ID: 1166040503

View in Genome Browser
Species Human (GRCh38)
Location 19:40199609-40199631
Sequence ATGTAGGAGAGGGAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 563}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166040492_1166040503 25 Left 1166040492 19:40199561-40199583 CCCATGTGGCTGCCACTGTGCAG 0: 1
1: 0
2: 6
3: 27
4: 315
Right 1166040503 19:40199609-40199631 ATGTAGGAGAGGGAGCTGGAAGG 0: 1
1: 0
2: 1
3: 42
4: 563
1166040496_1166040503 13 Left 1166040496 19:40199573-40199595 CCACTGTGCAGGCAAGGAAGAGA 0: 1
1: 0
2: 0
3: 37
4: 433
Right 1166040503 19:40199609-40199631 ATGTAGGAGAGGGAGCTGGAAGG 0: 1
1: 0
2: 1
3: 42
4: 563
1166040493_1166040503 24 Left 1166040493 19:40199562-40199584 CCATGTGGCTGCCACTGTGCAGG No data
Right 1166040503 19:40199609-40199631 ATGTAGGAGAGGGAGCTGGAAGG 0: 1
1: 0
2: 1
3: 42
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166040503 Original CRISPR ATGTAGGAGAGGGAGCTGGA AGG Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900364116 1:2303832-2303854 TTGTAGGAGTAGAAGCTGGAGGG - Exonic
901199035 1:7456291-7456313 AGGAAGGACAGGGAGCGGGAAGG + Intronic
901276943 1:7999167-7999189 AAGTAGGAGAGAGAGCAAGAGGG + Intergenic
901475300 1:9485320-9485342 CACTGGGAGAGGGAGCTGGAGGG - Intergenic
901749346 1:11396388-11396410 AAAGAGGAGAGGGAGCTGGGCGG + Intergenic
902139804 1:14343473-14343495 ATGTAGGTGATGGAGCTCCATGG + Intergenic
902686203 1:18079295-18079317 ATGAAGGAGAGGGGGAAGGAAGG + Intergenic
902790000 1:18761411-18761433 TGGTGGGAGCGGGAGCTGGAGGG - Intergenic
903033117 1:20477408-20477430 CTGTAAGAGAGAGAGCTGGGTGG - Intergenic
903262181 1:22137234-22137256 ATGGGGGAGGGGGAGCTGGTGGG + Intronic
903674225 1:25054332-25054354 AAGGAGGAGAGGGAGAGGGAAGG - Intergenic
903681981 1:25103318-25103340 GAGTGGGAGAGGGAGCTGGCAGG + Intergenic
904091871 1:27950560-27950582 ACTTAGGAGAGTGAGATGGAAGG - Intronic
904752510 1:32749742-32749764 GTGAGGGAGAGAGAGCTGGAAGG - Intronic
904930131 1:34081418-34081440 ACGAAGAAGAGGGAGCGGGAGGG - Intronic
905151619 1:35931806-35931828 AGGTAGGTAAGGGAGCTGGCTGG - Intronic
905205134 1:36339138-36339160 ATTGAGGAGAGGGAGGGGGAGGG + Intergenic
905303176 1:36999279-36999301 AGGTGGGAGAGGAAGCTGCAGGG + Intronic
905370171 1:37478867-37478889 ATGTGGCAGAGGGACCGGGAAGG + Intronic
905384350 1:37590638-37590660 ATGTTAGAGAGGGATCTGCATGG + Intronic
905524196 1:38624153-38624175 TTCTAGGGGAGGAAGCTGGAGGG - Intergenic
905951669 1:41956819-41956841 ATGGAGGAGAAGGAGTTGGAAGG + Intronic
907676896 1:56526213-56526235 ATGAAGGAAAGGGAGCAGGACGG + Intronic
907706787 1:56839403-56839425 CAGTGGGAAAGGGAGCTGGAAGG + Intergenic
908170684 1:61501583-61501605 CTGAAGGAGAGACAGCTGGAAGG + Intergenic
908242195 1:62196833-62196855 CTTTAGGAGATGGAGGTGGAAGG - Intronic
908269898 1:62412334-62412356 AAGAGGGATAGGGAGCTGGAAGG - Intergenic
908314043 1:62915374-62915396 AAGTAGGAGAGGAAGTTGGCTGG - Intergenic
908790009 1:67771729-67771751 TTCCAGGAGAGGCAGCTGGAAGG + Intronic
909060038 1:70869303-70869325 ATGTAGGAGATGGGGCCTGATGG - Intronic
910208986 1:84774967-84774989 ATGAAGGAGAGGAAGATGGATGG - Intergenic
910232759 1:85003309-85003331 ATCCAGGAGTGGGAGATGGACGG + Intronic
910675851 1:89815884-89815906 GTGGAGGAAATGGAGCTGGACGG - Intronic
910766776 1:90790009-90790031 ATGGCGAAGAGGGAGATGGAAGG + Intergenic
911052925 1:93686978-93687000 AGGAAGGAGAGGGTGCTGTAAGG - Intronic
911406681 1:97449427-97449449 AAGTGGGAGAGGGAGGTGGGAGG + Intronic
911512866 1:98828440-98828462 ATGTTGGAGATGGGGCTTGATGG + Intergenic
911672266 1:100620472-100620494 ATGAGAGAGAGGGAGCAGGAGGG - Intergenic
912137855 1:106683181-106683203 ATGCAGGAGATGGGGCTTGATGG + Intergenic
912153621 1:106888487-106888509 ATGTAGGGGATGGAAGTGGAGGG + Intergenic
912262170 1:108121412-108121434 GAGTGGGAGAGGTAGCTGGAAGG - Intergenic
913264213 1:117028389-117028411 ATATATGAGAGGGATTTGGAGGG + Intronic
914710543 1:150209161-150209183 GTGGAGGAGAGGGTGCTAGAGGG - Intergenic
915554788 1:156655376-156655398 CTGGAGGAGAGGGAGCCAGAAGG + Intronic
915718112 1:157963399-157963421 ATTTAGGAGGGAGAGGTGGACGG + Intergenic
915903228 1:159861138-159861160 AAGTGGAAGAGAGAGCTGGATGG + Intronic
916124216 1:161554946-161554968 TTCTAGGAGAGGGAGATGGTTGG + Intergenic
916134099 1:161636305-161636327 TTCTAGGAGAGGGAGATGGTTGG + Intronic
917929549 1:179813983-179814005 ATGTAAAAGGGGGAGCTGTATGG - Exonic
917963573 1:180164906-180164928 AAGCAGGAGAGGAAGCAGGAGGG + Intronic
918222890 1:182452120-182452142 ATGTAGGAAAAGGAGCAGGTTGG + Intronic
918367712 1:183826315-183826337 ATGGAGGATAGGGAGTTGCAGGG - Intronic
918790618 1:188822647-188822669 ACATAGAAGAGGGAGCTGTAGGG - Intergenic
919619384 1:199847787-199847809 ATTTTGGAGATGGAGCTGGCAGG - Intergenic
919960180 1:202459301-202459323 ATGGGGCAGAGGGAGCAGGAGGG + Intronic
920000104 1:202791588-202791610 ATGGATGAGAGGGAGCTGTCTGG - Intronic
920078219 1:203352487-203352509 ATGTAGGAGGGGCTGCTGTATGG + Intergenic
920094378 1:203476616-203476638 AAGCAAGAGCGGGAGCTGGAAGG + Intronic
920760765 1:208781890-208781912 ATTTAGGAGGGGGAGCGGGAAGG - Intergenic
922194166 1:223345495-223345517 ATGCAGGAGAGGGAGCGGCAGGG - Intronic
923174720 1:231453558-231453580 AAGTGGGAGAGGGAGGGGGAGGG - Intergenic
923205570 1:231755652-231755674 ATATAGGAGAAGGAACTGAATGG - Intronic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
1063176250 10:3553165-3553187 AGGTAGATGTGGGAGCTGGACGG - Intergenic
