169 GAGGCTGTGCGCGGCTGGGGTGG - Intronic
1165013402 19:32864415-32864437 GAGGCTGCGCTCGTATGGAGGGG + Intronic
1165113375 19:33514651-33514673 GAGGCTGGGGTCAGGAGGAGAGG + Intronic
1165314643 19:35047197-35047219 AAGGCTGGGGCCAGCTGGGGAGG - Intronic
1165476191 19:36032419-36032441 GAGGCAGAGGTCAGCTGGAGAGG + Intronic
1165842145 19:38794776-38794798 GAGGATGGCTTGAGCTGGAGAGG + Intergenic
1166040099 19:40197110-40197132 GAGGCTGGGCTCAGCTGGAGAGG + Intronic
1166516111 19:43448288-43448310 GAGGCTGGACTCACCTCCAGAGG + Intergenic
1166677512 19:44748741-44748763 GCGGCTGGGCTCGGCTGCACGGG - Exonic
1166742529 19:45123052-45123074 CAGGCTGGGATCAGCTGCAGCGG - Intronic
1167251169 19:48399029-48399051 GAGGCGGGGCTGACTTGGAGGGG + Intronic
1167420009 19:49397304-49397326 AAGTCTGGGCTCTGCTGGACTGG + Intronic
1168177802 19:54636832-54636854 GATGCTGGGCACAGCTGGAGAGG - Exonic
1168182072 19:54667973-54667995 GACACTGGGCTCAGCTGGAGAGG - Exonic
1168678095 19:58293665-58293687 GATGCTGTGCTCAGCTCTAGAGG + Intronic
925067278 2:938280-938302 GAGGTTGGCCTGAGCTGGAGGGG - Intergenic
926152401 2:10432457-10432479 GGGGCGGGGCTCGGCTCGAGAGG + Intergenic
926213641 2:10890090-10890112 GAGGCTGGGCAAATCCGGAGGGG + Intergenic
926242773 2:11101138-11101160 GAGCGTGGGCTCAGGGGGAGAGG - Intergenic
927036163 2:19178824-19178846 GAGGCTGAGATGAGGTGGAGAGG - Intergenic
927667223 2:25041437-25041459 GCGCTGGGGCTCAGCTGGAGAGG + Intergenic
927684302 2:25160124-25160146 GAGCCTGGGCACGGCAGGAGGGG + Intergenic
927854938 2:26522042-26522064 GAGGCTGTGCACAGCTTGAAGGG - Intronic
927972036 2:27311984-27312006 GAGTCTGGGGTCAGGTGGTGGGG - Intronic
928201388 2:29249768-29249790 GAGGCTTGGCTCAGCAGGAAGGG + Intronic
929078257 2:38096181-38096203 GAGGCTGAGCTCAGAAGGGGCGG - Intronic
929347844 2:40908328-40908350 GAGGTTTTGCTCAGCAGGAGAGG - Intergenic
929456499 2:42069726-42069748 TGGGCTGGGCTGAGCTGGACAGG - Intergenic
930848020 2:55926404-55926426 GAGGCAGAGCTCAGGAGGAGAGG + Intergenic
932106936 2:68952135-68952157 GAGGCTGGGATCAGATGGAGGGG + Intronic
932332742 2:70907276-70907298 GAGGCCGGCCTAGGCTGGAGCGG + Intronic
932557183 2:72834789-72834811 GAGGCTGTGGTCAGCTGGGGTGG - Intergenic
932741295 2:74293012-74293034 GAGGCTGGCCTCAGCAAGAGAGG + Intronic
934046706 2:88178681-88178703 GAGGGTGGGCTCAGCCTGGGAGG + Intronic
934654354 2:96109442-96109464 GTGGCTGGGGTCAGCAGGTGAGG + Intergenic
934685171 2:96315952-96315974 GGTGCTAGGCGCAGCTGGAGTGG + Intergenic
934921464 2:98347751-98347773 GAGGCTGGGATCAGCAGGAATGG + Intronic
936153525 2:110034155-110034177 GTGGCTGGGCTGAGCTGGGCAGG - Intergenic
936191156 2:110337260-110337282 GTGGCTGGGCTGAGCTGGGCAGG + Intergenic
936346662 2:111680509-111680531 GAGGCTGGGCTGGGCTGGAGAGG + Intergenic
