ID: 1166043614

View in Genome Browser
Species Human (GRCh38)
Location 19:40217226-40217248
Sequence GCGCGCGTGCGTAGTCGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 40}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166043611_1166043614 6 Left 1166043611 19:40217197-40217219 CCGGCTGCGGGCCTCCTGCAGGT 0: 1
1: 0
2: 1
3: 24
4: 245
Right 1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG 0: 1
1: 0
2: 1
3: 1
4: 40
1166043608_1166043614 17 Left 1166043608 19:40217186-40217208 CCTGTGGGTTCCCGGCTGCGGGC 0: 1
1: 0
2: 2
3: 16
4: 115
Right 1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG 0: 1
1: 0
2: 1
3: 1
4: 40
1166043609_1166043614 7 Left 1166043609 19:40217196-40217218 CCCGGCTGCGGGCCTCCTGCAGG 0: 1
1: 0
2: 6
3: 45
4: 389
Right 1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG 0: 1
1: 0
2: 1
3: 1
4: 40
1166043603_1166043614 27 Left 1166043603 19:40217176-40217198 CCGCCACTCACCTGTGGGTTCCC 0: 1
1: 0
2: 4
3: 16
4: 235
Right 1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG 0: 1
1: 0
2: 1
3: 1
4: 40
1166043601_1166043614 29 Left 1166043601 19:40217174-40217196 CCCCGCCACTCACCTGTGGGTTC 0: 1
1: 1
2: 1
3: 13
4: 196
Right 1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG 0: 1
1: 0
2: 1
3: 1
4: 40
1166043602_1166043614 28 Left 1166043602 19:40217175-40217197 CCCGCCACTCACCTGTGGGTTCC 0: 1
1: 0
2: 1
3: 30
4: 238
Right 1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG 0: 1
1: 0
2: 1
3: 1
4: 40
1166043605_1166043614 24 Left 1166043605 19:40217179-40217201 CCACTCACCTGTGGGTTCCCGGC 0: 1
1: 0
2: 2
3: 12
4: 169
Right 1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG 0: 1
1: 0
2: 1
3: 1
4: 40
1166043613_1166043614 -8 Left 1166043613 19:40217211-40217233 CCTGCAGGTAGCGCAGCGCGCGT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG 0: 1
1: 0
2: 1
3: 1
4: 40
1166043612_1166043614 -5 Left 1166043612 19:40217208-40217230 CCTCCTGCAGGTAGCGCAGCGCG 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG 0: 1
1: 0
2: 1
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166043614 Original CRISPR GCGCGCGTGCGTAGTCGCCC AGG Exonic
901095594 1:6676652-6676674 GCGCGCGTGCTCTGTCGCCCAGG - Intronic
905371149 1:37483305-37483327 GCGCGGGTGGGTAGTCGGCAGGG - Exonic
910892195 1:92029925-92029947 GCGCGTGTGCGGAGCCGCCGCGG + Intergenic
915348399 1:155209412-155209434 GCGCCCGTGCTGAGTAGCCCTGG - Intronic
915572386 1:156751576-156751598 GCGCGCGGGCGGAGACGCCGTGG - Intronic
920616371 1:207496400-207496422 GCGGGCGTGGGGAGGCGCCCGGG + Intronic
922831531 1:228556784-228556806 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832009 1:228608738-228608760 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832570 1:228610979-228611001 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833130 1:228613220-228613242 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833691 1:228615461-228615483 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834250 1:228617702-228617724 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835359 1:228622158-228622180 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835918 1:228624378-228624400 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922836477 1:228626620-228626642 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837035 1:228628859-228628881 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837594 1:228631101-228631123 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838153 1:228633342-228633364 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838712 1:228635581-228635603 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839270 1:228637807-228637829 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922840392 1:228642279-228642301 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
1070257738 10:74825893-74825915 GGGCGGGCGAGTAGTCGCCCGGG + Intronic
1077141721 11:1027739-1027761 AGGCGTGTACGTAGTCGCCCAGG + Exonic
1104049617 12:125186699-125186721 GCGCCCGGGCGTAGCCGCCGGGG + Intergenic
1110706261 13:78603706-78603728 GCGCGCGCGCGCAGACGCACGGG - Intergenic
1139890642 16:70251474-70251496 GCGCGCGCGGGTAGCGGCCCAGG + Exonic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1144787472 17:17840106-17840128 GCGCGCGTGCGGAGCCGCCCCGG - Intergenic
1162202021 19:9027392-9027414 GCGCCCGTGCGTTCTAGCCCGGG - Intergenic
1165696730 19:37906694-37906716 GCGCGCGCGCGTTCTCGCGCCGG - Intergenic
1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG + Exonic
1166100856 19:40570618-40570640 GCGCGGGGGCGGAGCCGCCCTGG - Exonic
1175859625 20:62143382-62143404 GGGCGCGGGCGTAGTGGCGCCGG - Exonic
953614459 3:44477675-44477697 GCGCACGCGCGTCGGCGCCCGGG + Intergenic
1019143779 6:169963889-169963911 GCGCGCGTGCGTGCTCCTCCAGG + Intergenic
1026360396 7:69597918-69597940 GCGCGCGCGCGAAGTGGCCTGGG + Intergenic
1026665471 7:72336904-72336926 GCGCGCGTGGGGAGCGGCCCGGG - Intronic
1029123237 7:98281852-98281874 GGCCGCACGCGTAGTCGCCCTGG - Exonic
1043502980 8:80874402-80874424 GCGCGCGGGCGCAGCCGGCCGGG - Intronic
1061170029 9:128947331-128947353 TAGGGCGTCCGTAGTCGCCCCGG - Exonic
1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG + Intergenic
1062499625 9:136846787-136846809 GCTCGCGCGCGTAGCTGCCCAGG - Exonic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic