ID: 1166043894

View in Genome Browser
Species Human (GRCh38)
Location 19:40218289-40218311
Sequence CGAGCCCGGTGGGGAGAGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 410}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166043876_1166043894 18 Left 1166043876 19:40218248-40218270 CCGGGACGAGCCGAGCCATGGCG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1166043894 19:40218289-40218311 CGAGCCCGGTGGGGAGAGGGCGG 0: 1
1: 0
2: 5
3: 37
4: 410
1166043879_1166043894 8 Left 1166043879 19:40218258-40218280 CCGAGCCATGGCGGGAGCCCGAG 0: 1
1: 0
2: 2
3: 5
4: 150
Right 1166043894 19:40218289-40218311 CGAGCCCGGTGGGGAGAGGGCGG 0: 1
1: 0
2: 5
3: 37
4: 410
1166043883_1166043894 -9 Left 1166043883 19:40218275-40218297 CCCGAGCCTGGGCCCGAGCCCGG 0: 1
1: 0
2: 15
3: 74
4: 577
Right 1166043894 19:40218289-40218311 CGAGCCCGGTGGGGAGAGGGCGG 0: 1
1: 0
2: 5
3: 37
4: 410
1166043880_1166043894 3 Left 1166043880 19:40218263-40218285 CCATGGCGGGAGCCCGAGCCTGG 0: 1
1: 0
2: 5
3: 21
4: 201
Right 1166043894 19:40218289-40218311 CGAGCCCGGTGGGGAGAGGGCGG 0: 1
1: 0
2: 5
3: 37
4: 410
1166043885_1166043894 -10 Left 1166043885 19:40218276-40218298 CCGAGCCTGGGCCCGAGCCCGGT 0: 1
1: 0
2: 1
3: 37
4: 235
Right 1166043894 19:40218289-40218311 CGAGCCCGGTGGGGAGAGGGCGG 0: 1
1: 0
2: 5
3: 37
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166043894 Original CRISPR CGAGCCCGGTGGGGAGAGGG CGG Exonic
900180383 1:1308540-1308562 CGGGGCCGGGGGGGAGGGGGGGG + Intronic
900244364 1:1630671-1630693 CGAGCCTGGGGGCGAGGGGGGGG + Intergenic
900477602 1:2883295-2883317 GGAGCCGGGTGGGGGGAGGAGGG - Intergenic
900624796 1:3603251-3603273 CGAGCCCGGTGGGGTCTGGATGG - Intronic
901054095 1:6440598-6440620 CGGGACGGGCGGGGAGAGGGGGG - Intronic
901658834 1:10786219-10786241 GGAGCTCGGTGGGGTGAGGTGGG - Intronic
902569302 1:17336635-17336657 GGAGCCAGGTGGGGAGAGGGAGG + Intronic
902620826 1:17649900-17649922 CGAGGCAGGAGGAGAGAGGGCGG + Intronic
904116180 1:28163703-28163725 CTGGGCCAGTGGGGAGAGGGAGG - Intronic
904369179 1:30037715-30037737 GGAGCCAGGTGGGAAGAAGGGGG + Intergenic
904473704 1:30751254-30751276 GGAGGCCGGTGGGGGCAGGGTGG - Intronic
905416578 1:37808299-37808321 GGAGACCGGTGGGGACGGGGCGG + Exonic
906318340 1:44802102-44802124 CGAGACCGGTGGAGAGGGGGAGG + Intronic
906344918 1:45009092-45009114 AGAGCCCGGCGTGGAGATGGGGG - Intronic
908833785 1:68208448-68208470 TGAGCTCGGCAGGGAGAGGGGGG + Intronic
909746495 1:79104488-79104510 CCAGCCCGGGTGAGAGAGGGAGG - Intergenic
910055567 1:83029525-83029547 GGGGCCTGGTGGGGAGCGGGGGG + Intergenic
913611371 1:120512689-120512711 TGAGCCTGGTGGGGAGAAGGGGG + Intergenic
913983420 1:143544133-143544155 TGAGCCTGGTGGGGAGAAGGGGG - Intergenic
914579821 1:149009550-149009572 TGAGCCTGGTGGGGAGAAGGGGG - Exonic
914790884 1:150876528-150876550 CAACCCCGGTGAGGAGACGGAGG - Exonic
915156005 1:153876921-153876943 CGAACCTGGTGAGGGGAGGGCGG + Intronic
915333506 1:155127798-155127820 CGCGCCGGGCGGGGCGAGGGCGG + Exonic
915601201 1:156924224-156924246 CGAGGCCGGTGGGGAGGTGGGGG + Intronic
915835267 1:159171427-159171449 CGAGCTCCCGGGGGAGAGGGTGG + Intergenic
915837396 1:159188504-159188526 AGAGCCAGCTGGGGAGAGGCAGG - Intronic
916078756 1:161218790-161218812 GAAGGCCGGTGGGGGGAGGGGGG + Intronic
917514606 1:175697211-175697233 AGAGCAAGGTGGGGAGGGGGTGG + Intronic
917553376 1:176058169-176058191 CCCGCCCGGTAGGGAGGGGGGGG + Intronic
918423378 1:184386329-184386351 TGAGAAGGGTGGGGAGAGGGGGG + Intergenic
920179153 1:204121989-204122011 CCAGGCCAGTGGGTAGAGGGCGG - Intronic
921008446 1:211116689-211116711 CCAGCCTGGTGGGGAAAGAGAGG + Intronic
921671533 1:217929682-217929704 AGGCCCCGGTGGGGAGAGCGGGG + Intergenic
922934337 1:229411774-229411796 CGTGCCTAGTGGGGAGACGGGGG - Intergenic
923069504 1:230549648-230549670 CCAGCCCTGTGGGGAAAGTGTGG - Intergenic
924264519 1:242267903-242267925 AGAGGCAGGAGGGGAGAGGGAGG + Intronic
924644916 1:245868845-245868867 CCAGCCTGGTGTGGAGAGAGGGG - Intronic
1063101201 10:2951390-2951412 GGAGGCCGGTGGGAAGAGGAGGG - Intergenic
1063115278 10:3067960-3067982 CTTGCCCGGTGGGGCGGGGGAGG + Intronic