937201391 2:120206511-120206533 GAGGGCGGGCACAGCTGCAGGGG + Intergenic
937211960 2:120279860-120279882 TATGCTGGGTGCAGCTGGAGTGG + Intronic
938079966 2:128364688-128364710 GAGCATGTGCCCAGCTGGAGAGG - Intergenic
939508906 2:143082663-143082685 TGGACAGGGCTCAGCTGGAGTGG + Intergenic
940279969 2:151978810-151978832 GAGGCTGGGCTCAGCTCTGGCGG - Intronic
940281075 2:151990187-151990209 GAGGCTGGGCACACCAGAAGTGG - Intronic
942265778 2:174224324-174224346 AGCGCTGGGCTCTGCTGGAGAGG - Intronic
944098123 2:195993028-195993050 CAGGATGGGGTCAGGTGGAGAGG - Intronic
944605225 2:201346479-201346501 GAGGCCGGGCTGAGCTGGGTGGG + Intronic
946365168 2:219244560-219244582 CAGGCAGGGGTAAGCTGGAGAGG - Intronic
948028034 2:234793560-234793582 GACGCAGCTCTCAGCTGGAGTGG + Intergenic
948589230 2:239038758-239038780 CAGGCTGAGCCCATCTGGAGAGG + Intergenic
948603351 2:239119897-239119919 GAGGCTGGGTCCAGCGGCAGTGG + Intronic
948946424 2:241222758-241222780 GAGGGAGGGCTCTGCTGGACAGG + Intronic
1169048793 20:2559036-2559058 GAGGCGGGGCGCGGGTGGAGAGG + Intronic
1169173327 20:3485046-3485068 TTGACTGGGCTCAGCTGGTGGGG + Intronic
1169207769 20:3749669-3749691 GAGGCTGGGCGAGGCTGGAGGGG + Intronic
1170634749 20:18094324-18094346 GAGGGAGGGCTCAGCTACAGAGG + Intergenic
1170826380 20:19799696-19799718 GAGGTTGGGCTGAACTGCAGTGG + Intergenic
1170920903 20:20678634-20678656 GAGGAGTGGGTCAGCTGGAGGGG - Intronic
1171347595 20:24477803-24477825 GAGGCTGGGGTGCGATGGAGGGG + Intronic
1171473678 20:25391006-25391028 GAGGGTGGGCGAAGCTGCAGCGG + Intergenic
1171982641 20:31638443-31638465 GAGACTGGGCTCAGCCAGACTGG + Intronic
1172024146 20:31936601-31936623 GAGACTGTGGTGAGCTGGAGAGG - Intronic
1172528925 20:35617454-35617476 GAGGCGGGGCTCAGCCTGCGTGG - Intronic
1172882829 20:38212979-38213001 GGGCCAGGGCCCAGCTGGAGGGG - Exonic
1173253135 20:41375142-41375164 AAGGCTGGGCTGCTCTGGAGGGG - Intergenic
1173295544 20:41752341-41752363 GGGGCTGAGCCCACCTGGAGTGG - Intergenic
1173457325 20:43213966-43213988 GAGGCTGGGCACATCTGTTGAGG - Intergenic
1173597560 20:44269009-44269031 TGGGCTGGGCTCAGCTGGGACGG + Intronic
1173812996 20:45967880-45967902 GAGGCTGGGGGCAGCTGCACCGG + Exonic
1174116922 20:48232581-48232603 GTGGCTGGACTGAGCTGGGGAGG - Intergenic
1174200655 20:48804396-48804418 AAGGCTGGGCTGAGAGGGAGAGG + Intronic
1174748253 20:53085928-53085950 GAGGTTGAGCGCAGCTGGAGAGG - Intronic
1174766984 20:53263891-53263913 CAGGCTGGGCTCCCCTGGAGAGG + Intronic
1174881789 20:54287747-54287769 AGGGCTGGGCTTAGCTGGAATGG + Intergenic
1174884248 20:54314645-54314667 GTGGATGGGTGCAGCTGGAGAGG + Intergenic
1175132348 20:56798828-56798850 TAGGATGGGCTCAGCTGGGATGG - Intergenic