1064295803 10:14078257-14078279 AAGTAGGAGAAGAACCTGGAGGG + Intronic
1064634024 10:17345499-17345521 AGGCAGGAGAAGGAGATGGAGGG + Intronic
1064642587 10:17429492-17429514 AGGGAGGAGAGGCAGTTGGAAGG - Intronic
1064741582 10:18440134-18440156 ATGTGGGAGAGGGAGTGGAAGGG + Intronic
1065729557 10:28698643-28698665 ATGTATGAGAGAGAGCAAGAGGG + Intergenic
1066003171 10:31123599-31123621 TTGGAGGAGGGGGATCTGGATGG - Intergenic
1066122202 10:32300385-32300407 ATGCAGGAGCGGGGGCGGGAGGG - Intronic
1068392909 10:56422619-56422641 ATGTAGGAGAGAGGGTTGAATGG + Intergenic
1069763818 10:70836537-70836559 AGGGAGGAGAGGGAGAGGGAAGG - Intronic
1069780036 10:70949620-70949642 TTGGAGGAGAGGGACCTGGGAGG + Intergenic
1069957319 10:72060043-72060065 ATCGAGGAGAGGGCACTGGAGGG + Exonic
1071466279 10:85942519-85942541 AGGAAGGAGAGGAAGCTGGGTGG - Intronic
1071554897 10:86594373-86594395 AGGAAGGAGAGGGAGGGGGAGGG + Intergenic
1071701841 10:87947001-87947023 CTGTAGGAAAGGGGGCTGGAAGG + Intronic
1071718536 10:88120289-88120311 AGGAAGGAGGGGGAGCAGGAAGG + Intergenic
1072101222 10:92231259-92231281 ATGTAGTGGAGGGGGCTAGAAGG - Intronic
1072193810 10:93097632-93097654 CTGACGGGGAGGGAGCTGGAAGG + Intergenic
1072489263 10:95887775-95887797 ATGTAGGTGAGTGAGTTGGGGGG - Intronic
1072983892 10:100122540-100122562 ATTGAGGAGAGGGTGCAGGAGGG - Intergenic
1074025005 10:109625412-109625434 CTGAAGGAGGGGGATCTGGATGG - Intergenic
1075289943 10:121220463-121220485 ATGAGAGAGAGAGAGCTGGAGGG - Intergenic
1075534979 10:123263289-123263311 AAGGAGGAGGAGGAGCTGGAGGG + Intergenic
1076697338 10:132253320-132253342 AGGGAGCAGAGGGAGCTGGAGGG + Intronic
1076697358 10:132253395-132253417 AGGGAGTCGAGGGAGCTGGAGGG + Intronic
1076697366 10:132253424-132253446 AGGGAGTCGAGGGAGCTGGAGGG + Intronic
1076697379 10:132253472-132253494 AGGGAGTCGAGGGAGCTGGAGGG + Intronic
1076697397 10:132253538-132253560 AGGGAGTCGAGGGAGCTGGAGGG + Intronic
1076697402 10:132253557-132253579 AGGGAGTCGAGGGAGCTGGAGGG + Intronic
1076697410 10:132253586-132253608 AGGGAGCCGAGGGAGCTGGAGGG + Intronic
1076697416 10:132253605-132253627 AGGGAGCCGAGGGAGCTGGAGGG + Intronic
1076697422 10:132253624-132253646 AGGGAGCTGAGGGAGCTGGAGGG + Intronic
1077434351 11:2531627-2531649 CCGGAGGAGAGGGAGCTGCAGGG - Intronic
1077971562 11:7197727-7197749 CTGTTGGAGAAGCAGCTGGAAGG - Intergenic
1078455398 11:11470883-11470905 TTTTAGGAGGGGGACCTGGAGGG - Intronic
1078733239 11:13995585-13995607 GTGTAGGGGAGGGACCTGGTGGG - Intronic
1079357803 11:19744367-19744389 ATTTAGGACAGGGAGATGGAAGG - Intronic
1080237883 11:30092836-30092858 AGGGAGGAGAGGGAGGGGGAGGG - Intergenic
1081199257 11:40196520-40196542 ATGTAGGAGAGGGAATTGAAAGG - Intronic
1081374201 11:42339778-42339800 ATGTTGAAGAGGCAGCTGGATGG + Intergenic
1082812663 11:57487953-57487975 ATGGAGGAGGGGGAGCTAGAGGG + Intronic
1083172247 11:60929910-60929932 TGGTAGGGAAGGGAGCTGGATGG + Intronic
1083213467 11:61203880-61203902 ATCTAAGAGAGGAAGATGGAAGG - Intronic
1083216349 11:61222716-61222738 ATCTAAGAGAGGAAGATGGAAGG - Intronic
1083219231 11:61241542-61241564 ATCTAAGAGAGGAAGATGGAAGG - Intronic
1083457322 11:62787549-62787571 AGGTAGGCGGGGGAGCTGGCCGG + Intronic
1084653487 11:70502272-70502294 TTGGAGGCGGGGGAGCTGGAGGG + Exonic
1084684550 11:70686055-70686077 AGGAAGGAAGGGGAGCTGGATGG - Intronic
1084684574 11:70686146-70686168 AGGAAGGAAGGGGAGCTGGATGG - Intronic
1085427202 11:76415196-76415218 ATGCAGGAGATGGGGCTGGCTGG + Intergenic
1085541013 11:77269700-77269722 ATGTACTAGAGGGAGAGGGAGGG - Intronic
1086289073 11:85284901-85284923 CTGTAGGGGAAGGAGATGGATGG - Intronic
1086446653 11:86878226-86878248 ATGAGGGAGAGGGAGGGGGAGGG - Intronic
1087137069 11:94731807-94731829 GTGTTGGAGAGGGAATTGGAGGG - Intronic
1087933710 11:104006802-104006824 AGGATGGATAGGGAGCTGGAAGG - Intronic
1088685515 11:112281495-112281517 AAGTTGGGGAGGTAGCTGGAAGG + Intergenic
1088805423 11:113347951-113347973 AGGTAGGAGAGGGGCCAGGAAGG - Intronic
1088812575 11:113401501-113401523 AGGCAGCAGAGGGAGTTGGAGGG + Intergenic
1089490782 11:118882521-118882543 ATGGAGGAGAGGGTGAAGGAGGG + Intergenic
1089630751 11:119782763-119782785 ATGGAGCAGAGGGAGCAGCAGGG - Intergenic
1090055660 11:123422148-123422170 TTGTAGGAGAGGGATGTGGGGGG + Intergenic
1091058552 11:132441059-132441081 AGGAAGGAGAGGGAGGAGGAAGG + Intronic
1091273070 11:134331782-134331804 CGGTAGGAGAGGGGGCTGGCGGG - Intergenic
1092120373 12:6039428-6039450 ATGAACGAGAGGCAGTTGGAAGG - Intronic
1092191832 12:6526868-6526890 CTGGAGGAGAGGGAGAGGGAAGG - Intronic
1092786520 12:12031940-12031962 AGGTATGAGAGACAGCTGGAAGG + Intergenic
1092865963 12:12761734-12761756 GTATATGAGAGGGTGCTGGAAGG + Intronic
1093490030 12:19695402-19695424 ATTTAGGAGTGGGAGGAGGAAGG + Intronic
1094729778 12:33161573-33161595 CTGTGGGAGAGGGAGCATGAGGG + Intergenic
1096167756 12:49437867-49437889 AGGAGGGAGAGGGAGCTGAATGG + Intronic
1096445147 12:51683097-51683119 ATGTATGAGAGGCAGCAGGAGGG - Intronic
1096814938 12:54196044-54196066 ATTTTGAAGAGGGAGCTGGAGGG - Intergenic
1097437471 12:59569204-59569226 ATATAGAAGAGGGAGGTTGAAGG - Intergenic
1097626636 12:62010163-62010185 ATGGGGGAGAGGGAGGGGGAGGG - Intronic
1098390774 12:69967545-69967567 ATGGAGGAGAGGTAAATGGAGGG - Intergenic
1098508395 12:71282162-71282184 AAGTGGGGGAGGGAGGTGGAGGG + Intronic
1099141393 12:78980915-78980937 AGGGGGGAGAGGGAGATGGAGGG + Intronic