1064052359 10:12069297-12069319 CGCGGCCGGTGGGGAGGAGGGGG + Intronic
1064145832 10:12825735-12825757 CGAGCCTGGGGTGGAGAGGAGGG + Intronic
1064418444 10:15169442-15169464 CAAGCCTGGTTGGGACAGGGCGG - Intergenic
1065186525 10:23174607-23174629 CGAGGCCGGCGGGGCGGGGGCGG - Intergenic
1067174020 10:43929990-43930012 GGAGCCCGGTGGGGAGAGTGTGG + Intergenic
1067368673 10:45661424-45661446 AGAGCCTGGTGGGGAGAGTGGGG - Intronic
1067449864 10:46375670-46375692 AGAGCCCGGGGGCGAGGGGGCGG + Exonic
1067634441 10:47991860-47991882 AGAGCCCGGGGGCGAGGGGGCGG - Intergenic
1068674945 10:59761160-59761182 CCAGCCTGGTGGGGAGAATGGGG - Intergenic
1069722718 10:70559979-70560001 CCAGGGCGGTGGGGAGAAGGGGG + Intronic
1071774153 10:88765962-88765984 CAAGCCAGATGGGGAAAGGGAGG + Intronic
1072804282 10:98414930-98414952 AGAGCTTGGTGGGGAGGGGGAGG - Intronic
1073471148 10:103723155-103723177 TGGGCCAGGTGGGGAGAGGCAGG - Intronic
1076416691 10:130295866-130295888 CGAAAGCGGTGGGGGGAGGGGGG + Intergenic
1076548374 10:131260981-131261003 CGGGCCCTGCAGGGAGAGGGTGG + Intronic
1076608395 10:131704164-131704186 CCATCCCGGTGGGGACAGAGTGG - Intergenic
1076868540 10:133181451-133181473 CGAGCCGTGAGGGGACAGGGAGG + Intronic
1077096890 11:802796-802818 CGAGCCGGGTGAGGAGTGGAAGG + Exonic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077101249 11:823593-823615 CGGACCCGGGCGGGAGAGGGCGG + Intronic
1077264590 11:1642454-1642476 CGGTCCCGGTGGGGAGCGAGAGG - Intergenic
1077360378 11:2138086-2138108 TGAGCCCGGGGGGGAGGAGGAGG - Intronic
1077364434 11:2155863-2155885 CCAGCGCCGTGAGGAGAGGGAGG - Intronic
1077544180 11:3161957-3161979 TGAGCAAGGAGGGGAGAGGGAGG + Intronic
1079302270 11:19288460-19288482 AGAGCCAGATGGGGAGTGGGAGG + Intergenic
1080388888 11:31826267-31826289 GTGGCCCGGTGGGGTGAGGGAGG + Intronic
1080637892 11:34139497-34139519 TGAGCCGGGTGGGGACAGGGAGG + Intronic
1081700209 11:45147723-45147745 AGAGCCCAGTTGGGAGATGGGGG + Intronic
1084063228 11:66689053-66689075 CAGGCCCTGTGGGGAGTGGGGGG - Intronic
1084207912 11:67606736-67606758 CCAGCCCGGTGGAGGGAGGAAGG + Intergenic
1084311529 11:68319042-68319064 CAGGCACGGTGGGGTGAGGGAGG - Intronic
1084420676 11:69059079-69059101 CGGGCCAGGTGGGGAGCTGGCGG - Intronic
1084489158 11:69468958-69468980 GGAGCCCGGTGGGGAAGGGAAGG + Intergenic
1084775550 11:71372364-71372386 GGAGCCTGGTGGGGAGAGCCAGG + Intergenic
1085479442 11:76809207-76809229 CGGGCTCTGTGGGGATAGGGAGG - Intergenic
1085784761 11:79439921-79439943 GGCGCCCGGTGAGGAGAGGCGGG + Intronic
1088738611 11:112748811-112748833 CCAGGCAGGTGGGCAGAGGGTGG + Intergenic
1088890362 11:114039330-114039352 AGGGCCAGGTGGGGTGAGGGAGG - Intergenic
1089359654 11:117877264-117877286 AGAGCCAGGTGGGGAGCTGGGGG + Intronic
1089729532 11:120511710-120511732 CGAGCCCGGCGCGGGGAGCGCGG - Intergenic
1089935132 11:122356876-122356898 CTATCCTGGTGGGGGGAGGGGGG - Intergenic
1090204188 11:124875719-124875741 CCAGGCCGGGAGGGAGAGGGAGG + Intronic
1091403520 12:195322-195344 CCCGCCCTGTGGGGAGAGCGTGG + Exonic
1091410132 12:233670-233692 CGAAGCGGGTGGGGAGAGGAGGG + Intronic
1091461026 12:643332-643354 CGCGCCGGGTGGGGAGGGGAGGG + Intronic
1091732456 12:2891063-2891085 GGAGCCCTGCGGGGAGAGGGCGG + Intronic
1091923119 12:4321383-4321405 CGAGCAGGGAGGGGAGAGGGTGG - Intronic
1092216854 12:6689422-6689444 TGAGCCTGTTGGGGGGAGGGAGG - Exonic
1092258858 12:6941833-6941855 AGGGCACGGTGGGGGGAGGGTGG - Exonic
1092752031 12:11727897-11727919 TGAGCCCGGGAGGTAGAGGGTGG - Intronic
1093094584 12:14958216-14958238 CAGGGGCGGTGGGGAGAGGGTGG - Intronic
1093597140 12:20975743-20975765 GGAGCCTGTTGGGGAGTGGGGGG - Intergenic
1095848208 12:46770637-46770659 AGATCCCTGTGGGCAGAGGGAGG + Intronic
1096089730 12:48890923-48890945 AGAGCCGGGAGAGGAGAGGGAGG + Intergenic
1096513160 12:52143053-52143075 GAGGCCCGGTGGAGAGAGGGTGG + Intergenic
1101718549 12:107331895-107331917 GGACCCAGGTGGGGAGAGGTGGG - Intronic
1101899699 12:108782287-108782309 CCAGCCCTGGTGGGAGAGGGAGG - Intergenic
1102028582 12:109727231-109727253 CCAGCAGAGTGGGGAGAGGGCGG + Intronic
1102035327 12:109767946-109767968 TGAGCCCTGTGGGGAGAGGTTGG + Intronic
