ID: 1166043568

View in Genome Browser
Species Human (GRCh38)
Location 19:40217057-40217079
Sequence CTACCTAGAAGCAGCTCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166043568 Original CRISPR CTACCTAGAAGCAGCTCCGC GGG Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
900759256 1:4460160-4460182 CTACCTTGCAGCAGCTCCTGTGG - Intergenic
901328480 1:8385002-8385024 CCATCTAAAAGCAGCTCTGCAGG + Intronic
903523877 1:23977549-23977571 CTACTTAGAAACAGCTCTGGTGG - Intronic
913329216 1:117653389-117653411 CTGCCTAGATGCCGCTCAGCTGG - Intergenic
916746467 1:167688535-167688557 CTACCAAGATGCAGCTGGGCGGG - Intronic
917741291 1:177964199-177964221 CTCCCTGGAAACAGCTCCCCCGG + Exonic
1065693024 10:28354581-28354603 ATACCAAGAAGGAGCTCAGCAGG - Intergenic
1068544315 10:58328754-58328776 CTACCTAGAAGTAGAACTGCTGG + Intergenic
1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG + Intergenic
1075794457 10:125109240-125109262 CTGCCTGGGAGCATCTCCGCTGG - Intronic
1078463447 11:11532699-11532721 CAGCCTTGAAGCAGCTCAGCGGG - Intronic
1084025616 11:66447030-66447052 CTACCAGGAAGCAACTCCCCAGG + Intronic
1089081943 11:115783633-115783655 CTACATAGAAGCAAATCAGCAGG - Intergenic
1091973740 12:4809445-4809467 CTCCCTAGGAGCCGCGCCGCAGG - Exonic
1097523277 12:60696407-60696429 CTACCTCAAAGCAAATCCGCTGG + Intergenic
1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG + Intronic
1118780434 14:69004311-69004333 TTCCCTGGAAGCAGCTCCGAGGG - Intergenic
1119389833 14:74283665-74283687 CTAGCTAGAAGCAGCTCAGAGGG - Intergenic
1119773969 14:77237240-77237262 CTAAGTAGCAGCAGCTCAGCAGG - Intronic
1133525559 16:6602013-6602035 GTACCTAGAAGCAGCTTGGTAGG + Intronic
1139746422 16:69078251-69078273 CTACATAGAACAAGCTCCCCAGG - Intronic
1145815720 17:27793702-27793724 CTCCTTAGGCGCAGCTCCGCTGG + Intronic
1145899570 17:28481505-28481527 CTAACTAGAAGCAGCACCCCAGG + Intronic
1146475936 17:33162807-33162829 CTTCCTGGTAGCAGCTCCCCTGG + Intronic
1146660454 17:34662169-34662191 CTACCTAGAAGCAGCAGTGCTGG - Intergenic
1148742199 17:49899150-49899172 CTACCTTGAAGCCGCTTCTCGGG - Intergenic
1148745520 17:49915946-49915968 CTCCCTCGAAGCCCCTCCGCTGG - Intergenic
1149544601 17:57494039-57494061 CTACATAGCAGAAGCTCCACTGG + Intronic
1157846285 18:51006909-51006931 CTATCTGGAAGCACCTCAGCTGG - Intronic
1165892123 19:39119525-39119547 CCACCTGGAAGCAACTCTGCTGG - Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166596931 19:44058556-44058578 CAACCCAGAAGCAGGTCCACTGG - Intronic
1166794671 19:45419355-45419377 CTTCCAAGAAGATGCTCCGCAGG + Intronic
932143436 2:69298876-69298898 TTAATTAGAAGCAGCTCCGTAGG - Intergenic
948804568 2:240447902-240447924 CAACCAGGAAGCAGCTGCGCCGG - Intronic
1170991025 20:21302066-21302088 TTACCTGGAAGCAGCCCCTCTGG - Intergenic
1171045378 20:21805524-21805546 GTACCTAGAAGCAGATTCCCTGG + Intergenic