1099796543 12:87408057-87408079 ATGTTGGAGATGGGGCTGGTGGG + Intergenic
1099924083 12:88996245-88996267 GTATAGAAGATGGAGCTGGAGGG + Intergenic
1100145718 12:91675021-91675043 ATGTATAAGTGGGAGCTGAATGG - Intergenic
1101046797 12:100814916-100814938 AAGTGGGAGAGGGGGCTGCAGGG + Intronic
1101276116 12:103203228-103203250 ACTTGAGAGAGGGAGCTGGATGG + Intergenic
1101541053 12:105665782-105665804 AGGCAAGAGAGGGAGCTGGCAGG - Intergenic
1101757327 12:107631090-107631112 AGGTAGGAGAGAGAGAAGGAAGG - Intronic
1102230229 12:111257200-111257222 AGGAAGGAGAGGGAGGAGGAGGG - Intronic
1102408760 12:112698807-112698829 AAGTAGGAGAAGGAGAAGGAGGG - Intronic
1102994708 12:117339918-117339940 TTCTAGGAAAGGGGGCTGGAAGG + Intronic
1103139169 12:118533869-118533891 ATGAAAGAAAGGGAGGTGGATGG - Intergenic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1104765152 12:131325675-131325697 ATGTGTGAGGGGGAGCTGGCAGG - Intergenic
1105813957 13:24016638-24016660 AGGAAGGAGAGGGAGCGGGGAGG - Intronic
1105870970 13:24505991-24506013 CTGTAGGAGTGGGAGGTGAAAGG - Intronic
1106231903 13:27826948-27826970 AGGTAGGTGGGGGAGCAGGAAGG - Intergenic
1106726314 13:32490057-32490079 GTGTAGGGGAGGGGGATGGAGGG - Intronic
1107975011 13:45680231-45680253 AGGATGGATAGGGAGCTGGAAGG + Intergenic
1112250443 13:97774465-97774487 AAGAAGGAGAGGGAGGGGGAGGG - Intergenic
1112331301 13:98478880-98478902 ATGCAGGCGAGGGAGGTGAATGG - Intronic
1113593934 13:111518272-111518294 GGGCAGGTGAGGGAGCTGGAGGG - Intergenic
1116097229 14:40386268-40386290 ATGGAAGAGGAGGAGCTGGAAGG + Intergenic
1117201119 14:53391131-53391153 ATGTGGGAGTGCGAACTGGAAGG + Intergenic
1117784894 14:59272665-59272687 ATGTAGGAGAGAGGGAGGGAGGG + Intronic
1117912106 14:60646654-60646676 ATGGAGGGAGGGGAGCTGGAAGG + Intronic
1118092613 14:62498710-62498732 AAGGAGGAGAGGGAGTTGGGAGG + Intergenic
1118192778 14:63595165-63595187 ATTCTGGAGGGGGAGCTGGAAGG - Intergenic
1118894695 14:69936037-69936059 AGGTAGGGGAGGGATGTGGAGGG - Intronic
1120176303 14:81297109-81297131 AGGCAGGAGAGGTAGCTGGAAGG + Intronic
1120571582 14:86124330-86124352 AAGTAGGAGAGAGAGGTGGAGGG + Intergenic
1120610334 14:86634011-86634033 ATGTATGCGAGGGACCTGGTGGG - Intergenic
1121324462 14:93011946-93011968 AGGTTGGAGAGGGAGCAGCAAGG - Intronic
1121631229 14:95423167-95423189 ATTTTGGAGAGGGAGAGGGATGG + Intronic
1121908079 14:97765727-97765749 AGGGAGGAGAGGGAAGTGGAAGG - Intergenic
1121944446 14:98105391-98105413 AGGTAGGAGAGGCCCCTGGAGGG + Intergenic
1122410243 14:101521996-101522018 ATGTGGGACAGGGAGCTAGCAGG + Intergenic
1122660781 14:103293620-103293642 ATGGAGGGGAGGGCGCGGGACGG - Intergenic
1122759929 14:104016041-104016063 ATGGCGGTGAGGGAGCTGGCTGG + Exonic
1122915907 14:104858892-104858914 ATGGTGGAGATGGAGATGGAGGG - Intergenic
1125225233 15:37388851-37388873 ATGTTGGGGAGGGACCTGGTGGG - Intergenic
1125350001 15:38756366-38756388 ATGGAGGGGAGGGGGCTGCATGG + Intergenic
1125429194 15:39579376-39579398 AGGAAGGGGAGGGAGATGGATGG + Intergenic
1125663469 15:41412653-41412675 AAGGAGGAGAGGAGGCTGGATGG - Intronic
1126698231 15:51343389-51343411 ATGTAGGGTAGAGAGCTGAAAGG - Intronic
1127564165 15:60170187-60170209 ATGCAGGAGACTGAGGTGGAAGG - Intergenic
1127854905 15:62946231-62946253 AAGTAGGAGAGGGAGTGAGAGGG + Intergenic
1128691674 15:69729173-69729195 CTGGAGGAAAGGGGGCTGGAGGG - Intergenic
1129145885 15:73646811-73646833 ATGGAGGAGGGGGAGGGGGAGGG + Intergenic
1129605647 15:77023759-77023781 ATGAAGGAGGCGGGGCTGGAGGG + Intronic
1129702608 15:77776338-77776360 ATGGTGGAGGGGGTGCTGGAAGG - Intronic
1130193468 15:81758096-81758118 GTGTAGGGGAGGCAGCTGGTGGG - Intergenic
1130513287 15:84606604-84606626 ATGGAGGAGAGAGTGATGGAGGG + Intronic
1131161820 15:90110351-90110373 ATGAAAGAGAGAGAGATGGAGGG + Intergenic
1131430862 15:92387842-92387864 ATGGTGGAAAGGAAGCTGGAAGG + Intergenic
1131827707 15:96333694-96333716 TTGGAGGAGAGGGAGCGGGAGGG - Intronic
1131842945 15:96457576-96457598 TAGGAGTAGAGGGAGCTGGAGGG - Intergenic
1131970078 15:97882921-97882943 ATTTAAGAGAAGGAGATGGATGG - Intergenic
1132360911 15:101214601-101214623 ATGTTGGAGGGGGACCTGGTGGG + Intronic
1132907351 16:2289560-2289582 CTGCAGGGCAGGGAGCTGGATGG + Exonic
1133903718 16:10001479-10001501 ATGTAGGGCAGAGAGTTGGAAGG - Intronic
1134058952 16:11187612-11187634 AGGTTGGGGAGGGGGCTGGAGGG - Intergenic
1134192115 16:12129757-12129779 AGGTAGGAGAGGGTGAGGGATGG + Exonic
1134238408 16:12485897-12485919 ATCTAGGAGAGGGAGTAGGTGGG + Intronic
1134751398 16:16628216-16628238 GGGGAGGAGAGGGAGATGGAGGG - Intergenic
1134994063 16:18725387-18725409 GGGGAGGAGAGGGAGATGGAGGG + Intergenic
1135491159 16:22910907-22910929 ATGGAGGAGAGGCAGGTTGAAGG + Intronic
1135694724 16:24575833-24575855 AGGGAGGAGAGGGAGAGGGAGGG + Intergenic
1136146582 16:28319991-28320013 TTGCTAGAGAGGGAGCTGGAGGG + Intronic
1136685944 16:31995021-31995043 ATGTAGGAGCGGGATGCGGACGG - Intergenic
1136786554 16:32938554-32938576 ATGTAGGAGCGGGATGGGGACGG - Intergenic
1136883214 16:33915240-33915262 ATGTAGGAGCGGGATGGGGACGG + Intergenic
1138333286 16:56232165-56232187 TTGTAGGAGAGGCTGCAGGAGGG - Intronic
1138696347 16:58817086-58817108 ATGTAGGGGAGGGGGGAGGAGGG - Intergenic
1139818629 16:69700126-69700148 AGGGAGGAGGGGGAGATGGAAGG - Intronic
1140153780 16:72401171-72401193 AGGGAGGAGAGGGAGAGGGAGGG + Intergenic
1140162717 16:72515183-72515205 CTGTAGGGGGTGGAGCTGGAGGG - Intergenic