1102297029 12:111745091-111745113 TGAGCCCGGTGGGGTCGGGGAGG - Intronic
1102610367 12:114106586-114106608 TCTGCCTGGTGGGGAGAGGGGGG - Intergenic
1103560995 12:121793339-121793361 AGAGCCCAGCGGGGTGAGGGGGG - Intronic
1103565356 12:121812533-121812555 CGAGACTGCTGGGCAGAGGGAGG + Intronic
1103992635 12:124809573-124809595 GGTGCCCGGTAGTGAGAGGGTGG - Intronic
1104421720 12:128641512-128641534 AGAGCACTGTGGGAAGAGGGAGG + Intronic
1104442719 12:128807514-128807536 CCAGCCCCGGGGGGAGAGAGAGG + Intronic
1104985418 12:132593791-132593813 TGGCCCCGGCGGGGAGAGGGTGG + Intergenic
1105209431 13:18249110-18249132 GGAGGCCGGTGGGCAGACGGAGG + Intergenic
1106229713 13:27812415-27812437 AAAGCCTGGTGGGGAGAGGTAGG + Intergenic
1109804211 13:67416530-67416552 CGAGCCCAGTGGGCTGAGTGAGG + Intergenic
1113330151 13:109319136-109319158 GGAGCCCATTGGGGAGGGGGAGG + Intergenic
1114453696 14:22842380-22842402 CCAGCCACGTGGGGAGAGGATGG - Intronic
1115760291 14:36574065-36574087 CAAGCTCAGTGAGGAGAGGGAGG + Intergenic
1116771469 14:49131627-49131649 CGAGCTTGGTGGGGTGGGGGGGG - Intergenic
1117037488 14:51743722-51743744 AGAGCCAGGGGGGGAGAGGGGGG + Intergenic
1121074955 14:91060299-91060321 CGGGCCCGGCCGGCAGAGGGCGG + Intronic
1122784068 14:104155848-104155870 CGGGCCCTGTGGGAAGAGGGTGG + Intronic
1123016338 14:105377337-105377359 AGAGGCAGGTGGGGAGGGGGAGG + Intronic
1125756758 15:42070091-42070113 AGTGCCTGGTGGGGAGAAGGTGG + Exonic
1125766138 15:42137754-42137776 CCACCCGGGTGGGGAGAGGCAGG - Intergenic
1126109593 15:45167589-45167611 CGGACCCAGTGGGGAGAGGGTGG + Exonic
1126353082 15:47765220-47765242 CGAGCCTGCTAGGGCGAGGGGGG + Intronic
1127071192 15:55289729-55289751 CGAGCCAGGCGGGGACAGGACGG - Intronic
1128157317 15:65400079-65400101 AGAGCCCTCTGGGGAGAGGAGGG - Intronic
1129180175 15:73869335-73869357 ACAGCCCAGTGGGGAGGGGGGGG - Intergenic
1129449079 15:75639823-75639845 GGAGCACGGTGGGGAGGCGGCGG + Exonic
1130188977 15:81713278-81713300 CTATCCAGGGGGGGAGAGGGGGG - Intergenic
1131570947 15:93535526-93535548 CCAGCCCTGTGGGGAGGGGTGGG - Intergenic
1132129038 15:99257558-99257580 CCAACCCGGGGGTGAGAGGGTGG + Intronic
1132685452 16:1160179-1160201 CGAGCCCGCTGTGGGAAGGGCGG + Intronic
1132810189 16:1793560-1793582 TGAGCCCGCTGGGGAGAGGCCGG - Intronic
1132983754 16:2752868-2752890 CGAGCCGGGTGGGGGAGGGGCGG + Intronic
1133046780 16:3092530-3092552 CGGGGCCGCTGGTGAGAGGGTGG - Exonic
1133336577 16:5010561-5010583 AGTTCCCGGTGGGGAGAGGGTGG + Intronic
1134302155 16:13001326-13001348 CCAGCCCAGGGAGGAGAGGGAGG - Intronic
1136403204 16:30029511-30029533 CCAGCCTGGGGGAGAGAGGGAGG + Exonic
1136898233 16:34009004-34009026 CGAGACTGTTGGGGAGTGGGGGG - Intergenic
1137009543 16:35309295-35309317 CGTCCCCGATGGGGAAAGGGTGG + Intergenic
1137918131 16:52455369-52455391 ACAGCCCGGTAGGGAAAGGGCGG - Intronic
1137988731 16:53131337-53131359 CTCGGCCGGTGGGGGGAGGGGGG + Intronic
1139264212 16:65623962-65623984 AGAGTCTGGTGGGGAGAGGGAGG - Intergenic
1140125888 16:72118747-72118769 GGAGCCCGGTGGTGGGCGGGGGG + Intronic
1140343858 16:74193096-74193118 TGAGCCCAGTGGGGAGAGTGTGG - Intergenic
1140516806 16:75549065-75549087 AGAGCAGGGTGGAGAGAGGGGGG + Intronic
1141904290 16:87013322-87013344 CGGGCCGGGTGGGAAGTGGGTGG + Intergenic
1141928696 16:87186147-87186169 GGAGCCCCGTGGTGAGAGGCGGG - Intronic
1141957898 16:87384441-87384463 CGCGCCCGGTCTGGAAAGGGAGG + Intronic
1142307574 16:89294115-89294137 AGGGCCTGGTGGGGAGCGGGAGG - Intronic
1142354671 16:89596844-89596866 TGAGCCAGGTGGGTGGAGGGAGG + Exonic
1142474439 17:180919-180941 CGAGGCCGGTGGGCAGGGCGCGG + Intronic
1142851298 17:2706108-2706130 AGAGCCGGGTGGGGAAGGGGAGG - Intronic
1143382604 17:6505859-6505881 CGAGACCGGCGGGGAGAGACGGG + Intronic
1143487539 17:7262861-7262883 AGAACCCGGCGGGGAAAGGGCGG - Intronic
1143516412 17:7421332-7421354 CAAGAACGGTGGGGAGGGGGCGG + Exonic
1143771406 17:9171344-9171366 CTTTCCTGGTGGGGAGAGGGGGG - Intronic
1144740669 17:17580531-17580553 ACAGCCTGGTGGGGGGAGGGTGG + Intronic
1145094115 17:20009696-20009718 CGGGCCCGGAGGGGAGGAGGCGG - Intronic
1146288813 17:31593829-31593851 CAAGGCAGGTGGGGAGAGAGAGG - Intergenic
