ID: 1166044830

View in Genome Browser
Species Human (GRCh38)
Location 19:40223690-40223712
Sequence AGCACGGGCTTGAGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166044824_1166044830 6 Left 1166044824 19:40223661-40223683 CCATTGACTTGTGTCTGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 147
Right 1166044830 19:40223690-40223712 AGCACGGGCTTGAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 164
1166044822_1166044830 25 Left 1166044822 19:40223642-40223664 CCTGGTGTGTAAAATGGGGCCAT 0: 1
1: 1
2: 2
3: 42
4: 317
Right 1166044830 19:40223690-40223712 AGCACGGGCTTGAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166044830 Original CRISPR AGCACGGGCTTGAGGGTCCT GGG Intronic
900104111 1:974901-974923 AGCACGGGCGTGAAGGTCGGAGG + Exonic
901139862 1:7021579-7021601 AGCACGGGCAGGAGGGACATTGG + Intronic
902224457 1:14987998-14988020 AGCTCTGGCCTGAGGGTACTAGG + Intronic
902482433 1:16718878-16718900 AGCCCGGCCTGGTGGGTCCTAGG + Intergenic
905202838 1:36325451-36325473 ATCAAGGACTTGAGGATCCTTGG + Intronic
907300540 1:53483950-53483972 AGCAGGGGCAGGAGGGGCCTGGG + Intergenic
907882509 1:58564534-58564556 AGCAAGGGCATGGGAGTCCTCGG + Intergenic
908401345 1:63774784-63774806 TGGAGGGGTTTGAGGGTCCTGGG + Intronic
922991257 1:229913864-229913886 AGAAAGGGCATGAGGGTGCTGGG - Intergenic
1063114756 10:3066313-3066335 AGCACGGGCTTATGGGACCCGGG - Intronic
1063437592 10:6047107-6047129 TGCAGGGATTTGAGGGTCCTTGG - Intronic
1067568457 10:47354516-47354538 AGCCTGAGCTTGAGGCTCCTGGG + Intronic
1069872067 10:71539267-71539289 TGGACAGGCATGAGGGTCCTAGG - Intronic
1070555504 10:77524705-77524727 AGCTCGGGACTGAGGGACCTGGG + Intronic
1070642719 10:78180958-78180980 GGGACGGGCAGGAGGGTCCTGGG - Intergenic
1070813170 10:79308447-79308469 AGCACGTGGCTGGGGGTCCTGGG + Intronic
1073185871 10:101614720-101614742 AACAGAGCCTTGAGGGTCCTGGG - Intronic
1074982859 10:118633665-118633687 AGCACGGGCTTTGGGGCCCAAGG - Intergenic
1075629239 10:123991231-123991253 AGCATGGGCTTGAGGGACTGGGG + Intergenic
1076295248 10:129378778-129378800 AGCACGGGCTAGAGGGGACAAGG - Intergenic
1076495308 10:130893280-130893302 GGCACAGTCCTGAGGGTCCTGGG - Intergenic
1076729303 10:132430261-132430283 GGCACATGCCTGAGGGTCCTGGG + Intergenic
1077050060 11:562580-562602 GGCACGGGCCTGAGCGTCCAGGG - Exonic
1077333864 11:1994763-1994785 AGCCCGGGCTTCAGGGGTCTGGG + Intergenic
1078269076 11:9777797-9777819 AGGAAAGGCTTGAGGGCCCTTGG + Intergenic
1081571564 11:44294512-44294534 AGGAGGGGCCTGAGGGGCCTGGG + Intronic
1084888433 11:72224873-72224895 GGCCCGGGCTTGAGGATCCGTGG - Exonic