1140274797 16:73498901-73498923 ATGTGGGAGATGGACTTGGATGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141174992 16:81712927-81712949 AGGTAGCAGAGGGAGCTGGATGG - Intergenic
1141270118 16:82531910-82531932 ATGAGGGAGAGGCAGATGGAAGG - Intergenic
1141840954 16:86573720-86573742 ATTTAGGGGATGGAGCTGGGAGG + Intergenic
1203088789 16_KI270728v1_random:1200220-1200242 ATGTAGGAGCGGGATGGGGACGG - Intergenic
1143684850 17:8505363-8505385 ATGGAAGAGAGGCACCTGGAGGG - Intronic
1144058803 17:11563092-11563114 ATTTCAGAGAGGGAGCTGGCTGG + Exonic
1144334341 17:14255524-14255546 TTGTAGGAGAGGGAGGAGGAGGG - Intergenic
1144480502 17:15625137-15625159 ATGTTGGAGGTGGAGCTGGGTGG - Intronic
1144578653 17:16445491-16445513 GGGAAGGAGAGGGAGGTGGAGGG + Intronic
1144917808 17:18738608-18738630 ATGTTGGAGGTGGAGCTGGGTGG + Intergenic
1146370210 17:32261426-32261448 ATGCTGGAGATGGAGGTGGAGGG + Intergenic
1146681028 17:34808356-34808378 ATGTTGGAGGGGGGGCTGGTGGG + Intergenic
1147310981 17:39596100-39596122 ATAGAGGGGTGGGAGCTGGAGGG - Intergenic
1148029809 17:44611788-44611810 CTGGAGGAGAGGGAGCTATAGGG - Intergenic
1148535424 17:48434506-48434528 ATCTAGGAGTGTGAGCTGGAAGG - Intergenic
1149372918 17:56013135-56013157 AAGTAAGAGAGGGAGGTGGGTGG + Intergenic
1149433780 17:56616699-56616721 ATGGTGGAGAGGGGGCTGGGAGG - Intergenic
1149439295 17:56661724-56661746 AAGTGAGAGAGGGGGCTGGAAGG + Intergenic
1149867908 17:60160942-60160964 AGGCAGGAGAGTGAGGTGGAGGG + Intronic
1150854726 17:68741042-68741064 GAGTTGGATAGGGAGCTGGAAGG - Intergenic
1151179583 17:72317269-72317291 ATGTAAGAGACGAAGCTGAATGG + Intergenic
1151345264 17:73497573-73497595 ATGCAGGAGAGGGAGGAAGATGG - Intronic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1151572048 17:74931376-74931398 AAGCAGCAGATGGAGCTGGAAGG + Intronic
1153170134 18:2306981-2307003 ATGAAGGAGAGAATGCTGGATGG - Intergenic
1153354791 18:4123117-4123139 ATGAGGGAGAAAGAGCTGGAAGG - Intronic
1153631341 18:7073096-7073118 AGCTGGGAGAGGGAGCAGGAAGG - Intronic
1155739682 18:29272687-29272709 GTGAATGAGAGGGAGCTGAAAGG - Intergenic
1156464995 18:37343032-37343054 AGGTAGATGTGGGAGCTGGAAGG + Intronic
1156961092 18:43031944-43031966 ATGTAGCAGAAGCAGGTGGAAGG + Intronic
1157514207 18:48299311-48299333 AGGCAGGAGAGGGAGCTGCAAGG - Intronic
1159034444 18:63263444-63263466 ATGGGGGTGAGGGAGCAGGAGGG + Intronic
1159352276 18:67291182-67291204 ATAAAGGGGAGGGAACTGGAAGG + Intergenic
1159544106 18:69818039-69818061 TTGTAGGAGAAGGAGGTGTATGG - Intronic
1160016148 18:75142073-75142095 ATGCATGATAGGTAGCTGGAAGG + Intergenic
1160532435 18:79573425-79573447 ATCTAGAAGAGGAGGCTGGAAGG + Intergenic
1160673170 19:375891-375913 AGGTCGGAAAGGGAGCAGGACGG - Exonic
1160872799 19:1284790-1284812 GTGCAGGAGAGGGAACTGCAGGG - Intergenic
1161256001 19:3310066-3310088 AGGGAGGAGAGAGAGATGGAGGG - Intergenic
1161258420 19:3322408-3322430 ATGGATGGGAGGGAGGTGGATGG + Intergenic
1162076525 19:8191578-8191600 CTGTAGGAGAGGGGGCAGGTAGG - Intronic
1162395880 19:10417868-10417890 AGGTAGGAGAGGGAGCAGAGTGG + Intronic
1162458336 19:10799271-10799293 CTGTAGGATAGGGAGCGGGCTGG - Intronic
1162955076 19:14092882-14092904 AAGTGGGAGAGGGGGCAGGAGGG + Exonic
1163632458 19:18424421-18424443 ATGGAGGAGACGGAGCAGGGTGG + Intronic
1164441926 19:28285222-28285244 GTGCAGGGGAAGGAGCTGGAGGG + Intergenic
1164715849 19:30389806-30389828 CTGGAAGATAGGGAGCTGGAGGG - Intronic
1164741053 19:30575885-30575907 ATGTAGAAGAGGGGGAGGGACGG + Intronic
1164901005 19:31923292-31923314 ATAGAGGAGAGGGATTTGGAAGG - Intergenic
1165154037 19:33776922-33776944 AGGGAGGAGGGGGAGCTGGGGGG - Intergenic
1165847384 19:38827033-38827055 AGGGAGGAGAGGGAGAAGGAGGG + Intronic
1165866579 19:38943041-38943063 AAGGAGGAGAGGGAGCCGGGAGG + Intronic
1166040503 19:40199609-40199631 ATGTAGGAGAGGGAGCTGGAAGG + Intronic
1166400197 19:42473072-42473094 AGGTTGGAGAGGAAGGTGGAGGG + Intergenic
1166661130 19:44647844-44647866 ATATTGGAAAGGGAGCTGGGAGG + Intronic
1166889037 19:45978979-45979001 ATGAAGGGGAGGGGGCTAGATGG + Intergenic
1167645409 19:50702841-50702863 AGGCAGGAGAGGGGGCTGGTTGG - Intronic
1167648769 19:50718945-50718967 AAGGAGAAGCGGGAGCTGGAGGG + Intronic
1167663005 19:50807422-50807444 CTGTATGAGAGGGAGATAGATGG + Intergenic
1167837454 19:52085734-52085756 CTGGAGCAGAGGGAGCAGGAAGG + Intronic
925170624 2:1748176-1748198 CAGCAGGAGATGGAGCTGGAGGG - Intergenic
925545461 2:5011229-5011251 AAGGAGGAGAGGGAGGGGGAAGG - Intergenic
926307721 2:11651117-11651139 ATGTAGAAGAGGGAACTGATGGG + Intergenic
926352939 2:12013853-12013875 GTGTGGGAGAGCAAGCTGGAGGG + Intergenic
926696481 2:15772720-15772742 GTGTGGCAGAGAGAGCTGGAGGG - Intergenic
926813367 2:16776057-16776079 CTGGAGGAGAGGGAGCAAGAAGG + Intergenic
927107051 2:19836795-19836817 ATTCAGGTGAGTGAGCTGGAGGG - Intergenic
927926045 2:27014513-27014535 ATCCAGGACAGGGATCTGGACGG - Intronic
928179018 2:29054553-29054575 ATGCAGGAGAGGAAGCGGGCAGG + Exonic
928306334 2:30172966-30172988 ATGTAGCAGAAGGACCTGGAAGG - Intergenic
928395457 2:30940168-30940190 AAGTTGGAGAGGGTGCTGGGAGG - Intronic
928996967 2:37303195-37303217 ATGTGGGAGAGGGGACGGGACGG - Intronic
930155809 2:48106737-48106759 ATGGAGGAGGGGGGGCCGGATGG - Intergenic
930741736 2:54838601-54838623 CTGTAGCAGAGGGAATTGGAAGG + Intronic
931721293 2:65069504-65069526 CTATGGGAGAGGGAGCTGCAGGG + Exonic