1146742844 17:35301450-35301472 TGAGCTTGGTGGGGGGAGGGGGG + Intergenic
1147947286 17:44087240-44087262 GGAGGCCGGTGGGGAGAAGGGGG - Intronic
1147969500 17:44212011-44212033 AGAGCCAGGTGGGGGGACGGAGG + Intronic
1148203529 17:45765605-45765627 CCAACCTGGTGGGGACAGGGTGG + Intergenic
1148699722 17:49580177-49580199 CGTGCCCGCTGCTGAGAGGGCGG - Exonic
1148793058 17:50184364-50184386 AGAGGCAGGTGGAGAGAGGGTGG + Exonic
1148904122 17:50900718-50900740 CGAGCTGGGAGGGGAGGGGGGGG + Intergenic
1151367623 17:73627605-73627627 GGAGCACGGTGGGCAGTGGGTGG + Intronic
1151468122 17:74300959-74300981 CCAGGACGGTGGGGTGAGGGCGG + Intronic
1151491113 17:74432672-74432694 CGAGCCGGCTGGGGACTGGGGGG + Intronic
1151816138 17:76472315-76472337 CGCACACGGTGGGGAGAGGACGG + Intronic
1152069566 17:78128136-78128158 TGAGCTAGGTGGGGAGAGGCTGG + Intronic
1152524133 17:80877845-80877867 TGAGCACGATGGGGAGCGGGTGG - Intronic
1152797968 17:82317230-82317252 GGACCCCGGTGGGGAGTGGCCGG - Intronic
1155509481 18:26562417-26562439 GAAGCCCGGTGGGGGGTGGGGGG + Intronic
1157610645 18:48952763-48952785 GGAGCCCGGAGCTGAGAGGGCGG - Intergenic
1158878030 18:61751729-61751751 GAAGGCCGGTGGGGAGAGGCTGG + Intergenic
1159968687 18:74622144-74622166 GGAGACTGGTGAGGAGAGGGTGG + Intronic
1160442954 18:78906295-78906317 GGACCCTGGTGGGGAGCGGGAGG - Intergenic
1160621459 18:80174084-80174106 GGAGCCCTGTGGAGTGAGGGTGG - Intronic
1160809879 19:1008775-1008797 CCAGCCAGGTGGGGAGCGGGTGG + Exonic
1160810275 19:1010277-1010299 CGAGCCCGTGGGGGTGGGGGAGG - Exonic
1160942240 19:1625704-1625726 CCAGCCTGGTGGGGAGCGGATGG + Exonic
1160947194 19:1649126-1649148 CAGGCCCGGTGGGGAGGGCGGGG - Intronic
1160947969 19:1652276-1652298 TGAGCCCGGCGGGGGGCGGGGGG - Intronic
1160968112 19:1755446-1755468 AGCGGCCGGAGGGGAGAGGGAGG - Intronic
1161057950 19:2200055-2200077 AGAGGCCGGTGGGGACAGGAAGG + Intronic
1161330132 19:3682985-3683007 CAAGCCTGGTGTGGGGAGGGAGG - Intronic
1161492657 19:4570735-4570757 CCAGTCCCGTGGGGAGACGGGGG + Intergenic
1161576704 19:5058423-5058445 GGAGCCCGGTGAGGGGAGGATGG + Intronic
1161736883 19:5997001-5997023 CCGGGCCTGTGGGGAGAGGGCGG - Intronic
1162032924 19:7925161-7925183 CCAGCCCGGGGGAGAGGGGGAGG - Exonic
1162312146 19:9913910-9913932 GGAGCCCGGCGGGGGGCGGGGGG + Intronic
1162443385 19:10707284-10707306 CGAGCCTGATGGTGAGATGGGGG - Exonic
1162555530 19:11383635-11383657 CCGGCCCGGTGGAGGGAGGGAGG - Intronic
1162559131 19:11405971-11405993 CCAGCACTTTGGGGAGAGGGAGG - Intronic
1162771594 19:12952730-12952752 CGAGCCCCCTGGGGAGCTGGCGG + Exonic
1163524771 19:17814050-17814072 CAAGCCTGGTAAGGAGAGGGAGG - Intergenic
1163665587 19:18602459-18602481 TTAGCCAGGTGGGGAGGGGGTGG + Intronic
1163672181 19:18636027-18636049 TGTGCAGGGTGGGGAGAGGGAGG + Intergenic
1164938210 19:32231154-32231176 GCAGCCTGGTGGGGAGAGAGCGG - Intergenic
1166043894 19:40218289-40218311 CGAGCCCGGTGGGGAGAGGGCGG + Exonic
1166107629 19:40605219-40605241 CGAGCACGGTGAGGAAAGGGTGG + Exonic
1166118454 19:40670076-40670098 CGAGGGCGGGGGGTAGAGGGCGG - Intronic
1166133707 19:40762884-40762906 CATGCCCTGTGGAGAGAGGGAGG - Exonic
1166232515 19:41433432-41433454 GGACTGCGGTGGGGAGAGGGTGG + Exonic
1166373930 19:42316570-42316592 GAAGCTGGGTGGGGAGAGGGTGG + Intronic
1166694777 19:44846348-44846370 CGAGCCGGGCGGGGAGAGCTGGG + Intronic
1167379933 19:49132947-49132969 CGAGCCCCTGGGGGAGAGGACGG - Intronic
1167445291 19:49533890-49533912 CGGGGCCGGCGCGGAGAGGGTGG + Intronic
1167466886 19:49654786-49654808 CCAGCCCGGTGGGGGTGGGGGGG - Exonic
1167547437 19:50136808-50136830 CGAGCCCGGGCGGCAGAGTGAGG + Intergenic
1167738713 19:51311770-51311792 CGAGGCCTGGGGGGAGAGGGGGG - Intergenic
1167955256 19:53058734-53058756 CGAATTCGGTGGGGGGAGGGGGG + Intergenic
1168112501 19:54201469-54201491 CTCGCCTGGTGGGGAGAAGGGGG - Exonic
1168252655 19:55149250-55149272 CCCGCCCCGAGGGGAGAGGGAGG + Exonic
1168523649 19:57071698-57071720 GGAGCCAGGTGGGGATGGGGAGG + Intergenic
925085081 2:1101335-1101357 GGATCCCAGTGGGGAGAGGCAGG - Intronic
925127802 2:1473314-1473336 CTAGGCCTGTGGGGAGAAGGAGG - Intronic
925162307 2:1694508-1694530 AGGGCCAGGTGGGCAGAGGGGGG - Intronic