1171794237 20:29554079-29554101 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1173111669 20:40196757-40196779 CTAGTTGGAAGCAGCTCAGCAGG + Intergenic
1173197965 20:40931580-40931602 CAACCTAGAAGCAGCTGCACAGG + Intergenic
1173873423 20:46355551-46355573 CTTCCTAGACCCAGCTCTGCTGG + Intronic
1175927258 20:62476783-62476805 CTGCCGCGGAGCAGCTCCGCAGG + Intergenic
953109737 3:39922352-39922374 CTACCTAGAAAAAGCTAAGCAGG + Intronic
953473246 3:43184474-43184496 CTCCCTAGAAGGAGCTCTTCGGG - Intergenic
955392802 3:58533602-58533624 CCACCTAGAAGCAGCTTCACAGG - Intronic
957870546 3:86085682-86085704 CTACCTTGAAGCTGCTATGCTGG + Intergenic
968470445 4:779617-779639 CTACCTAAAAGGAGGTCCCCAGG + Intergenic
980406021 4:132354853-132354875 CTAGGTAGAGGCAGCTCCGATGG + Intergenic
982355232 4:154459614-154459636 CTAACTAGAAGCCACTTCGCAGG - Intronic
983204966 4:164902359-164902381 GTTCCTAGAGGCAGCTCAGCAGG + Intergenic
990115609 5:52386946-52386968 AAACCCAGAAGCAGCTCTGCTGG + Intergenic
992581414 5:78182183-78182205 AAACCTAGAATCAGCTCCTCTGG - Intronic
993715813 5:91274831-91274853 CTACCTTGAAGCTGCCCCTCTGG + Intergenic
995635920 5:114190219-114190241 CTACCTAGAAGCAGAATGGCTGG - Intergenic
997402110 5:133611659-133611681 CTACGCACAAGCAGCGCCGCAGG + Intronic
1003030730 6:2598238-2598260 CCACGTAGAAACAGCTCCGGGGG + Intergenic
1006642015 6:35494527-35494549 CTACCCAGAGGCAGATCCTCAGG + Intronic
1008546792 6:52590267-52590289 CTACCTAGAAACAGCAGAGCTGG - Intergenic
1017971368 6:159315276-159315298 CTGCCTGGAAGGAGCTCCCCAGG + Intergenic
1018599748 6:165526467-165526489 CTAGCTAGAAGCAGCTCTAATGG - Intronic
1018708055 6:166477097-166477119 CTACCTGGCTCCAGCTCCGCAGG + Intronic
1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG + Intronic
1023803329 7:43853617-43853639 CTACCTAGAAGGAATTCTGCCGG + Intergenic
1036395861 8:8370824-8370846 CTACTGAGAAGCAGCTCAGGAGG + Intronic
1039053393 8:33514690-33514712 CTAAATGGAAGCAGCTCCTCGGG - Intergenic
1044134215 8:88564243-88564265 ATACCTAGAAGCAGAACTGCTGG - Intergenic
1046299011 8:112260982-112261004 GTACCTAGAAGGAGCTCCTTTGG + Intronic
1049357854 8:142197558-142197580 CTCCCTATAAGCAGCTGCCCTGG - Intergenic
1052395467 9:27933115-27933137 CTACCAAGGAGCAGCTCTGCTGG - Intergenic
1053792046 9:41693593-41693615 CTACCTTCAAGAAGCTCAGCAGG - Intergenic
1054153110 9:61621172-61621194 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1054180451 9:61905613-61905635 CTACCTTCAAGAAGCTCAGCAGG - Intergenic
1054472904 9:65552376-65552398 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1054657140 9:67675529-67675551 CTACCTTCAAGAAGCTCAGCAGG + Intergenic
1188244603 X:27824589-27824611 CCAGCTAGATGCAGCTCAGCTGG - Intergenic
1196893282 X:120310354-120310376 CTACCAAAAAGCAGCTTCGAGGG + Intronic
1199664668 X:150087262-150087284 CTACCTAGAAACAGACCCACAGG + Intergenic