931819200 2:65934703-65934725 ATGTAGGAGTGAGAGCTTGCTGG + Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933947573 2:87300035-87300057 GTGTTGAAGAGGTAGCTGGAAGG - Intergenic
934475139 2:94588571-94588593 GTGGAGGACAGGGGGCTGGAGGG - Intronic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
934674844 2:96242254-96242276 ATGGATGAGAGGGAGGTGGGTGG - Intergenic
935140782 2:100351006-100351028 ATGGAGGGGAAGGAGCTGGGTGG + Intergenic
935418137 2:102840215-102840237 ATGAGGGAGTGGGAGGTGGAGGG + Intronic
936043657 2:109169462-109169484 TTGTCGGGGAGGAAGCTGGAGGG + Intronic
936062151 2:109301939-109301961 ATGCAGGAGAGGCTGCGGGAAGG - Intronic
936332623 2:111561542-111561564 GTGTTGAAGAGGTAGCTGGAAGG + Intergenic
936689172 2:114865661-114865683 ATGATGGAGAGGGAACAGGAAGG + Intronic
936702741 2:115033476-115033498 AGGAAGGAGTTGGAGCTGGAGGG - Intronic
936754922 2:115696159-115696181 AAGTAGAAGAGGGAGATGAAGGG + Intronic
937740705 2:125349586-125349608 ATGTTGGGGAGGAAGCTGGTGGG - Intergenic
938314949 2:130318868-130318890 AGCAGGGAGAGGGAGCTGGATGG - Intergenic
939105687 2:137945905-137945927 AAGTAGAAGAGGGATTTGGAAGG - Intergenic
939713422 2:145552839-145552861 ATGTAAGAGATAGAGATGGAAGG - Intergenic
940370356 2:152894529-152894551 ATGCAGCAGTGGGAGCTGGTGGG + Intergenic
941378874 2:164766347-164766369 ATGTTGGAGATGGAGCCAGATGG + Intronic
941647470 2:168056830-168056852 CTGTGTGATAGGGAGCTGGAAGG - Intronic
942166648 2:173247063-173247085 AGGCAGGAGAGGGAGTTGGCTGG - Intronic
942398298 2:175575324-175575346 ATGTGAGAGAGAGAGATGGAAGG - Intergenic
943153063 2:184138460-184138482 AGGTGGGGGAGGGAGCTGGTGGG + Intergenic
943746049 2:191463711-191463733 ATGTAGAAGGGGTAGCTGGATGG - Intergenic
944503586 2:200386827-200386849 GTGTATGAGAGGGGGATGGAGGG - Intronic
944593891 2:201244381-201244403 CTGTAGGAGAGAGAGAAGGAAGG + Intronic
946027198 2:216679080-216679102 CTGCAGGAGAAGGAGCCGGAGGG + Intronic
946185828 2:217979871-217979893 ATCCAGGAGAAGGAGGTGGATGG - Intronic
946378739 2:219330600-219330622 GAGTAGGAGTGGGATCTGGATGG - Intronic
946484005 2:220083446-220083468 ATGCATGAAAGGAAGCTGGAAGG - Intergenic
947270622 2:228330100-228330122 ATATAGGAAAGGGAGCTCAAAGG + Intergenic
947859603 2:233349163-233349185 ACGTGGGTGAGAGAGCTGGAGGG + Intergenic
947871704 2:233442210-233442232 ATGTATGAGGGGGACCTGAAGGG + Intronic
1168836879 20:883522-883544 GTGTAGAAGAGAGGGCTGGATGG - Intronic
1169029894 20:2398826-2398848 ATGTGGTAGAGGGAGGTGGTGGG - Intronic
1170054076 20:12179762-12179784 ATTTGGGAGAGAGAGGTGGAAGG - Intergenic
1172166883 20:32904945-32904967 GTGTAGTAGAAGGAGCTGGCGGG + Intronic
1172192375 20:33069654-33069676 ATGTAGGAGAGGAAGCTCTGGGG - Intronic
1172229831 20:33329152-33329174 GCGCAGGAGAGGGAGCAGGAGGG + Intergenic
1172347346 20:34213157-34213179 ATGGAGGAGAAGGAGCAAGAAGG - Intronic
1173178883 20:40786614-40786636 ATGCAGAAGAGGCAGCAGGATGG - Intergenic
1173192266 20:40885821-40885843 ATATAGGGGAGGGGGTTGGAAGG - Intergenic
1173598214 20:44273777-44273799 ATGTGGGGGAGGTGGCTGGAGGG - Intronic
1173747281 20:45447627-45447649 ATGTTGAAGAAGGACCTGGAAGG - Intergenic
1175118719 20:56702330-56702352 ATGTTGGGGAGGGACCTGGTGGG - Intergenic
1175485003 20:59339476-59339498 ATGGAGGAGAGGGACAAGGAAGG + Intergenic
1175855432 20:62118474-62118496 AGGCAGGAGGGGGAGATGGATGG + Intergenic
1175968579 20:62672503-62672525 TTGTGGGAGATGGAACTGGAGGG + Intronic
1176971385 21:15270087-15270109 ATGTAGGAGGCTGAGGTGGAAGG - Intergenic
1177036930 21:16055824-16055846 AAATAGAAGAGGGAGGTGGAAGG + Intergenic
1177301133 21:19246322-19246344 ATGACGGAGCGGGAGCTGTAGGG - Intergenic
1177866553 21:26519424-26519446 AGCTAGGAGAGGGACCTGAAGGG + Intronic
1177943573 21:27440629-27440651 AGGATGGAGGGGGAGCTGGAAGG - Intergenic
1179286469 21:39981874-39981896 ACATAGGAAAAGGAGCTGGAGGG - Intergenic
1179598197 21:42457620-42457642 ATGTTGGGGAGGGACCTGGTGGG - Intergenic
1179606222 21:42517242-42517264 TTGAAGGAGAGGGAGCAGAAAGG + Intronic
1179831294 21:43998305-43998327 GTGGAGGAGATGGAGCTGCAGGG + Intergenic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180888955 22:19271280-19271302 GTGTTGGAGAGGGACCTGGTGGG + Intronic
1181462763 22:23095099-23095121 ATGGAGGAGAGGGGGTTGGATGG + Intronic
1181895726 22:26105875-26105897 ATGGAGGAGATGCAGCTGTAAGG - Intergenic
1183184189 22:36282453-36282475 GAGCAGGGGAGGGAGCTGGAAGG + Exonic
1183438317 22:37808055-37808077 ATTCTGGAGGGGGAGCTGGAAGG + Exonic
1185273797 22:49941262-49941284 AAGAAGGAGAGGGTGCTGGGAGG + Intergenic
949952155 3:9238224-9238246 ATGGAGGAGATGGAGAAGGAAGG + Intronic
950440416 3:13007126-13007148 GTGCAGGAGAGGAAGCTGGCAGG + Intronic
950789837 3:15462992-15463014 GTGGAAGAGAGGGAGCTGGAAGG + Intronic
950851767 3:16068933-16068955 ATGTATGAGAGGGGACTTGAGGG - Intergenic
950981775 3:17314877-17314899 ATGCAGCAGAGGTATCTGGAGGG + Intronic
953003696 3:38958118-38958140 AGGATGGAGAGTGAGCTGGAGGG - Intergenic
953064354 3:39455725-39455747 ATGCTGGAGATGGAGATGGAGGG + Intergenic
954455688 3:50598567-50598589 ATGGTGAAGTGGGAGCTGGAGGG + Intergenic
955360286 3:58268337-58268359 ACGTAGAAGAGGGAGTGGGAAGG - Intronic
956320120 3:67987179-67987201 AAGTAGGAAAGGGAGATAGATGG - Intergenic
959092328 3:101917148-101917170 ATAGAGGAGAGGGAGCTCCAAGG + Intergenic
959171692 3:102852005-102852027 ATGTTGGAGGGGGATCTGGTTGG + Intergenic
959671922 3:108987995-108988017 ATGTAAGATAGGGAGCTGTCAGG + Intronic
959928049 3:111946826-111946848 AAGTAAGAGAGGGAGATGCAGGG + Intronic