1175160702 20:57005550-57005572 CAGTCAGGGTTCAGCTGGAGAGG + Intergenic
1175215825 20:57391337-57391359 GGGGCGGGGCTGAGCTGGCGGGG + Intergenic
1175759436 20:61550838-61550860 CAGGCAGGGCTGAGCAGGAGCGG + Intronic
1176101991 20:63368564-63368586 GAGGCTGGGCTAAGATGGGTGGG - Intronic
1176241160 20:64076569-64076591 GCGGCTGGGGGCCGCTGGAGAGG + Exonic
1176295040 21:5067284-5067306 GAGTCTGAGCTGAGCTGGTGGGG - Intergenic
1178829788 21:36046173-36046195 GGGGCTGTGCTCCCCTGGAGAGG - Intronic
1178864427 21:36316408-36316430 GAGGCTTTGCTGAGCTGCAGTGG + Intergenic
1179124796 21:38581163-38581185 GGGGATGGGTTCAGCTGGGGAGG + Intronic
1179460816 21:41533790-41533812 GTGGCTGTGGCCAGCTGGAGGGG + Intergenic
1179574241 21:42297381-42297403 GAGGGTTGGCTCAGCAGGAGTGG + Intergenic
1179608843 21:42535891-42535913 GAGGTTGGGCTCTGCTGAACAGG - Intronic
1179798112 21:43797554-43797576 GAGGCTGGGCTCCGACGGGGCGG + Intronic
1179862009 21:44194844-44194866 GAGTCTGAGCTGAGCTGGTGGGG + Intergenic
1179930622 21:44568748-44568770 CAGGCTGGGGCCAGCTGCAGTGG - Intronic
1180175923 21:46089284-46089306 CAGCCTGTGCTCAGGTGGAGGGG - Intergenic
1180685726 22:17664864-17664886 GAGGCTGCACACAGCAGGAGGGG + Intronic
1180928427 22:19572327-19572349 AAGGCTGGACCCTGCTGGAGTGG - Intergenic
1181007806 22:20022320-20022342 TGGGCTGGGAGCAGCTGGAGAGG + Intronic
1181008124 22:20024143-20024165 TGGGCTGGGGGCAGCTGGAGAGG - Intronic
1181876636 22:25945623-25945645 GGGGCTGGGCTGAGCTAGAGGGG + Intronic
1183063718 22:35350063-35350085 GTAGCTGGGCCCAGCGGGAGCGG - Intergenic
1183508370 22:38221560-38221582 GAGCCTGGGCCCACCTGGCGTGG - Exonic
1183686213 22:39362692-39362714 AAGGCTGGGTTCAGCTTGTGGGG + Intronic
1184179846 22:42813348-42813370 GAGGCTGGACTGCCCTGGAGTGG + Intronic
1184794625 22:46724726-46724748 AAGGCTGGGCTCAGCAGGGCGGG + Intronic
1184971854 22:48028128-48028150 GAGGCAGGGCACAGAGGGAGTGG + Intergenic
1185017500 22:48353291-48353313 CAGGCAGGGCTCAGGTGGTGTGG - Intergenic
1185103475 22:48854157-48854179 GAGGCTGAGCTGAGCTGGCAGGG + Intergenic
1185287883 22:50010598-50010620 GAGGCCGGGGTGGGCTGGAGAGG + Intronic
1185384367 22:50525137-50525159 GAGGGTGCCCTCAGCAGGAGGGG - Intronic
1185421267 22:50735589-50735611 ATGGCTGGGATGAGCTGGAGGGG + Intergenic
949259763 3:2091671-2091693 TTGGCTGTGCTCACCTGGAGTGG + Intergenic
950176407 3:10877925-10877947 GAGTCGGGGGTCAGGTGGAGTGG - Intronic
950584080 3:13880381-13880403 GAGGCTGCCCTCGGGTGGAGTGG + Intergenic
950585745 3:13890835-13890857 CAGGCAGGGCTCAGCTGGGAGGG + Intergenic
950907743 3:16554339-16554361 TAGGCAGGGCTCAGCTGGGCTGG - Intergenic
951002075 3:17574399-17574421 GAGGTTGGGTTCAGTGGGAGTGG - Intronic
951365577 3:21777946-21777968 AAGGCTTGGCTCAGCTGGATGGG - Intronic