925407206 2:3613441-3613463 AGAGCCGGGTGGGGAGGTGGGGG + Intronic
925715543 2:6781490-6781512 CTAGCCCAGTGGGGAGAGCCCGG + Intergenic
926284978 2:11481933-11481955 CGGCGGCGGTGGGGAGAGGGCGG + Intergenic
926321319 2:11750078-11750100 CGAGGCCGGGGAGGGGAGGGGGG - Intronic
926423321 2:12718791-12718813 AGAGCCCGGGGAGGAGAGGGCGG + Intronic
927200838 2:20577245-20577267 GGAGCTGAGTGGGGAGAGGGTGG + Intronic
927544504 2:23940670-23940692 CGCGTCCGGCGGGGTGAGGGCGG + Intronic
927787350 2:25982749-25982771 CGGGCTCGGTGGGGTGACGGCGG - Intronic
927857244 2:26535403-26535425 GGAGCCCCGTGGGAAGATGGTGG - Intronic
929486768 2:42361568-42361590 GGGGCCTGGGGGGGAGAGGGCGG + Exonic
931252931 2:60549996-60550018 CGAGCTCCGAGGCGAGAGGGGGG + Intronic
931624847 2:64247991-64248013 AGAGCCCTGTGGGGAGAGCTAGG - Intergenic
932768855 2:74489366-74489388 GGAGCCTGGTGGTGGGAGGGAGG + Intronic
932838692 2:75061188-75061210 AGAGGCTGGAGGGGAGAGGGAGG + Intronic
933778675 2:85787047-85787069 TGAGGGCGGAGGGGAGAGGGAGG - Exonic
934716793 2:96549329-96549351 CGAGGCAGGCGGGGAGCGGGAGG + Exonic
935754336 2:106265337-106265359 AGAGCCTGGGTGGGAGAGGGTGG - Intergenic
935946167 2:108288644-108288666 CGAGGCCAGTGGGAGGAGGGAGG + Exonic
936114041 2:109688025-109688047 AGAGCCTGGGTGGGAGAGGGTGG + Intergenic
936653876 2:114461875-114461897 AGAGACAGGTGGAGAGAGGGAGG + Intronic
937278389 2:120701211-120701233 CCAGCCTGGTGGGGAGAGCAGGG + Intergenic
940140567 2:150486956-150486978 AGAGCCGGGTGGGGTGAGTGGGG - Intronic
940771551 2:157844345-157844367 CAAACCCAGTGGGGACAGGGTGG - Intronic
941021067 2:160408028-160408050 CGATCCCGGGAGGGAGAGCGCGG - Intronic
942116745 2:172735798-172735820 CTGGGGCGGTGGGGAGAGGGAGG - Intronic
942428408 2:175883736-175883758 CAAGGCCGGTGGGGGCAGGGAGG + Intergenic
942890343 2:180980578-180980600 CGAGCGCGGGGGGGAGGGGCGGG - Intronic
944164058 2:196698835-196698857 GTTGCCGGGTGGGGAGAGGGGGG - Intronic
944221744 2:197310505-197310527 GGAGCCCGGCGGGGGGATGGGGG - Intronic
944517423 2:200526284-200526306 CGATCCCGACAGGGAGAGGGCGG - Intronic
944699977 2:202238216-202238238 CGAGCCCGGAGAGGGGCGGGCGG + Intronic
945251722 2:207770022-207770044 CGAGCCCGCGGGGCAGTGGGCGG - Intergenic
945492797 2:210476265-210476287 CGAACACCGTGGGGAGAGGCAGG + Intronic
946329652 2:219002103-219002125 AGAGCCCGGGCGGGGGAGGGGGG - Intergenic
947778200 2:232732079-232732101 CATGACTGGTGGGGAGAGGGAGG - Intronic
948085612 2:235244211-235244233 CATGCCCGCTGGGGAGAAGGAGG + Intergenic
948656600 2:239480242-239480264 CGAGACCCGGGGGGAGATGGAGG - Intergenic
948802089 2:240437548-240437570 AGAGCCCAGTGGGGTGAGGGGGG - Intronic
948826005 2:240573709-240573731 AGAGCCTGGTGGGGTGAGCGGGG + Intronic
948836557 2:240628825-240628847 AGAACCCGGAGGGGTGAGGGCGG - Intronic
1168900345 20:1358476-1358498 AGAGCCTGTTGGGGAGAGGAGGG + Intronic
1169291748 20:4359007-4359029 GGAGCCAGAAGGGGAGAGGGTGG + Intergenic
1170013796 20:11757653-11757675 TGAGCCCGGAGAGGAGAAGGGGG - Intergenic
1170217168 20:13903729-13903751 TGAACCCGGGGGGGAGACGGAGG + Intronic
1171290583 20:23980777-23980799 GGAGGCCGGTGGGCAGACGGAGG + Intergenic
1171391135 20:24802500-24802522 AGAGCCCAGTGCGGGGAGGGTGG + Intergenic
1172137535 20:32697398-32697420 AGAGCGGGGTGGGGGGAGGGGGG - Intergenic
1172155351 20:32820149-32820171 CGAGCCGGGTGGGGGAAGGGCGG + Intronic
1172485016 20:35292607-35292629 GGAGCCTGGTGGGGATGGGGCGG - Intergenic
1172618656 20:36306286-36306308 CGAGAGCGGCGGGGAGGGGGCGG - Intergenic
1174506936 20:51023079-51023101 GGAGCCCGGCGGGGACCGGGAGG - Exonic
1174804485 20:53593849-53593871 CGGGCGCGGAGGGGAGGGGGCGG + Intronic
1174852509 20:54008373-54008395 CCACCCCAGTGGGGAGAGGGAGG - Intronic
1174980069 20:55383968-55383990 CAAGACGGGTGGGGAGAGGTGGG + Intergenic
1175442114 20:58999598-58999620 GGAGCCCCGTTGGCAGAGGGTGG + Intronic
1176061324 20:63174174-63174196 CGTGCCTGGTGGGGAGAGGGAGG - Intergenic
1176146512 20:63567935-63567957 CCTGCCCAGTGGGGAGTGGGAGG - Intronic
1177792548 21:25735739-25735761 GGAGCCGGGTGGGGAGGGGCGGG + Intronic
1179485128 21:41705170-41705192 CGAGGGTGGTGGGGGGAGGGTGG + Intergenic