960061165 3:113323091-113323113 ATGTATGGGAGGGATCTGGTTGG - Intronic
960313116 3:116141454-116141476 ATGGAGGAGAGGGAGAAGAAAGG - Intronic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960438016 3:117651189-117651211 GTGTAGGAGAAGGAGTTGGCAGG - Intergenic
961460289 3:127045670-127045692 AAGGAGGAGAGGGAGAGGGAGGG + Intergenic
962607407 3:137044316-137044338 AGAGAGGGGAGGGAGCTGGATGG + Intergenic
963709291 3:148728008-148728030 ATGTGGGAGAGGGAGGTGTGGGG - Intronic
963729132 3:148954497-148954519 AAGTAGGAGAAGGAGATGGGAGG - Intergenic
964247445 3:154669905-154669927 ATGTTGAAGAGGCAGCAGGATGG + Intergenic
965611863 3:170552891-170552913 ATGTAGGAAAAGGATTTGGAAGG - Intronic
966728935 3:183134232-183134254 TTGTATGAGAGGGTGCTGGAGGG + Intronic
966815983 3:183890242-183890264 GTGTATGAGAGTGAGCTGGAGGG - Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967127405 3:186436193-186436215 AAGAGGGAGAGGGAGGTGGAGGG + Intergenic
968051025 3:195655040-195655062 ATGTAGGAGAGAGAGGTGTTTGG - Intergenic
968104801 3:195993298-195993320 ATGTAGGAGAGAGAGGTGTTTGG + Intergenic
968303094 3:197630882-197630904 ATGTAGGAGAGAGAGGTGTTTGG + Intergenic
968432285 4:566088-566110 ACGGAGGAGAGGGAGGTGGAGGG - Intergenic
968746909 4:2365022-2365044 AAGTGGGGGAGGGAGGTGGAGGG + Intronic
977179347 4:93854994-93855016 ATGTAGGGGAGGTAACTAGAGGG + Intergenic
977262402 4:94813522-94813544 AGGTCTGAGAGGGAGATGGAGGG + Intronic
977294768 4:95198331-95198353 TTGTGGGAGAGAGAGATGGAAGG + Intronic
977402371 4:96548404-96548426 ATGTTGGGGAGGGACCTGGTGGG - Intergenic
977613200 4:99058135-99058157 ATGTAGGAGAGGGAAGAGGAGGG + Intronic
978120946 4:105078774-105078796 AAGTAGGAGAGGGAGGTGTACGG + Intergenic
978345227 4:107760410-107760432 ATGTAGGATAGAGTGGTGGATGG - Intergenic
979404893 4:120297623-120297645 ATGGAGGAGTGGGAGTGGGATGG + Intergenic
979517462 4:121626384-121626406 ATGTTGGAGAGGGGGCAGGAAGG + Intergenic
980145146 4:128973460-128973482 AGGGAGGAGAGGGAGAGGGAGGG + Intronic
981055886 4:140360929-140360951 ATGTCGCAGAAGGTGCTGGATGG - Intronic
981451664 4:144905266-144905288 ATGTAGGAGAAAGAACTGTAAGG - Intergenic
982666505 4:158270872-158270894 ATGTTGGAGGGGGACCTGGTAGG + Intergenic
983627416 4:169815635-169815657 ATGTAGGTGATGGACCTGGTAGG + Intergenic
983987950 4:174082707-174082729 ATGTGGGAGATGGGGCTTGATGG - Intergenic
984019496 4:174467866-174467888 AGGTAGGAGAGTGAGGAGGATGG - Intergenic
985045504 4:185936470-185936492 ATTTAGGAGAAGGAGGTGGTGGG + Intronic
985507651 5:293056-293078 ATGTAGGAGAGAGAGGTGTTTGG - Intronic
985900010 5:2780798-2780820 AAGGAGCAGAGGGAGCTGGTGGG - Intergenic
986122794 5:4857610-4857632 ATGTGTCAGAGGGTGCTGGATGG - Intergenic
986122807 5:4857670-4857692 ATGCATCAGAGGGTGCTGGATGG - Intergenic
986122818 5:4857728-4857750 ATGCATCAGAGGGTGCTGGATGG - Intergenic
988836932 5:35042770-35042792 GTGTAAGAGATGGAGGTGGAGGG + Intronic
988926021 5:35991667-35991689 AGGTAATAGAGGCAGCTGGAAGG - Intergenic
988999258 5:36744152-36744174 TTGTGGGAGAGGGAGATGGAAGG - Intergenic
990109047 5:52300779-52300801 TCATAGGAGAGGGAGGTGGAAGG - Intergenic
990532225 5:56685872-56685894 ATGTAAGACTGTGAGCTGGAAGG - Intergenic
990631091 5:57670019-57670041 ATGTCGAGGAGGGAGCTGGTGGG - Intergenic
990659424 5:57996429-57996451 ATGTAGTAGAGGGAACTGTTAGG + Intergenic
992689022 5:79225432-79225454 ATGAAGGAGAGGGAGAGGAAAGG - Intronic
993052308 5:82939858-82939880 AGGTAGAAGAGGGAGATGGAGGG - Intergenic
993242601 5:85410291-85410313 ATGTTGGAGAAGGTGCTGGTAGG - Intergenic
993478996 5:88399635-88399657 ATGTTGGAGAGGGTGTTAGATGG - Intergenic
994262624 5:97678080-97678102 ATGTAGGAATGAGAGGTGGATGG + Intergenic
995799666 5:115980183-115980205 AGGGAGGAGAGGGTGGTGGATGG + Intronic
996125181 5:119717997-119718019 ATGAAGGTCAGGGAGCTGGGAGG - Intergenic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
996911029 5:128656691-128656713 ATGTTGGAGAGGGGTCTGGTGGG - Intronic
997247038 5:132358481-132358503 CTGCAGGAGGGTGAGCTGGAGGG - Intergenic
997250893 5:132387801-132387823 TGGTAGGAGAGGGAACGGGAAGG - Intronic
997280708 5:132642971-132642993 ATGTAGGAGAAGAAGGTGGTGGG - Exonic
997368672 5:133342101-133342123 TGGCAGGAAAGGGAGCTGGAAGG + Intronic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
997834487 5:137181227-137181249 AGGCAGGAGAGGAAGGTGGAGGG + Intronic
998358479 5:141562514-141562536 AGGTAGGGGAGGGAGAAGGATGG + Intronic
998522147 5:142811000-142811022 GTGTGGGAGAGGGAGATGGGAGG - Intronic
998744185 5:145238062-145238084 ATGTAAGAGAGGTTGTTGGAGGG - Intergenic
998827503 5:146118364-146118386 ATGGAAGAGAGGGGACTGGAAGG + Intronic
998873619 5:146576956-146576978 ATGTTGGGGAGGGACCTGGTGGG - Intergenic
1000120636 5:158194662-158194684 ACGTAGCAGAAGGGGCTGGAGGG - Intergenic
1000418505 5:161010187-161010209 AAGTAGGAGAAAGAGCAGGAAGG - Intergenic
1000611908 5:163383769-163383791 AGGGAGGAGAGGGAGAAGGAAGG + Intergenic
1000722642 5:164727576-164727598 ATGTAGGTGAGGGAACTGTTTGG + Intergenic
1001132897 5:169079510-169079532 AAGGAGGAGAGGGAGGAGGAAGG + Intronic
1001249111 5:170132518-170132540 ATGAAGGAGAAGAAGCTGGTAGG + Intergenic
1001650176 5:173310457-173310479 AGTGAGGAGAGGGAGATGGAAGG - Intergenic
1002375763 5:178788193-178788215 ATGAAGGTGTGGGAGATGGAAGG - Intergenic
1002559837 5:180073612-180073634 ATGGAAGAGAGGGAAATGGAGGG - Intergenic
1006014388 6:31068184-31068206 AGGGAGGAGAGGGAGAGGGAGGG + Intergenic