952380107 3:32797914-32797936 GAGGCTAGAGTCATCTGGAGAGG + Intergenic
952843304 3:37666438-37666460 GAGGCTAGGCTCAGCTGTTTGGG + Intronic
952888811 3:38027962-38027984 GAGGCTGGTCTCAAATGGGGTGG + Intronic
953548721 3:43884022-43884044 TAGACTGGGCTTTGCTGGAGTGG + Intergenic
953931977 3:47010045-47010067 GTGGCAGGGCCGAGCTGGAGGGG - Intergenic
954435882 3:50495785-50495807 GAGCCTGGGCTCAGGCAGAGTGG - Intronic
954538891 3:51381053-51381075 GAGGCTGGGATAGGGTGGAGAGG - Exonic
954603763 3:51893070-51893092 AATTCTGGGGTCAGCTGGAGTGG - Intergenic
954715589 3:52525180-52525202 GAGGCAGGGCTGGGCTGCAGTGG - Intronic
955045642 3:55357405-55357427 GAGGCAGAGCTCAGGTGGTGAGG - Intergenic
955386792 3:58487073-58487095 GAGGCTGGGCCCAGAGAGAGAGG + Intergenic
955509931 3:59669427-59669449 TAGGTTGGGCTCAGCTGGGGTGG + Intergenic
955650788 3:61191784-61191806 GAGGCTGCTCACAGCTGGAGTGG - Intronic
956794695 3:72707095-72707117 GAGGAGGGGCTCAGCTGCAGAGG - Intergenic
961349442 3:126290355-126290377 GGGGCTGGGCTGGGCTGGGGTGG - Intergenic
961512476 3:127411525-127411547 GAGGGTGGGGCCAGCTGCAGAGG - Intergenic
961572727 3:127811915-127811937 AGTGCTGGGCTCAGCTGGATGGG - Intronic
961667934 3:128505178-128505200 GAGGCTGGAGCCAGGTGGAGAGG + Intergenic
962351163 3:134656696-134656718 GGAACTGGGCTCAGATGGAGAGG + Intronic
962607717 3:137046130-137046152 GAGGATTGCCTCAGCTGGAAAGG + Intergenic
962744272 3:138385945-138385967 GAGCCAGTGCTTAGCTGGAGAGG + Intronic
963262192 3:143204246-143204268 AAGGCTGAGCTCAGCTGGGATGG - Intergenic
963545986 3:146658864-146658886 AAAGCTGGGCTGAGCTGGACAGG - Intergenic
963981532 3:151543615-151543637 GGGGCTTGGCTCAGCTCGACTGG - Intergenic
966311219 3:178596025-178596047 GTGTCTGGACTCAGCTTGAGAGG + Intronic
966344509 3:178963775-178963797 GAGGCAGGGGTCAGAGGGAGGGG - Intergenic
967331937 3:188298723-188298745 GGGTGTGGTCTCAGCTGGAGAGG + Intronic
968524723 4:1050272-1050294 GAGGCTGGGCCCAGCAGCTGGGG + Intergenic
969274691 4:6127465-6127487 CAGGCTGGGCCCAGCAGGGGAGG + Intronic
969296711 4:6274538-6274560 GAGGGAGGGCTCTGATGGAGAGG + Intronic
969336982 4:6516860-6516882 GAGCTTGGGGTCAGCTGGGGCGG - Intronic
969398499 4:6938471-6938493 GAGGCTGGGATCCCCTGGAGAGG - Intronic
969486009 4:7472739-7472761 GAGACTGGTCCCCGCTGGAGGGG + Intronic
969637537 4:8377964-8377986 GGGGCTGGGCTCTGCTCTAGGGG + Intronic
971234480 4:24828987-24829009 GAGGCTGGGATCCTCTGCAGAGG + Intronic
971852709 4:32004023-32004045 GAGTCTGGGCACAGCTTGACTGG + Intergenic
971911131 4:32798939-32798961 GCTGATGGGCTCAGCTGCAGTGG - Intergenic
972703270 4:41514986-41515008 GTGTCTGGGCTTAGCTGGTGTGG + Intronic
976513475 4:85936985-85937007 GAGGCTGAGATCAGCTTGTGGGG + Intronic