1085332850 11:75667834-75667856 TGCACGGGCTTGGGGATCCACGG + Exonic
1085472402 11:76766719-76766741 AGCCCGGGCAGGAGGGTCCCAGG - Intergenic
1089739625 11:120573506-120573528 AGCTCTAGCTTGTGGGTCCTTGG + Intronic
1090271359 11:125388591-125388613 AGCTGGGGCTTGAGGACCCTGGG - Intronic
1090880404 11:130827704-130827726 AGCAGGGGCTTGAGGGCACTGGG - Intergenic
1091356309 11:134940638-134940660 AGCAAGAGCATGAGGGTCCTGGG - Intergenic
1202816847 11_KI270721v1_random:49945-49967 AGCCCGGGCTTCAGGGGTCTGGG + Intergenic
1092441402 12:8508359-8508381 AGCAGGGGCATGAGGCTCATGGG + Intergenic
1092645746 12:10570156-10570178 AGCAGGGGCTTGCAGGTCATAGG - Intergenic
1099171449 12:79369398-79369420 ATCATGGGCTTGAGCCTCCTGGG - Intronic
1099514657 12:83583121-83583143 TACACTGGCTTCAGGGTCCTAGG - Intergenic
1099995943 12:89778626-89778648 AGTACTTGCTTTAGGGTCCTAGG - Intergenic
1102278669 12:111601094-111601116 AGCATGGGCATGAGGATCCTGGG + Intergenic
1103139501 12:118536228-118536250 TGCAGAGGCTTGAGGGTCATGGG + Intergenic
1103828282 12:123757751-123757773 AGCACGGGGTTGGGGGTGCGGGG + Intronic
1107761572 13:43685074-43685096 AGCACAGCCTTGGGGATCCTGGG - Intronic
1108899655 13:55385205-55385227 AGCACTGGGGTGTGGGTCCTAGG + Intergenic
1113324938 13:109271830-109271852 AGCAAGGGCATGGGAGTCCTGGG + Intergenic
1117336243 14:54759415-54759437 AGCGTGGGCATGAGGATCCTGGG - Intronic
1121019418 14:90570039-90570061 AGCCTGTGCTTGAGGGCCCTTGG - Intronic
1121669291 14:95695561-95695583 AGCAAGGGCGTGAGAGTCCCCGG + Intergenic
1122415683 14:101548521-101548543 AGCACGGGCTGGTGGGTGCAGGG + Intergenic
1123134878 14:106018324-106018346 ATCACAGGCCTGAGGGCCCTGGG - Intergenic
1123136037 14:106027880-106027902 ATCACAGGCCTGAGGGCCCTGGG - Intergenic
1126919430 15:53504477-53504499 AACACGGGGCTGAGGTTCCTGGG + Intergenic
1128603556 15:69017525-69017547 AGCAGGGGCTTCCGGGTCGTAGG - Intronic
1129480451 15:75821073-75821095 AGCACCAGCTTTAGAGTCCTAGG - Intergenic
1129666093 15:77580149-77580171 AGCAGGGACTTGGGGGTGCTAGG - Intergenic
1131462587 15:92629078-92629100 AGCACAGCCTTGGCGGTCCTTGG - Intronic
1133275184 16:4634082-4634104 AGCACTAGCTTCAGAGTCCTGGG + Intronic
1133767776 16:8849748-8849770 AGGAGGGGCTCGAGGGGCCTGGG - Intergenic
1135949170 16:26896927-26896949 AGCAAGGGGATCAGGGTCCTGGG - Intergenic
1136283609 16:29228809-29228831 AGCAGGGGCCTGAGGGACGTGGG + Intergenic
1139365026 16:66427630-66427652 AGCCCGGGGTCGAGGGTCCGCGG - Intronic
1139513200 16:67438892-67438914 AGCACAAGCATGAGGGTTCTGGG + Intronic
1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG + Intronic
1140899145 16:79352099-79352121 GGCACCTGCTTGAGGGACCTGGG + Intergenic