1006029875 6:31170747-31170769 GTGGAGGAGAGGGAGGTGGGGGG + Intronic
1006297868 6:33178039-33178061 AGAGAGGAGAGGGAGCAGGAAGG + Intronic
1007143771 6:39606124-39606146 ATATAGGAGAAGGAGGAGGAGGG - Intronic
1007228004 6:40328291-40328313 ATGTTGGTGAGGGACCTGGAGGG - Intergenic
1007315255 6:40983116-40983138 AAGTCAGAGAGGGAGCTGCAGGG - Intergenic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1008126797 6:47678198-47678220 ATGGAGCAGAGGGTGCTGGGAGG - Intronic
1008750972 6:54733478-54733500 ATGTTGGAGAGGGGCCTGGTGGG - Intergenic
1010179189 6:73065461-73065483 ATGTCAGAGAGGAAGCTGGAAGG - Intronic
1010220386 6:73443594-73443616 ATGTGGGAGATGGAGGTGGGGGG - Intronic
1010577521 6:77550804-77550826 ATCTGGGAGTGGGAGCTAGATGG - Intergenic
1010815463 6:80353052-80353074 AGAGAGGAGAGGGAGTTGGAAGG - Intergenic
1011759599 6:90547518-90547540 TTGTACGAGAGGGAGCTACAGGG + Intronic
1012265691 6:97139207-97139229 ATGTAAAATATGGAGCTGGAAGG - Exonic
1012366930 6:98452678-98452700 TTGTAAGAAAGGGAGCTAGAAGG + Intergenic
1013285720 6:108679722-108679744 AGGTGGGTGAGGGAGATGGAAGG + Intronic
1013824069 6:114190188-114190210 ATGGAGGAGTGGGAGATGGGGGG + Intronic
1013859523 6:114618502-114618524 ATGGAGGACAGGAAGATGGAGGG - Intergenic
1014692056 6:124574121-124574143 ATGTAGTGGAGGCAGCTGCAGGG + Intronic
1015866779 6:137735151-137735173 AAGTAGGGAAGAGAGCTGGAGGG - Intergenic
1016806172 6:148214622-148214644 ATGTTGGAGAGGGATCTGGTGGG - Intergenic
1017081816 6:150676907-150676929 ATGAAGGAGAGGGAGGAGGGAGG - Intronic
1017159115 6:151349002-151349024 ATGAAGGGGAGGGAGCAGCAGGG + Exonic
1017378103 6:153795004-153795026 AAGAAGGAGAAGGAGATGGAAGG + Intergenic
1017456664 6:154606943-154606965 AGGAAGGAGATGGAGCTGGGAGG - Intergenic
1017686245 6:156915972-156915994 ATGTAGGAAAGTGAGCTGGGGGG - Intronic
1018238915 6:161753609-161753631 ATGTAGGAGATGAAGCAGGGAGG + Intronic
1018480297 6:164182949-164182971 ATGAAGCAGAGGGAGAAGGATGG - Intergenic
1019504927 7:1385978-1386000 AGCCAGGAGAGGGAGCTGGGGGG + Intergenic
1019845305 7:3493282-3493304 ATGAAGGGTAGGGAGATGGATGG - Intronic
1022097545 7:27150425-27150447 ATGTAGGTGTGGGACCTTGAAGG + Intronic
1022310386 7:29191422-29191444 ATGTAGGATGGGAAGCAGGAAGG + Intronic
1022488125 7:30795873-30795895 AAGCAGAAGAGGGAGCAGGAAGG - Intronic
1022781478 7:33588893-33588915 TGGTAGGAGAGGAGGCTGGAGGG + Intronic
1022808750 7:33848793-33848815 ATGAAGGAAGGGGAGCAGGAAGG - Intergenic
1022815131 7:33905745-33905767 AGGTAGGGGAGGGGGCGGGAGGG + Exonic
1023337278 7:39183562-39183584 ATGTGGAAGAGGGACCTGGTGGG - Intronic
1023809687 7:43902159-43902181 ATGGTGGAGAGGGAGGAGGAGGG + Intronic
1024656260 7:51453697-51453719 ATGCAGGAGAGAGGGCTGGATGG - Intergenic
1024797785 7:53038304-53038326 ATGTTGGAGATGGACCTGGTGGG - Intergenic
1025561427 7:62377820-62377842 AAGAAGGAGAGAGAGGTGGAGGG + Intergenic
1025849715 7:65236041-65236063 GTGTTGGAGAAGGAGCTTGATGG + Intergenic
1027129867 7:75583145-75583167 GGGGAGGAGAGGGAGCAGGAGGG - Intronic
1028173662 7:87628695-87628717 ATGTAGGAAAGGAGCCTGGAGGG - Exonic
1028727375 7:94102818-94102840 CTGGAGTTGAGGGAGCTGGATGG + Intergenic
1031202975 7:118715304-118715326 ATGTATGAGAGGGAGCATGTTGG - Intergenic
1031914361 7:127548963-127548985 ATGGTGGAGAGTCAGCTGGAAGG - Intergenic
1032177152 7:129640148-129640170 ATGTATTAGAGGGACCAGGATGG + Intronic
1032198140 7:129801072-129801094 GTGTGGGAGACGGAGCTGGGAGG - Intergenic
1032466883 7:132151590-132151612 AAGGAGGAGAGGGAGAGGGAGGG + Intronic
1032651414 7:133882786-133882808 TGGTAGGAGATGGGGCTGGAAGG + Intronic
1032839282 7:135701643-135701665 ATGTAGGAAACAGAGCTAGAAGG + Intronic
1033444075 7:141405016-141405038 ATGTAGGAGAGAGAGAGGGTAGG - Intronic
1033555327 7:142483991-142484013 ACGGTGGAGAGGTAGCTGGAGGG + Intergenic
1033581982 7:142746325-142746347 ATGTAGGAGAAAGATCTGGTGGG + Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034331056 7:150282507-150282529 ATGTAGGATTGAGAGGTGGAAGG - Intronic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1035336759 7:158134289-158134311 GTGTGTGAGAGGGAGCGGGAGGG - Intronic
1035377171 7:158413129-158413151 ATGTTGAGGAGGGCGCTGGATGG - Intronic
1035387082 7:158480395-158480417 CTGGAGGAGAGGGAGCGAGATGG - Intronic
1035401776 7:158570416-158570438 TGGTGGGAGAGGGTGCTGGAGGG - Intronic
1035672846 8:1433262-1433284 ATGTAGAGCAGAGAGCTGGATGG - Intergenic
1035674338 8:1444599-1444621 ATGATGGAGAAGGAGGTGGAGGG - Intergenic
1036206645 8:6810424-6810446 AAGCAGCAGTGGGAGCTGGAAGG + Exonic
1036409843 8:8489256-8489278 GTGTTGGAAAAGGAGCTGGAGGG - Intergenic
1037121863 8:15298317-15298339 ATGTTGGAGGTGGAGCTGGCGGG - Intergenic
1037751197 8:21683460-21683482 ATGCAGGAGGGGGAGTTTGAGGG + Intergenic
1037764444 8:21763670-21763692 ATTCCAGAGAGGGAGCTGGAAGG - Intronic
1037893206 8:22635043-22635065 ATGCAGGAGAGGCAGCAGGAGGG - Intronic
1038389327 8:27180427-27180449 ATGATGAAGAGGGAGCTTGAGGG - Intergenic
1038675684 8:29620778-29620800 AAATAGGAAAGGGAGGTGGAAGG + Intergenic
1039077659 8:33707175-33707197 AGGAAGGAGAGGGAGCCAGATGG - Intergenic
1039546561 8:38414932-38414954 GGGGAGGTGAGGGAGCTGGAAGG + Intronic
1039749017 8:40459471-40459493 ATTTAGGATAGGAATCTGGATGG + Intergenic
1041830887 8:62151953-62151975 GGGTAGGAGAGGGTGCAGGAGGG - Intergenic
1041953638 8:63533208-63533230 AGGTAGGAGAGAGAGAGGGAAGG - Intergenic
1042483561 8:69328752-69328774 ATGTAGGAGAGAGAGGTGTTTGG - Intergenic