980793231 4:137647063-137647085 GAGTCTGGGCACAGCTGAACTGG - Intergenic
981389484 4:144171823-144171845 GAGGCTGAGCTGAGCTGGCCAGG + Intergenic
982083325 4:151810871-151810893 TCAGCTGGGCTCAGCTGAAGCGG - Intergenic
982216196 4:153084613-153084635 GAGGCAGGCCTCTGCTGGGGTGG + Intergenic
982293552 4:153804140-153804162 TAGGCTAGGCCCAGCTGGAATGG + Intergenic
982427253 4:155279665-155279687 GAGGCTGCCCTCAGCTCCAGAGG - Intergenic
983346331 4:166529710-166529732 TAGGCTGGGTTCTGCAGGAGTGG + Intergenic
985268045 4:188168151-188168173 GAAGCTGAGCTCATCCGGAGCGG - Intergenic
985345688 4:189002081-189002103 GAGGCCGTGCCCAGCGGGAGGGG - Intergenic
985349767 4:189046808-189046830 ATGGCTGAGTTCAGCTGGAGAGG - Intergenic
985652276 5:1112545-1112567 GAGGAGGGGCCCAGCAGGAGGGG - Intergenic
985671002 5:1206662-1206684 GGGGCTTGGCTCTGCTGGTGGGG + Intronic
985805330 5:2039032-2039054 AAGGCTAGGCTGAGCTGGACAGG + Intergenic
985957663 5:3276932-3276954 GAGGCTGAGCACAGCAGGGGAGG - Intergenic
986009407 5:3698664-3698686 CTTGGTGGGCTCAGCTGGAGAGG - Intergenic
986311157 5:6551966-6551988 GAGGCCGGGCTCCTGTGGAGGGG - Intergenic
986349307 5:6862487-6862509 AAGGCTGGGCTCAGCTGGGACGG + Intergenic
986662911 5:10074982-10075004 GGGGCAGGGCTCAGCTTGTGGGG - Intergenic
986662919 5:10075004-10075026 GGGGCAGGGCTCAGCTTGTGGGG - Intergenic
986662927 5:10075026-10075048 GGGGCAGGGCTCAGCTTGTGGGG - Intergenic
987044169 5:14090946-14090968 CAGGCTGGGCTCAGCTGGCCTGG - Intergenic
987148759 5:15017778-15017800 GAAGCCGGGATCAGCAGGAGTGG + Intergenic
987590102 5:19913694-19913716 GATGCTGAGCTAAGATGGAGGGG + Intronic
988397768 5:30716645-30716667 GAGGCTGGGCTGATCTTGATGGG + Intergenic
991150424 5:63361096-63361118 GAGGCTTTGCTGAGCTGCAGAGG + Intergenic
992308336 5:75466563-75466585 GAGTTGAGGCTCAGCTGGAGAGG - Intronic
993181872 5:84563590-84563612 GCCGCTGTGCTCAGCTAGAGAGG - Intergenic
994899493 5:105752517-105752539 GAGGCAGAGCACAGCTGAAGTGG + Intergenic
995728047 5:115203010-115203032 AAGCCTGTGCTCAGATGGAGAGG + Intergenic
995745046 5:115394103-115394125 GAGGCTGGGGTCTGCAGGGGTGG + Intergenic
998150698 5:139756042-139756064 GGGGCTGCGCTCACCTGGCGGGG - Intergenic
998406208 5:141876192-141876214 GAGGCTGGGCGCTGCCGGGGTGG - Intronic
998727538 5:145035082-145035104 GGGGCTGGGGTCAGGTGGATGGG - Intergenic
999425099 5:151481015-151481037 GAGGCTGAGCCAGGCTGGAGGGG - Intronic
1000337612 5:160253453-160253475 GTGCCTGGGCTCAGCTGCAATGG + Exonic
1001559515 5:172659982-172660004 GCAGCTGGTCTCAGCTCGAGGGG + Intronic
1002534581 5:179869268-179869290 GGGGCAGGGCTCAGCAGGAGTGG - Intronic
1002801899 6:531182-531204 GAGGTTGAGTCCAGCTGGAGAGG + Intronic
1003507351 6:6750986-6751008 GAAGGTGGGCTCAGGGGGAGAGG - Intergenic
