ID: 1166043250

View in Genome Browser
Species Human (GRCh38)
Location 19:40215405-40215427
Sequence TATTGGGGAAGGAGGGAGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2266
Summary {0: 1, 1: 0, 2: 22, 3: 234, 4: 2009}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166043233_1166043250 24 Left 1166043233 19:40215358-40215380 CCATGCCACAAGGTGGGGGAGGC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG 0: 1
1: 0
2: 22
3: 234
4: 2009
1166043238_1166043250 2 Left 1166043238 19:40215380-40215402 CCCTGGGCAGGATGTTCACTCTA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG 0: 1
1: 0
2: 22
3: 234
4: 2009
1166043234_1166043250 19 Left 1166043234 19:40215363-40215385 CCACAAGGTGGGGGAGGCCCTGG 0: 1
1: 0
2: 4
3: 55
4: 406
Right 1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG 0: 1
1: 0
2: 22
3: 234
4: 2009
1166043229_1166043250 28 Left 1166043229 19:40215354-40215376 CCCGCCATGCCACAAGGTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 156
Right 1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG 0: 1
1: 0
2: 22
3: 234
4: 2009
1166043231_1166043250 27 Left 1166043231 19:40215355-40215377 CCGCCATGCCACAAGGTGGGGGA 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG 0: 1
1: 0
2: 22
3: 234
4: 2009
1166043239_1166043250 1 Left 1166043239 19:40215381-40215403 CCTGGGCAGGATGTTCACTCTAT 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG 0: 1
1: 0
2: 22
3: 234
4: 2009

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166043250 Original CRISPR TATTGGGGAAGGAGGGAGGG GGG Exonic
Too many off-targets to display for this crispr