ID: 1166046142

View in Genome Browser
Species Human (GRCh38)
Location 19:40232236-40232258
Sequence CGGCTAGTACAGGAGGAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 87}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166046132_1166046142 9 Left 1166046132 19:40232204-40232226 CCTGAGCTCAGTGCCCTCCTTGC 0: 1
1: 0
2: 1
3: 43
4: 346
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1166046129_1166046142 16 Left 1166046129 19:40232197-40232219 CCCTCACCCTGAGCTCAGTGCCC 0: 1
1: 0
2: 1
3: 34
4: 348
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1166046130_1166046142 15 Left 1166046130 19:40232198-40232220 CCTCACCCTGAGCTCAGTGCCCT 0: 1
1: 0
2: 4
3: 53
4: 454
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1166046136_1166046142 -4 Left 1166046136 19:40232217-40232239 CCCTCCTTGCTGAAGGGAACGGC 0: 1
1: 0
2: 1
3: 8
4: 72
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1166046137_1166046142 -5 Left 1166046137 19:40232218-40232240 CCTCCTTGCTGAAGGGAACGGCT 0: 1
1: 0
2: 1
3: 9
4: 80
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1166046127_1166046142 24 Left 1166046127 19:40232189-40232211 CCCAGCTGCCCTCACCCTGAGCT 0: 1
1: 1
2: 3
3: 41
4: 412
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1166046126_1166046142 25 Left 1166046126 19:40232188-40232210 CCCCAGCTGCCCTCACCCTGAGC 0: 1
1: 0
2: 9
3: 55
4: 606
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1166046138_1166046142 -8 Left 1166046138 19:40232221-40232243 CCTTGCTGAAGGGAACGGCTAGT 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1166046131_1166046142 10 Left 1166046131 19:40232203-40232225 CCCTGAGCTCAGTGCCCTCCTTG 0: 1
1: 0
2: 5
3: 46
4: 374
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87
1166046128_1166046142 23 Left 1166046128 19:40232190-40232212 CCAGCTGCCCTCACCCTGAGCTC 0: 1
1: 1
2: 11
3: 63
4: 490
Right 1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166046142 Original CRISPR CGGCTAGTACAGGAGGAGCT GGG Exonic
900543054 1:3213648-3213670 GGGTAAGAACAGGAGGAGCTTGG - Intronic
900694996 1:4004290-4004312 CGGCCAGTGCAGAAGGTGCTTGG - Intergenic
903622047 1:24704917-24704939 CGGCTAGTTCAGAAGGAGAAAGG - Intergenic
904756483 1:32771222-32771244 CGGCTAGAGCAGGGGCAGCTGGG - Exonic
907199058 1:52710441-52710463 TGGCTAGTAAATGTGGAGCTGGG + Intergenic
911632494 1:100199089-100199111 CAGCTGGTAGAGGGGGAGCTTGG + Intronic
912380695 1:109246678-109246700 CAGCTAGTAATGGAAGAGCTAGG - Intergenic
912550361 1:110481503-110481525 TGGCTAGTAATGGAGGAGCTAGG + Intergenic
913418130 1:118635229-118635251 TGGCTTGTACTGGAGGATCTGGG - Intergenic
914705130 1:150163893-150163915 CTGATAGTTCAGGAGGAGTTGGG - Intronic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
920335870 1:205244779-205244801 CGGCTAGCAGAGAAGGAGGTGGG + Intronic
920735404 1:208528866-208528888 AGGCAAGTACATGAGGAGATTGG + Intergenic
1063388414 10:5631989-5632011 AGGAAATTACAGGAGGAGCTTGG - Intergenic
1065721418 10:28631587-28631609 CAGCTGGCACAGGAGGACCTGGG + Intergenic
1067228694 10:44392006-44392028 TGGGTTGTAAAGGAGGAGCTGGG + Intergenic
1069951091 10:72018679-72018701 AGGATAGGACAGGAGGATCTAGG - Intergenic
1075736381 10:124666945-124666967 CAGCTGGTAAAGGAGGGGCTGGG - Intronic
1083334503 11:61914843-61914865 ATCCTAGAACAGGAGGAGCTGGG - Intronic
1091796409 12:3299791-3299813 GGGGGAGGACAGGAGGAGCTAGG + Intergenic
1095449838 12:42318687-42318709 GGGCAGGTACAAGAGGAGCTTGG + Intronic
1100639149 12:96464711-96464733 TAGCTAGTACTGGTGGAGCTGGG + Intergenic
1100842377 12:98626369-98626391 CTGCGAGTAGAGGAGCAGCTAGG - Exonic
1113259860 13:108549780-108549802 CTTCTAGTGCAGGAGGAGCTGGG - Intergenic
1115013833 14:28585626-28585648 GGGCTAGGGCAGGAGGAGATGGG + Intergenic
1116918597 14:50549069-50549091 CAGCTTCTACAGGAGGTGCTTGG + Intronic