1004503804 6:16231311-16231333 GGGGCTGGGGGCACCTGGAGTGG - Intergenic
1004513935 6:16306100-16306122 GAGGAAGGGCACAGCAGGAGCGG - Exonic
1004865640 6:19851455-19851477 GAGGCTGGGGGGAGCTGCAGTGG - Intergenic
1004902045 6:20203967-20203989 AAGGCTGAGCTGAGCTGAAGAGG - Intronic
1006369416 6:33634667-33634689 GGGGAGGGGCTGAGCTGGAGAGG + Intronic
1006877514 6:37311382-37311404 AAGGCTGGGGTCAGGTGCAGTGG + Intronic
1006921549 6:37630829-37630851 AAGGCTGGACTCAGCTGGGATGG + Exonic
1007376001 6:41457086-41457108 GATGCTGGGATCAGAGGGAGGGG - Intergenic
1007475396 6:42116460-42116482 GAGGAAGGGCTGAGGTGGAGGGG - Intronic
1010547298 6:77173796-77173818 GAAGCTGGGCAGAGCTGGACTGG + Intergenic
1012334591 6:98039624-98039646 AAGGCAGGGCTGAGGTGGAGTGG - Intergenic
1015464419 6:133532987-133533009 GATGCTGGTTTCAGCTGGGGTGG - Intergenic
1015966530 6:138699619-138699641 GATGCTGGGCTCAGCTCCTGGGG - Intergenic
1016714128 6:147204180-147204202 GAGGCTGGGCTGAGCGGGCTCGG + Intergenic
1017158362 6:151342074-151342096 GTGGCTGCGGTCAGCTGGGGAGG + Intronic
1019327386 7:445147-445169 GAGGTTGGGGTCAGCTGATGTGG + Intergenic
1019333436 7:471516-471538 GAGGCCTGGCTCTGCTGGCGGGG + Intergenic
1019513884 7:1431389-1431411 GAGGGTGGGGGCAGCTGGTGGGG - Intronic
1019702235 7:2479600-2479622 GAGGCTGGACTGTGCTGGAGGGG + Intergenic
1019713724 7:2529092-2529114 GGGGCTGGGACCAGCTGCAGTGG - Intronic
1019925089 7:4186548-4186570 GTGGCAGGGCTCAGCAGGTGGGG - Intronic
1019961896 7:4467491-4467513 GAGGCTGCTCTTGGCTGGAGAGG + Intergenic
1020040657 7:4998413-4998435 GCTGCTGGGCCCAGCAGGAGTGG + Intronic
1020203921 7:6101143-6101165 GAGGCTGTTCTTAGCTGAAGGGG - Intergenic
1021141669 7:17033475-17033497 GAGGCTGGGCACAGGGCGAGAGG + Intergenic
1022521816 7:31013374-31013396 GAGGCTGGACACAGAAGGAGTGG - Intergenic
1023996813 7:45163568-45163590 GAGGCTGGGGTCAGCAGTGGTGG + Intronic
1024046014 7:45586186-45586208 GAGGCTGGGCTGTCTTGGAGAGG + Intronic
1024559115 7:50628584-50628606 GAGGCGGGGCTCAGCGAGAGCGG + Intronic
1026277039 7:68889091-68889113 CAGGCTGGGCTCAGCAGGGCAGG - Intergenic
1026331795 7:69358471-69358493 GAGGTGGGACTCAACTGGAGAGG - Intergenic
1026942422 7:74294890-74294912 GAGGCTGGGCTCTGGTGTGGTGG + Intronic
1029537641 7:101165506-101165528 TGGGCTGGGCTCAGCTGGGTCGG + Exonic
1029599201 7:101553882-101553904 GAGGCTGGGGCCAGTGGGAGGGG + Intronic
1029613937 7:101644667-101644689 GTGGCTGGGCGCAGGTGGTGGGG + Intergenic
1029738922 7:102480639-102480661 GAGGCAGGGGTCAGGGGGAGAGG - Intergenic
1029756923 7:102579802-102579824 GAGGCAGGGGTCAGGGGGAGAGG - Exonic
1029774862 7:102678862-102678884 GAGGCAGGGGTCAGGGGGAGAGG - Intergenic
1032373392 7:131383426-131383448 GGGACTGGGCTTAACTGGAGTGG - Intronic