1044252009 8:90013966-90013988 ATGTAGGAGAGGGATGAGTATGG + Intronic
1044755180 8:95454162-95454184 ATGTAGGAGTTGGGGGTGGAAGG - Intergenic
1045233564 8:100329096-100329118 ATATAGGAGAGGGAGAGGGGTGG + Intronic
1045677057 8:104618797-104618819 AGGGAGGAGAGGGATCTGGCAGG + Intronic
1045869136 8:106905526-106905548 ATATAGGAGAGGGATCAAGATGG - Intergenic
1046906933 8:119583379-119583401 ATGCAAGAGATGGAGGTGGAGGG + Intronic
1047056816 8:121174223-121174245 TTGGAGGAGAGGAAGCTGGCCGG + Intergenic
1047216916 8:122883325-122883347 ATGGAGGAGATGGAGGTGGGCGG + Intronic
1047332484 8:123904393-123904415 ATTTAGGAGTGGGGGCTGGCGGG - Intronic
1047749078 8:127866489-127866511 CTGAAGGAGAGGGAGTGGGAGGG - Intergenic
1048519494 8:135140480-135140502 AGGAAGGAAAGTGAGCTGGAGGG - Intergenic
1048845730 8:138602401-138602423 AGGTAGGGGAGGAATCTGGAGGG - Intronic
1049383986 8:142331668-142331690 TTGGAGGCGAGGGTGCTGGATGG - Intronic
1049405857 8:142451573-142451595 GTGTTGGGGAGGGAGCTGGGAGG + Intronic
1049765017 8:144351144-144351166 ACGGAGGAAAGGGAGCTGGAGGG - Intergenic
1050481357 9:6090466-6090488 ATGCAAGAGAGAGAGCTGGGAGG - Intergenic
1050715628 9:8521911-8521933 ATGCAGAAAAGGGGGCTGGAAGG + Intronic
1051326444 9:15975943-15975965 TTGTAAGAGAGGGAGGTGCAGGG + Intronic
1051912497 9:22170418-22170440 GTTTAGGAGAGGCTGCTGGATGG + Intergenic
1052854911 9:33401191-33401213 GTGAAGGACAGGGGGCTGGAGGG + Intronic
1053380067 9:37641669-37641691 GTGTAGGATAGGGAGAGGGAGGG - Intronic
1053682933 9:40497520-40497542 GTGGAGGACAGGGGGCTGGAGGG + Intergenic
1053932914 9:43125834-43125856 GTGGAGGACAGGGGGCTGGAGGG + Intergenic
1054280781 9:63127408-63127430 GTGGAGGACAGGGGGCTGGAGGG - Intergenic
1054296033 9:63333020-63333042 GTGGAGGACAGGGGGCTGGAGGG + Intergenic
1054394049 9:64637515-64637537 GTGGAGGACAGGGGGCTGGAGGG + Intergenic
1054501681 9:65878815-65878837 GTGGAGGACAGGGGGCTGGAGGG - Intronic
1055027145 9:71734353-71734375 ATGGAGGGGAGGCAGCGGGAGGG + Intronic
1055235963 9:74123605-74123627 AGCTGGGGGAGGGAGCTGGAAGG + Intergenic
1055555655 9:77470958-77470980 ATGTTGGGGAGGGACCTGGTGGG - Intronic
1055637308 9:78291729-78291751 CTTGAGGGGAGGGAGCTGGAGGG - Intergenic
1055931000 9:81559840-81559862 AGGGAGGAGAGGGATCTGGAGGG - Intergenic
1056210790 9:84363290-84363312 ATGTAGGAGAGGAACCAAGAGGG + Intergenic
1056421254 9:86428762-86428784 ATGTAGTAGGGTGAGGTGGAAGG - Intergenic
1056423397 9:86452496-86452518 ATGCAGCAGTGGGAGCTGGGTGG - Intergenic
1056470738 9:86902853-86902875 GTGGAGGTGAGGGTGCTGGAGGG - Intergenic
1057067941 9:92072880-92072902 AAGAAGGAGAGGTAGATGGAAGG - Intronic
1057630662 9:96716507-96716529 AAGTGGGAGAGGGAGGGGGACGG + Intergenic
1057815466 9:98290710-98290732 GTGGAGGATGGGGAGCTGGAGGG + Exonic
1060399403 9:123339489-123339511 GTGTAGGAGGCGGAGCCGGATGG + Intergenic
1060469036 9:123931880-123931902 GTGTTGGAGAGGGAGGTAGAAGG + Intergenic
1061114894 9:128603831-128603853 CAGTAGGGCAGGGAGCTGGAAGG + Intronic
1061385596 9:130287600-130287622 AAGTAGCACAGGGAGCTGGGAGG - Intronic
1061900040 9:133668319-133668341 ATGAGGGAGAGGGAGAGGGAGGG - Intronic
1061931381 9:133834767-133834789 ACGCAGGAGAGGAAGCAGGAGGG + Intronic
1061967579 9:134025050-134025072 ATGGAGGAGGAGGGGCTGGATGG - Intergenic
1062059786 9:134489003-134489025 ATGCAGGAGGGGCAGCTGGTAGG - Intergenic
1062437205 9:136551563-136551585 AGGAAGGAGAGGGAGGGGGAGGG - Intergenic
1185852194 X:3499585-3499607 ATGTTGGGGAGGGACCTGGTGGG + Intergenic
1187128877 X:16481689-16481711 ATGAAGGAGAGAGAGAGGGAGGG - Intergenic
1187544697 X:20237188-20237210 ATATAGGAGAGGGAGCAGATTGG - Intronic
1189605306 X:42671702-42671724 AAGTAGGATAGGGAGATAGAGGG + Intergenic
1190129114 X:47730579-47730601 AGGGAGGAGAGAGAGCCGGAAGG - Intergenic
1190745584 X:53320362-53320384 AAGTTGGAGAGGGATCTAGAGGG + Intronic
1191101440 X:56733556-56733578 AAGGAGGGGAGGGAGCTGGTGGG + Intergenic
1191666213 X:63705532-63705554 ATTTAGGACAGAGAGATGGAAGG + Intronic
1191688316 X:63914888-63914910 ATGTTGGGGAGGGACCTGGTGGG + Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1192232744 X:69277327-69277349 ATGAAGGTGAGGGAGGTAGATGG + Intergenic
1192254798 X:69447396-69447418 GTATGGGAGAGGGAGCAGGAAGG - Intergenic
1192338312 X:70240062-70240084 AGGTAGGAGAGGGAGGTTAAAGG + Intronic
1192359894 X:70432817-70432839 ATGTAGGAAAGGCAGTTGGGGGG + Intronic
1195976732 X:110535204-110535226 AAGTAGGAGAGAGAGCTGAGGGG - Intergenic
1196124221 X:112082344-112082366 GTGAAGGAGAGGGAGAAGGAGGG + Exonic
1196733640 X:118965479-118965501 AAGGGGGAGTGGGAGCTGGAAGG - Intergenic
1197681181 X:129386974-129386996 AGGTAGGAGAGAGGCCTGGAAGG + Intergenic
1197971627 X:132120617-132120639 AGGTAGGAGTGGGAGTGGGAAGG + Intronic
1198213175 X:134533790-134533812 AGGTAGAAGAGGAAGATGGAAGG + Intergenic
1198367088 X:135951695-135951717 CTTTAGGAGAGGGTGATGGAGGG + Intergenic
1198661708 X:138975921-138975943 ATATAGGAAATGGAGCTTGAGGG + Intronic
1198957730 X:142150207-142150229 ATATTGGAGAGGGAGTTTGAGGG - Intergenic
1199535269 X:148895595-148895617 GTGTAAGAGAGGGAGGGGGAGGG + Intronic
1200185088 X:154177120-154177142 AGCTAGGAGAGGGAGGTGGGGGG + Intergenic
1200190741 X:154214258-154214280 AGCTAGGAGAGGGAGGTGGGGGG + Intergenic
1200196492 X:154252060-154252082 AGCTAGGAGAGGGAGGTGGGGGG + Intergenic
1200202147 X:154289178-154289200 AGCTAGGAGAGGGAGGTGGGGGG + Intronic
1202575534 Y:26320641-26320663 ATGGGGCAGAGGGAGCAGGAGGG - Intergenic