1142088642 16:88198320-88198342 AGCAGGGGCCTGAGGGACGTGGG + Intergenic
1142207455 16:88790944-88790966 AGGAGGGGGTTGAGGCTCCTGGG - Intergenic
1142560209 17:805130-805152 AGCACGGGCTTGGGGTGCCAGGG + Exonic
1143532386 17:7512889-7512911 TGTAGGGGCTTGAGGGACCTGGG - Exonic
1147890276 17:43712023-43712045 ACCAAGGGCTTTTGGGTCCTAGG + Intergenic
1148703729 17:49609414-49609436 AGCCAGGTCTTGAGGGTCCTCGG + Intronic
1151800054 17:76373725-76373747 AGCACGCTCTTCAGCGTCCTGGG + Intronic
1152018970 17:77770628-77770650 ACCATGGGCTTGAGAATCCTGGG - Intergenic
1153121433 18:1732177-1732199 AGCAAGGGCATGGGAGTCCTCGG + Intergenic
1157754882 18:50208935-50208957 ATCACAGGCTTGAGGGTTATAGG - Intergenic
1158482315 18:57832703-57832725 AGCAAGGGCATGGGAGTCCTTGG - Intergenic
1159483529 18:69022957-69022979 AGCACGGATTTTAGGATCCTTGG - Intronic
1160799186 19:959958-959980 GGCAGCGGCTTGAGGGTCCTAGG + Intronic
1161210651 19:3063496-3063518 AGCAAGGACTTGTGGGTCTTGGG + Intergenic
1161605852 19:5214525-5214547 GGCAGGGGCTTGAGGGCCGTGGG + Intronic
1161830720 19:6602228-6602250 AGCAAGGGCATGGGAGTCCTCGG + Intronic
1161983676 19:7643079-7643101 AGCATGGGGTTGAGGGGCCGAGG - Intronic
1162391625 19:10393501-10393523 AGCTGTGGCTGGAGGGTCCTGGG - Intronic
1163018023 19:14468631-14468653 AGCATGGGCTTGGAGATCCTGGG + Intronic
1163235991 19:16031088-16031110 AGCTCAGCCTCGAGGGTCCTGGG + Intergenic
1163676070 19:18655935-18655957 AGCCCGGCCTTGAGGGCACTGGG + Intronic
1164932588 19:32186886-32186908 GGCAAGGGCTTGAGGGGCATTGG - Intergenic
1166044830 19:40223690-40223712 AGCACGGGCTTGAGGGTCCTGGG + Intronic
1166661752 19:44651770-44651792 AGCACTGGTTAGAGAGTCCTGGG - Intronic
1167095398 19:47372696-47372718 GACACGGGGTTGAGGCTCCTGGG - Intronic
1167246035 19:48373762-48373784 AGCTCTGGGTTGGGGGTCCTGGG - Intronic
1167730135 19:51248014-51248036 AGCAAGGGCATGGGAGTCCTTGG + Intronic
1168368671 19:55812715-55812737 AGAAAGAGCTTCAGGGTCCTAGG - Intronic
926795220 2:16613372-16613394 AGCAGGGGAATGAGTGTCCTTGG - Intronic
927990031 2:27441515-27441537 AGTACGGGACTGAGGGACCTGGG - Intronic
932438431 2:71716862-71716884 GGGAGGGGCTTGAGGGGCCTCGG - Intergenic
933369617 2:81398393-81398415 AGCAAGGGCATGAGAGTCCTTGG + Intergenic
933996939 2:87677076-87677098 AGCAGGTGCTCCAGGGTCCTGGG + Intergenic
936296911 2:111273834-111273856 AGCAGGTGCTCCAGGGTCCTGGG - Intergenic
937547174 2:123036505-123036527 TGCACAGACTTGAGGGCCCTGGG + Intergenic
938073536 2:128320304-128320326 AGCAGGGGCTTTGGGGCCCTAGG - Intergenic
938259674 2:129886504-129886526 AGCAAGGGCTTCCGGGTCATAGG + Intergenic