1033182526 7:139194886-139194908 GAGGAGGGGCTAAGATGGAGAGG + Intergenic
1034255415 7:149722201-149722223 GAGGCTGGGCTCAGGGGGAAGGG + Intronic
1034701451 7:153099653-153099675 GAGGCTGCGCTCAACCTGAGGGG + Intergenic
1034989376 7:155538489-155538511 GAGTCTGGGGTTAGCAGGAGGGG - Intergenic
1035087029 7:156269088-156269110 GAGGCTGGGGGCAGATGGGGAGG + Intergenic
1035374743 7:158400672-158400694 GAGGCTGGTCTCAGTTGCTGGGG - Intronic
1035468023 7:159092321-159092343 GTGGCTGGGCCCATCTGGAGGGG - Intronic
1038359877 8:26865707-26865729 GAGGCTGTGCTGAGCTTGACGGG + Intronic
1038720116 8:30027734-30027756 GGGGCTGGGGTCAGCTGGATGGG - Intergenic
1039215594 8:35266775-35266797 AAGGCTGGGCTCAGCTGGGATGG + Intronic
1039659476 8:39447252-39447274 TTGGCTGGGGTCAGTTGGAGAGG + Intergenic
1042348377 8:67750726-67750748 GAGGAAGGACACAGCTGGAGAGG - Intergenic
1044242282 8:89902050-89902072 GATGCGGGGGTCAGCGGGAGAGG + Intronic
1044958748 8:97508493-97508515 TAGGCTGGGCTCAGCTAGGGTGG + Intergenic
1045357082 8:101398854-101398876 GATGCAGGGCACAGTTGGAGGGG - Intergenic
1045806518 8:106168652-106168674 GAGGTTGGTGTAAGCTGGAGAGG - Intergenic
1047389588 8:124439481-124439503 GAGGCTGGGGTGAGCTGGGTGGG - Intergenic
1047928193 8:129701517-129701539 GGAGCTGGGCTGAGCTGGTGTGG - Intergenic
1047928820 8:129706129-129706151 GAGGAGGGGCTCAGGTGTAGAGG + Intergenic
1048534629 8:135281577-135281599 CAGGCTGGGCTCAGCAGGGATGG + Intergenic
1049202499 8:141347164-141347186 GGGGCTGGGGCCAGCTGGAGGGG + Intergenic
1049272086 8:141701245-141701267 GAGGCTGGGCTGGGCTGGGGAGG + Intergenic
1049358088 8:142198609-142198631 GAGGCTGGGCTGGGCAGGGGTGG - Intergenic
1049453444 8:142675138-142675160 GAGGCTGTGCCCAGCTGGAAGGG + Intronic
1049564897 8:143332938-143332960 GAGGCTGGTCTCACCTGACGTGG - Intronic
1049602133 8:143512911-143512933 CAGGCTCGGCTCTCCTGGAGGGG - Intronic
1049785799 8:144450136-144450158 GAGGCTGGGCTGACCCGAAGAGG - Exonic
1049798668 8:144507780-144507802 GGGGCTGGGCTGAGCGGGAGTGG + Intergenic
1050017413 9:1248957-1248979 GAGGCTGAGCTCAGCTGACAAGG + Intergenic
1050298205 9:4228327-4228349 GAGTCGGGGCTGAGCCGGAGAGG + Intronic
1051356966 9:16248157-16248179 GAGGCTTGCCTCACCTTGAGCGG - Intronic
1053016709 9:34665964-34665986 GGGGCTGGGGTCACCTGGAGGGG + Exonic
1053427059 9:38017143-38017165 GAAGCGGGGCTAAGCAGGAGGGG - Intronic
1054804027 9:69380929-69380951 GAGTCAGTGCTCAGCTGTAGAGG + Intronic
1055044663 9:71911483-71911505 GAGGCTGCGCGGAGCCGGAGGGG + Intergenic
1055722745 9:79193962-79193984 GAGGCTGGGCTGAGCTGGAGCGG - Intergenic
1056327065 9:85488945-85488967 GAAGCTGGGCTACACTGGAGTGG + Intergenic
1056540101 9:87563792-87563814 TGGGCTGGGCTCAGCTGGGCAGG - Intronic