1179562236 21:42222951-42222973 TGAGCCAGGTGGGGTGATGGTGG - Intronic
1179717938 21:43299608-43299630 AGAGCCCGGCAGGGAGAGAGCGG + Intergenic
1179886118 21:44314895-44314917 CCAGCCCTGGGGGCAGAGGGTGG + Intronic
1179976971 21:44873780-44873802 CGAGCCCGTTGGCGAGGGGCGGG - Exonic
1180085623 21:45506818-45506840 GGGGGCCGGTGGCGAGAGGGAGG - Intronic
1180105665 21:45616664-45616686 GGAGCCCGGCGGGGAGGGGCTGG - Intergenic
1180560388 22:16610251-16610273 CGGGCGCGGAGGGGAGGGGGCGG + Intergenic
1180766472 22:18348568-18348590 CGAGGATGGTGGGGAGAGGAGGG + Intergenic
1180766838 22:18350290-18350312 GGAGGCCGGTGGGCAGATGGAGG - Intergenic
1180779475 22:18512088-18512110 GGAGGCCGGTGGGCAGATGGAGG + Intergenic
1180779843 22:18513810-18513832 CGAGGATGGTGGGGAGAGGAGGG - Intergenic
1180812191 22:18769409-18769431 GGAGGCCGGTGGGCAGATGGAGG + Intergenic
1180812557 22:18771131-18771153 CGAGGATGGTGGGGAGAGGAGGG - Intergenic
1181167881 22:20993039-20993061 GGAGCCCTGTGGGCTGAGGGTGG + Intronic
1181198350 22:21203656-21203678 GGAGGCCGGTGGGCAGATGGAGG + Intergenic
1181198716 22:21205379-21205401 CGAGGATGGTGGGGAGAGGAGGG - Intergenic
1181401021 22:22650420-22650442 CGAGGATGGTGGGGAGAGGAGGG + Intergenic
1181401395 22:22652143-22652165 GGAGGCCGGTGGGCAGACGGAGG - Intergenic
1181533079 22:23528222-23528244 AGAGCCCAGAGGGGAGATGGCGG + Intergenic
1181702998 22:24631512-24631534 CGAGGATGGTGGGGAGAGGAGGG + Intergenic
1181703363 22:24633225-24633247 GGAGGCCGGTGGGCAGACGGAGG - Intergenic
1182693644 22:32181267-32181289 CGAGCCAGGTTGGGGGTGGGTGG - Intergenic
1183535510 22:38398531-38398553 CGGGCGCGGAGGGGAGGGGGCGG + Intergenic
1184850320 22:47116060-47116082 GGGGGCCGGCGGGGAGAGGGCGG - Intronic
1185312572 22:50164517-50164539 GGTGTCCGGTGGGGAGTGGGGGG - Intergenic
1185388399 22:50546905-50546927 CGGGCTCGATGGGGAGAGGCCGG + Intergenic
1203228089 22_KI270731v1_random:89458-89480 CGAGGATGGTGGGGAGAGGAGGG + Intergenic
1203228457 22_KI270731v1_random:91181-91203 GGAGGCCGGTGGGCAGACGGAGG - Intergenic
949882324 3:8671801-8671823 ATATCCAGGTGGGGAGAGGGGGG - Intronic
949882348 3:8671879-8671901 ATATCCAGGTGGGGAGAGGGGGG - Intronic
951310916 3:21125157-21125179 CGAGCATGGTGAGGAGAGGGGGG + Intergenic
951543963 3:23806976-23806998 AGAGCCCCGGGGGGCGAGGGAGG + Intronic
951981860 3:28575538-28575560 CGCGCTCGGCCGGGAGAGGGAGG + Intergenic
952436544 3:33277548-33277570 CCAGCCCGGTAGGGGTAGGGCGG - Intronic
953432572 3:42851877-42851899 GGAGCAGGATGGGGAGAGGGTGG - Intronic
953761383 3:45689692-45689714 CGAGCACGGTGGAGAAAGGCCGG - Intronic
953982045 3:47417953-47417975 GGTGCGGGGTGGGGAGAGGGGGG + Intronic
955593527 3:60563170-60563192 CGAGCCCGATGGGAAGCGGTAGG + Intronic
956122057 3:65976377-65976399 CCAGCACTGTGGGGAGACGGAGG + Intronic
960338360 3:116445598-116445620 CCAGCAGGGTGGGGGGAGGGTGG - Intronic
961564540 3:127754223-127754245 TGAGCTTGGTGGGGAGTGGGCGG - Intronic
961720971 3:128895774-128895796 CAAGCCCAGTGGGGAGAAGGTGG - Intronic
962640128 3:137377144-137377166 CCAGCTTGGTGGGGGGAGGGAGG - Intergenic
962666056 3:137654512-137654534 CGAGCTTGGTTGGGGGAGGGGGG + Intergenic
964148686 3:153497760-153497782 CGAGAGCTGAGGGGAGAGGGAGG - Intronic
965590602 3:170357553-170357575 CGAGGGCGGCGGGGAGGGGGAGG - Intergenic
967031619 3:185612827-185612849 CTAGCCTGGTGGGTTGAGGGGGG + Intronic
967858345 3:194134544-194134566 AGGGCCCCGCGGGGAGAGGGCGG + Intergenic
968514769 4:1011476-1011498 GGAGCCCGGCGGGGCGGGGGCGG + Intronic
968659473 4:1793199-1793221 CGAGCCGGGCGGGGACCGGGCGG + Intergenic
969398404 4:6938039-6938061 GGTGCTGGGTGGGGAGAGGGAGG + Intronic
969531404 4:7733029-7733051 CCAGAGGGGTGGGGAGAGGGAGG - Intronic
969607816 4:8211242-8211264 ACAGGACGGTGGGGAGAGGGAGG - Intronic
969609476 4:8219004-8219026 GGAGCCGGGTGGGGAGTAGGTGG + Intronic
970565371 4:17327114-17327136 GGAGCACGATGGGGACAGGGAGG - Intergenic
971095015 4:23390775-23390797 GGAGTCCGCTGGGGAGAAGGTGG + Intergenic
973160839 4:47014520-47014542 GGAGGCTGGTGGGGAGAGAGGGG - Intronic
975656385 4:76645295-76645317 AGTGACCGGTGGGGAGAGGCTGG - Intronic
977569282 4:98612818-98612840 TTAGCCCTGTGGGGGGAGGGAGG - Intronic