945711812 2:213306576-213306598 ACCACGGGCTAAAGGGTTCTGGG - Intronic
947529239 2:230898369-230898391 TGGAAGGGCTTGAGGGTCCAGGG - Intergenic
948231155 2:236350655-236350677 TGCAAGGGCTTGTGGGTGCTGGG - Intronic
948441780 2:237996353-237996375 AGCATGGGCTTTGTGGTCCTTGG + Intronic
948753049 2:240143521-240143543 TTCACGCGCTTGAGGGACCTGGG + Intronic
1170567594 20:17615745-17615767 AGCACAGGCTGGAGGCACCTTGG - Intronic
1172506875 20:35469502-35469524 ACCTCGGGCTGGAGGGACCTTGG + Intronic
1176171409 20:63697997-63698019 GGCAAGGGCTTGGGGCTCCTGGG - Intronic
1180209483 21:46286159-46286181 AGCGCGGGCCTCGGGGTCCTGGG - Exonic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1181026530 22:20130834-20130856 GGCACAGGCATGAGGCTCCTTGG - Intronic
1181532239 22:23523205-23523227 AGCAGGGGCTTGAGGGTGGGGGG - Intergenic
1182879749 22:33723316-33723338 AGCACAGCCTTCAGGGTCCAGGG + Intronic
1183393808 22:37560594-37560616 AGCCCGGGCGCGCGGGTCCTCGG + Intronic
1184639009 22:45859083-45859105 AGCACGGTTTTGAGGGGCCCGGG - Intergenic
1185243113 22:49756906-49756928 ACCACGGGCTTGTGGTTCATGGG - Intergenic
954146853 3:48638793-48638815 AGCAGGGGTTTGGGGATCCTGGG - Intronic
954785568 3:53089972-53089994 AGCATGAGCATGATGGTCCTGGG + Exonic
954841948 3:53519176-53519198 TGCTAGGGTTTGAGGGTCCTTGG + Intronic
957523346 3:81349447-81349469 ATCACAAGCCTGAGGGTCCTTGG + Intergenic
959280034 3:104325657-104325679 AGCAAGGGCATGGGAGTCCTTGG + Intergenic
967474818 3:189904304-189904326 ATAAGGGGCTTGAGGGGCCTAGG - Intergenic
968431108 4:559683-559705 AGCAAGGGCATGGGAGTCCTTGG - Intergenic
972149942 4:36076992-36077014 AGCAAGGGCATGGGAGTCCTTGG + Intronic
985967062 5:3345471-3345493 AGCTCGGGCCTGAGGGGCCTCGG - Intergenic
994458223 5:100041777-100041799 AGCAGGGAGTTGAGGGTCTTAGG + Intergenic
994835304 5:104844198-104844220 AGCAGGGGCTTACGGGTCATAGG - Intergenic
995832928 5:116373586-116373608 AGCATGGGTTTTAGGATCCTTGG + Intronic
997370819 5:133358512-133358534 AGCACGGGCTTCAGGGCCTGGGG - Intronic
1000112277 5:158120412-158120434 AGTTCGGGCTTCAGGGTTCTGGG - Intergenic
1000220222 5:159208422-159208444 TTCACGGGTCTGAGGGTCCTTGG + Intronic
1002107327 5:176886664-176886686 AGCAGGGGCTTGAGGTCGCTTGG - Intronic
1002560959 5:180081952-180081974 GGCAGGAGTTTGAGGGTCCTGGG - Intergenic
1003891856 6:10570762-10570784 AGCAAGGACTTCAGGGTCTTGGG - Intronic
1006088188 6:31611867-31611889 AGCACTGGCTAGAGGGTCTTTGG - Intergenic
1006190123 6:32202364-32202386 ACCACGGGCTTGGGGGGCCCAGG - Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1009215468 6:60914752-60914774 AGCAAGGGCATGGGAGTCCTCGG - Intergenic