1056890755 9:90489473-90489495 CAGGCTGGTAGCAGCTGGAGGGG - Intergenic
1057200645 9:93137935-93137957 CAGGCAGGGCTCAGTGGGAGGGG + Intergenic
1057210589 9:93199025-93199047 GAACCTGGGTCCAGCTGGAGGGG - Intronic
1057815327 9:98290054-98290076 AAGGCTGGGGTCAGCTGGCCTGG + Exonic
1058548383 9:106085957-106085979 AAGGCTGGGCACTGCTAGAGAGG + Intergenic
1059307633 9:113367332-113367354 GGGGCTGGGTTTTGCTGGAGAGG - Intronic
1059452191 9:114377346-114377368 GAGGCTGGTCTCAGCTTGGAAGG - Exonic
1060004321 9:119986284-119986306 GAGGCTGGGATCACTGGGAGGGG - Intergenic
1060032466 9:120227215-120227237 AAGGCTGGGCTCTGCTGGGATGG - Intergenic
1060156594 9:121324636-121324658 TGGGCTGGGCTCACCTGGACAGG - Exonic
1060270160 9:122134583-122134605 GAGGATGGGCTCAGAGGCAGGGG - Intergenic
1060506659 9:124202911-124202933 GAGGCTGGGCAGTGCTGGAAGGG + Intergenic
1060759646 9:126236435-126236457 GGGGCTGGGCTGGGCTGGTGTGG - Intergenic
1060952629 9:127613203-127613225 GAGGCTGAGCTCTGCTGGGCCGG + Intronic
1061449297 9:130659944-130659966 GAGGGTGTGCGAAGCTGGAGAGG + Intergenic
1061493912 9:130961039-130961061 GAGCCTGGGCCCAGTTGGAATGG - Intergenic
1061804175 9:133128895-133128917 GGGGCTGGGGGCAGCTGGGGAGG + Intronic
1061893234 9:133633703-133633725 GAGGGTGCCCTGAGCTGGAGGGG - Intergenic
1061995689 9:134181609-134181631 GCAGCTGGGCCCAGCTGGAGAGG + Intergenic
1062192830 9:135256496-135256518 GGGGCTGCGCCCAGGTGGAGAGG - Intergenic
1062206151 9:135338548-135338570 GAGACTGGACTCAGCCAGAGAGG + Intergenic
1062214103 9:135379818-135379840 GGGGCTGGGCCGAGCTGGAGAGG - Intergenic
1062396120 9:136353582-136353604 GAGGCTGGGGCCAGCTGTTGAGG - Intronic
1062429768 9:136521756-136521778 GTGGCTGGGCTCAGCTGACTGGG + Intronic
1062577251 9:137214476-137214498 GAGGCTGGGCCGGGCTGCAGGGG + Intronic
1062590471 9:137272369-137272391 GTGCCTGGGCACAGCTGGGGAGG + Intronic
1186768455 X:12794190-12794212 GAGGCTGGTCACAGCTGAGGCGG + Intronic
1186895091 X:13997478-13997500 TAGGCTGGGCTCAGCTAGGTGGG - Intergenic
1187572179 X:20515921-20515943 TAGGCTGGGCTCTGCTGGGGAGG + Intergenic
1188055389 X:25535202-25535224 GAGGCAGGGCACAGGTGGACTGG - Intergenic
1189286264 X:39854441-39854463 GAGGCTGGAGTCAGGAGGAGAGG - Intergenic
1191038885 X:56057636-56057658 TAGGCTGGGGCCAACTGGAGAGG + Intergenic
1192016694 X:67339035-67339057 GAGGCAGGGCTCAACTTTAGAGG - Intergenic
1192202894 X:69078162-69078184 GAGGCTGAGCTCAGCTGGCTTGG - Intergenic
1195107906 X:101617854-101617876 GAGGGTGGGCGCTGCTTGAGAGG - Intronic
1195808394 X:108801319-108801341 CAGGCTGTGCTGAGCTGCAGTGG - Intergenic
1195928994 X:110054484-110054506 GAGGCTGAACTGAACTGGAGTGG + Intronic
1198649679 X:138848273-138848295 GATAGAGGGCTCAGCTGGAGAGG - Intronic