979670651 4:123357214-123357236 GGAGCCAGCTGGGGCGAGGGCGG - Intergenic
981097117 4:140793217-140793239 ACAGCCTGGTGGGGAGATGGGGG - Intergenic
981749866 4:148082870-148082892 CGAGCTTGGTGGGGGAAGGGGGG + Intronic
985714083 5:1445932-1445954 CGAGCCCGCTGGTCAGAGCGTGG - Intergenic
986743547 5:10724967-10724989 GGAGCCTGAAGGGGAGAGGGGGG - Intronic
987019270 5:13852670-13852692 CCAGCTTGGTGGGGGGAGGGGGG + Intronic
987924078 5:24317808-24317830 TGAGCTTGGTGGGGGGAGGGGGG - Intergenic
988735479 5:34016218-34016240 CGGGGGTGGTGGGGAGAGGGTGG + Intronic
994710671 5:103259752-103259774 CGCGACAGGTGGGGCGAGGGTGG - Intronic
994778207 5:104061946-104061968 CAAGACAGGTGGGGAGAGGGAGG - Intergenic
997089559 5:130841391-130841413 GGAGCCTGTTGGGGAGTGGGGGG - Intergenic
997549279 5:134738184-134738206 AGAGACGGGTGGGGGGAGGGGGG + Intergenic
998232310 5:140368570-140368592 TGTTCCCTGTGGGGAGAGGGAGG - Exonic
998501647 5:142637871-142637893 AGAGCCTGGAGGGGAAAGGGTGG + Intronic
999427578 5:151500956-151500978 GGGGCCTGGTGGGGAGAGGATGG + Intergenic
1001098115 5:168791898-168791920 AGAGGCCGGTGGGGTGAGGGTGG - Intronic
1001639466 5:173234709-173234731 CGACCCAGGAGGGGAGAAGGGGG + Intronic
1002072824 5:176690516-176690538 CCAGCCCTGTGATGAGAGGGTGG - Intergenic
1002304965 5:178277896-178277918 TGACCCCCGTGGGGTGAGGGAGG + Intronic
1002420871 5:179148528-179148550 CCAGCACCGTGGGGAGAGTGAGG - Intronic
1002771057 6:291714-291736 CTCGCCTGGTGGGGAGAGGTGGG - Intronic
1002896221 6:1382030-1382052 CCCGCGCGGAGGGGAGAGGGAGG + Intergenic
1002896229 6:1382054-1382076 GCAGCGCGGAGGGGAGAGGGAGG + Intergenic
1002896236 6:1382078-1382100 GCAGCGCGGAGGGGAGAGGGAGG + Intergenic
1002896243 6:1382102-1382124 GCAGCGCGGAGGGGAGAGGGAGG + Intergenic
1003543223 6:7036455-7036477 CTAGCCCTGTGGGGTGAGAGTGG + Intergenic
1003646283 6:7915276-7915298 AGAGCTCAGTGGGCAGAGGGAGG - Intronic
1004438478 6:15621877-15621899 GGAGCCCTGTGGGAGGAGGGCGG - Intronic
1004565476 6:16792002-16792024 CCATCCCAATGGGGAGAGGGAGG - Intergenic
1004864238 6:19837706-19837728 CGAACCCGCTGGGGCGAGCGAGG - Exonic
1005887137 6:30105877-30105899 GGAGCCAGGTGGGGTAAGGGGGG + Intronic
1006147859 6:31970020-31970042 CGAGCCTGGGGGGCAGATGGAGG + Exonic
1006213131 6:32414394-32414416 CGAGGCCAGTGAGGGGAGGGTGG + Intergenic
1006987008 6:38182555-38182577 CCAGCCCTGTGGGGAGAGCAGGG - Intronic
1007364713 6:41383357-41383379 CAAGCCCTGTGAGGACAGGGAGG - Intergenic
1007431565 6:41780084-41780106 CAAGCCCGGAGGGGACAGGGCGG + Intronic
1009366312 6:62860626-62860648 AGAGCCAGGAGGTGAGAGGGGGG + Intergenic
1011277361 6:85643519-85643541 CCCGCCTGGAGGGGAGAGGGAGG - Intronic
1013819301 6:114135598-114135620 CGTGCCCTGGGTGGAGAGGGAGG - Intronic
1014290118 6:119548450-119548472 AGGGCCCGGAGGGGAGATGGTGG - Intergenic
1015842985 6:137493271-137493293 CGGGCCGGGAGGGAAGAGGGAGG - Exonic
1016841855 6:148533235-148533257 GGAGCCAGGTGGGGAGAGGGAGG - Intronic
1016863716 6:148746884-148746906 CGAGACCCGAGCGGAGAGGGAGG + Intergenic
1018229701 6:161663818-161663840 CCGGCCCTGTGGTGAGAGGGTGG + Intronic
1018719863 6:166564359-166564381 AGAGACTGGTGGGGAGAGGGAGG - Intronic
1018890106 6:167976993-167977015 CGATGCCGGCGGGGAGCGGGCGG + Intergenic
1019406958 7:888966-888988 CGGGCCCTGTGGGGAGAGCCAGG + Intronic
1019415619 7:925442-925464 GGAGGCCGGAGGGAAGAGGGAGG - Intronic
1019537446 7:1536735-1536757 TGTGCATGGTGGGGAGAGGGAGG + Intronic
1020204667 7:6105242-6105264 CCAGGCCGCTGGGGAGGGGGCGG + Intronic
1022943054 7:35257773-35257795 CGTGCCCCGTGGGGAGCGCGCGG + Intergenic
1023287133 7:38631487-38631509 GGAGCGCGGAGGGGTGAGGGCGG + Exonic
1023294694 7:38702562-38702584 CTTCCCCGGTGGGGAGAGTGGGG - Intergenic
1026471286 7:70695260-70695282 CGAGCCCGGCCGGCCGAGGGAGG - Intronic
1029370805 7:100149288-100149310 GGAGCCCGGGGGCGAGAGTGGGG + Intronic
1030083485 7:105797751-105797773 CGCACCAGGAGGGGAGAGGGAGG - Intronic
1032035462 7:128518116-128518138 AGAGCCCTCTGGGTAGAGGGAGG + Intergenic
1032447609 7:131998171-131998193 TGAGCAAGGTAGGGAGAGGGTGG - Intergenic
1033390623 7:140924522-140924544 CGAGCCCGGAGTCGGGAGGGCGG + Intronic