1013601424 6:111708676-111708698 AGCACTGGCCTGAGGCTCATGGG + Intronic
1015224247 6:130838408-130838430 AGAACAGGGTTTAGGGTCCTGGG - Intergenic
1016437771 6:144055520-144055542 ATCACAGGCTTGAGGGTAGTTGG - Intronic
1016461805 6:144286056-144286078 AGCTCGGGCGTGGAGGTCCTTGG + Intronic
1018618912 6:165712100-165712122 GGCACGGGCTGGAGGGTTCTGGG + Intronic
1018923650 6:168192471-168192493 AGCACGGTCTTTAGAGACCTGGG - Intergenic
1019060118 6:169251556-169251578 AGCATGAGCCTGAGGGTCCCAGG + Intronic
1019078767 6:169412946-169412968 AGCACAGGCTGCATGGTCCTGGG + Intergenic
1019299656 7:296704-296726 AGCAAGGTTTTGAGGGTCTTTGG + Intergenic
1021788039 7:24172311-24172333 AGCACGGGCTTACAGGTCATAGG - Intergenic
1022339124 7:29451996-29452018 AGCAGGGTCCTTAGGGTCCTGGG + Intronic
1024532794 7:50407218-50407240 AGAATGGGCTTGAGGGGCCTGGG - Intergenic
1024543296 7:50496839-50496861 AGCAGAAGCTTGAGGGACCTGGG + Intronic
1027186976 7:75978495-75978517 AGCAGGGACTTGAGCATCCTTGG + Intronic
1029664719 7:101987693-101987715 GGCACGTGCCTGAGGGCCCTTGG + Intronic
1037414165 8:18630946-18630968 ATCAGGGACTTGAGTGTCCTTGG + Intronic
1038883376 8:31639127-31639149 ACCCCGGGCGTGCGGGTCCTCGG - Intergenic
1042735007 8:71978223-71978245 AGCACAGGCCAGAGGGGCCTAGG - Intronic
1048914918 8:139173364-139173386 AGCACGGGCTTATGGGTTCATGG - Intergenic
1056615282 9:88160238-88160260 AGCAGGGGCTGGAGGGAGCTGGG - Intergenic
1057845939 9:98523620-98523642 AGGAGGGGCTTGAGGATGCTAGG + Intronic
1059298656 9:113295494-113295516 ATCAGGGGCTTGAGCATCCTCGG + Intergenic
1060213357 9:121723835-121723857 AGCACTGGCTTAAGGCACCTTGG + Intronic
1060458656 9:123826484-123826506 AGCAGTGGCTTGAGGGGCATGGG - Intronic
1061579986 9:131530820-131530842 AGCACGGACTTGGGGCTCCGAGG + Intronic
1062014708 9:134285223-134285245 ACCCCAGGCTGGAGGGTCCTGGG - Intergenic
1062368337 9:136222837-136222859 AGCAAGGGCACGAGGGGCCTTGG + Intronic
1186712836 X:12218371-12218393 AGCATGGGCTTGGGGGTGGTAGG + Intronic
1187039693 X:15580504-15580526 AGCACAGGCTTCAGAATCCTAGG - Intronic
1187258036 X:17659058-17659080 AGCAGGGGCTTCAAGGCCCTAGG - Intronic
1187328291 X:18312326-18312348 ATCAGGGACTTGAGTGTCCTTGG - Intronic
1189693464 X:43639864-43639886 AGCAGGAGCTTAAGGGTACTTGG + Intergenic
1190303121 X:49067727-49067749 GGCACGGGTGTGGGGGTCCTTGG - Exonic
1193325663 X:80176559-80176581 AGTAGGGGCATGAGTGTCCTAGG - Intergenic
1195566557 X:106345833-106345855 AGCACGGGCTTCAAGGTCATAGG + Intergenic
1198227031 X:134654590-134654612 AGCAAGTGCATGAGGGGCCTGGG - Intronic
1200015743 X:153161496-153161518 AGCCTGAGCTTGTGGGTCCTTGG + Intergenic