1033824092 7:145168631-145168653 CGAGGCGGGTGGTGGGAGGGAGG - Intergenic
1034218064 7:149422908-149422930 CGAGGCCGGCGGGGAGACCGAGG + Intergenic
1034273210 7:149813140-149813162 TGAGGGAGGTGGGGAGAGGGAGG + Intergenic
1034618284 7:152436690-152436712 GGAACCCGGGGGGGAGGGGGAGG - Intergenic
1034880351 7:154757973-154757995 AGAGGGCGGCGGGGAGAGGGCGG - Intronic
1035553098 8:544912-544934 CGGGCCTGGTGGGGAGGGGGCGG - Intronic
1035574303 8:695298-695320 CAAGGGCTGTGGGGAGAGGGAGG - Intronic
1037990293 8:23316914-23316936 GGAGCCCGGTGGGGAGGGAGGGG + Intronic
1038467014 8:27773463-27773485 GGAGGGCGGTGGGGGGAGGGGGG + Intronic
1038544010 8:28411981-28412003 CGGGCCTGGGAGGGAGAGGGAGG + Intronic
1038683425 8:29692579-29692601 CCAGCTGGGTGGGGGGAGGGGGG + Intergenic
1039895592 8:41714421-41714443 AGAGCCCTGTGGGAACAGGGGGG + Intronic
1041586832 8:59530323-59530345 TGAGCCAGGTGGGGAGAGGCTGG + Intergenic
1042861078 8:73315124-73315146 GGAGGCCGGTGGGGAGAGGAAGG - Intronic
1042962603 8:74320518-74320540 CAAACCCGGCCGGGAGAGGGAGG + Intronic
1043390152 8:79784153-79784175 CGATCCGGGCGGGGTGAGGGGGG + Intergenic
1043720436 8:83543010-83543032 AGAGCCCGGGGAGGAGAAGGTGG + Intergenic
1044829191 8:96229387-96229409 GGAGCCGGGTGGGTGGAGGGAGG - Intronic
1044996686 8:97844100-97844122 GGAGCAGGATGGGGAGAGGGGGG + Intronic
1045538585 8:103059513-103059535 GGGGGCCGGTGGGGGGAGGGGGG - Intronic
1045661791 8:104445637-104445659 GGATGGCGGTGGGGAGAGGGGGG + Intronic
1048860299 8:138719890-138719912 GGAGCCCTGTGGGTGGAGGGCGG + Intronic
1049408971 8:142464087-142464109 CCGGCCCGGTGGGGGCAGGGAGG - Exonic
1049451937 8:142666654-142666676 CATGCACTGTGGGGAGAGGGTGG + Intronic
1049643143 8:143724576-143724598 TGGGGCTGGTGGGGAGAGGGGGG + Exonic
1049653868 8:143789284-143789306 AGAGCCGGGTGGGGAGGAGGGGG + Intergenic
1049765749 8:144354503-144354525 GGAGCCAGGTGGGCAGAGGCAGG - Intronic
1049782544 8:144435519-144435541 CGAACCCGGATGGGAGGGGGCGG + Exonic
1050407598 9:5326590-5326612 GGAGCCAGGTGGGGACAAGGGGG + Intergenic
1052842712 9:33306791-33306813 AGAGCACCGTGGGGAAAGGGGGG - Intronic
1053272758 9:36761558-36761580 CGAGGCCAGGGAGGAGAGGGCGG + Intergenic
1053613981 9:39744942-39744964 TGGGGGCGGTGGGGAGAGGGGGG - Intergenic
1054239535 9:62597451-62597473 TGGGGGCGGTGGGGAGAGGGGGG + Intergenic
1054553667 9:66631978-66632000 TGGGGGCGGTGGGGAGAGGGGGG + Intergenic
1056820931 9:89841645-89841667 AGAGCCACCTGGGGAGAGGGCGG - Intergenic
1056857248 9:90142545-90142567 CGAGGGTGGCGGGGAGAGGGGGG - Intergenic
1056865112 9:90222069-90222091 ATAGCCAGGGGGGGAGAGGGGGG - Intergenic
1057600303 9:96451028-96451050 AGAGCGCGGTGGGGAGGAGGAGG + Intronic
1057858975 9:98624810-98624832 CGAGCCCGGGGCAGACAGGGAGG + Intronic
1059259121 9:112959091-112959113 TGACACCGGTGGAGAGAGGGTGG - Intergenic
1059416694 9:114166920-114166942 AGAGTCCTGTGGGGAGAAGGAGG + Intronic
1060583299 9:124770838-124770860 CGAGACCGGGGAGGAGAGGGAGG + Intronic
1061247380 9:129407583-129407605 AGAGCCCAGAGGGGAGATGGTGG - Intergenic
1061272263 9:129550199-129550221 CGAGCCGGGCGGGGAGAGGGAGG - Intergenic
1062204596 9:135329115-135329137 GGAGCCCGGTGGGGCTGGGGTGG - Intergenic
1062396271 9:136354042-136354064 AGAGCCCTGCGGGGAGAAGGGGG + Intronic
1062524339 9:136972214-136972236 GGGGCCCCGTGGGAAGAGGGAGG + Intergenic
1062622346 9:137428683-137428705 GGAGCTGGGTGGGGAGACGGGGG + Intronic
1185835963 X:3346216-3346238 GGAGCGCTTTGGGGAGAGGGAGG + Intronic
1186805975 X:13140271-13140293 TGAGCCAGGTGGGGAGTGGCAGG - Intergenic
1190117727 X:47637109-47637131 CGGGGTCTGTGGGGAGAGGGTGG + Exonic
1191101610 X:56735570-56735592 GGAGCCGGGTGGGTGGAGGGAGG - Intergenic
1199105200 X:143858145-143858167 GGAGCCTGTTGGGGAGGGGGTGG + Intergenic
1200002607 X:153069716-153069738 CGAGGCGGGGGGGGGGAGGGGGG + Intergenic
1200230643 X:154442270-154442292 TGAGCCCAAGGGGGAGAGGGAGG + Intronic
1200884172 Y:8252446-8252468 CGAGCCCCGTGGGGAGCGCCAGG + Intergenic
1200887087 Y:8280952-8280974 CGAGCCCTGTGGGGAGAGCCAGG + Intergenic
1201018117 Y:9625112-9625134 CGAGCCCCATGGGGAGAGCCAGG + Intergenic
1201938710 Y:19435314-19435336 GCAGCCTGGTGGGGAAAGGGGGG + Intergenic