1118850355 14:69578279-69578301 AAGCTAGTACAGGTGGGGCTGGG + Intergenic
1121224465 14:92311127-92311149 CATTTAGTACAGGAGGGGCTTGG + Intergenic
1126540381 15:49816173-49816195 TGGCTAATCCAGGAGGAGCCAGG + Intergenic
1128566274 15:68702202-68702224 CAGCTAGGAAAGGAGGAGCTGGG - Intronic
1129468513 15:75737753-75737775 GGGCTAGGACAGAAGCAGCTGGG - Intergenic
1129727068 15:77906754-77906776 GGGCTAGGACAGAAGCAGCTGGG + Intergenic
1130006875 15:80107992-80108014 CAGCTAGTAAGTGAGGAGCTGGG - Intronic
1132703350 16:1231167-1231189 CGACTAGTCCATGGGGAGCTGGG - Intergenic
1133564896 16:6984267-6984289 CAGGTAGTACAGGAGGATCCAGG - Intronic
1137030773 16:35522205-35522227 TGGCTCATACTGGAGGAGCTGGG - Intergenic
1137841912 16:51648822-51648844 CAGCAAGTAAAGGAGGAGCTTGG - Intergenic
1142108960 16:88321135-88321157 CAGCCTGGACAGGAGGAGCTTGG - Intergenic
1142720648 17:1773567-1773589 CAGCTAGTACAGGCAGAGCTGGG - Intronic
1145275824 17:21429648-21429670 GGGCGAGCACAGGAGGAGCCAGG - Intergenic
1145313669 17:21715557-21715579 GGGCGAGCACAGGAGGAGCCAGG - Intergenic
1145712107 17:26987534-26987556 GGGCGAGCACAGGAGGAGCCAGG - Intergenic
1145874486 17:28306901-28306923 CGGCCCGGGCAGGAGGAGCTTGG - Intergenic
1146503178 17:33381783-33381805 CGGCTAGTAATGGAGGAGTTGGG - Intronic
1148339758 17:46866320-46866342 CGGAGAGCACAGGAGGGGCTAGG + Intronic
1148649130 17:49237103-49237125 CAGGAAGTACAGGAGGAGCTGGG + Intergenic
1151531822 17:74711483-74711505 AGGCTGGTACAGGAAGAGCAGGG - Intronic
1151986735 17:77548571-77548593 CGGCCAGGAGAGGAGGAGCTGGG - Intergenic
1153691607 18:7600118-7600140 CAGCTAGACCAGGAGGAGCTAGG - Intronic
1154274076 18:12944853-12944875 CTGCTAGTACTGCTGGAGCTAGG - Intergenic
1156027771 18:32675259-32675281 AGGCTAGGACAGGAGGATCGTGG + Intronic
1157825151 18:50805686-50805708 CGGATGGTAAAGGAGGAGGTGGG + Intronic
1160159607 18:76461244-76461266 CGGAGTGTCCAGGAGGAGCTTGG - Intronic
1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG + Exonic
1168297114 19:55382874-55382896 GGCCTAGGAAAGGAGGAGCTGGG - Intronic
1168576520 19:57516140-57516162 TGGCTCGTACTGGAGGAGCTGGG - Intronic
932064781 2:68543170-68543192 CGGGGAGGACAGGAGGAGCTGGG + Intronic
938015818 2:127866382-127866404 CAGCTAGTACATGTTGAGCTGGG + Intronic
939007432 2:136805693-136805715 TGGCTAGTAGGGGAGGGGCTGGG + Intronic
941932160 2:170953053-170953075 AGACTGGTAAAGGAGGAGCTAGG + Intronic
942906405 2:181185966-181185988 TTTCTAGTTCAGGAGGAGCTTGG - Intergenic
944860240 2:203809444-203809466 AGAATAGTACAGGAGGAGGTTGG - Intergenic
947931741 2:233970371-233970393 CAGCGAGTACAGGACCAGCTCGG - Exonic
948802887 2:240440810-240440832 CGGCACGGCCAGGAGGAGCTGGG - Intronic
1171092196 20:22295916-22295938 CAGCTAGCAGAGGTGGAGCTGGG + Intergenic
1171981601 20:31632894-31632916 GGTCTAGTACAGGAGGAGCGGGG - Intergenic
1178445864 21:32641221-32641243 AGGCTAGTCCAGTAGGAGCTGGG - Intronic
1179482397 21:41686452-41686474 CGGGTAGTGCAGGAGGGGCTGGG + Intergenic
1179911445 21:44451154-44451176 CGGCTGGCACAGGAGAAGCCGGG + Intergenic
1183492064 22:38122086-38122108 CAGCCAGTCCAGGAGGTGCTGGG - Intronic
1183698734 22:39437931-39437953 CTGCCAGCACAGGAGGAGCCTGG - Intergenic
950118344 3:10465455-10465477 AGGATGGTACTGGAGGAGCTGGG - Intronic
950971471 3:17192935-17192957 CTGCTAGTACAGGAGGATGTGGG - Intronic
954111622 3:48436763-48436785 CAGCTAGTAGAGGAGGTGCTGGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
966866631 3:184261805-184261827 AGCCTGGTACTGGAGGAGCTTGG + Intronic
970192759 4:13531036-13531058 CGGCTATTTCCGGTGGAGCTGGG - Intergenic
981573988 4:146184379-146184401 CACCTAGTAGAGGAGGAGCTAGG + Intronic
982127804 4:152199526-152199548 CTGCTAGTAAGGGTGGAGCTGGG - Intergenic
988350968 5:30106718-30106740 GAGCAGGTACAGGAGGAGCTGGG - Intergenic
988897641 5:35695016-35695038 ATGATAGCACAGGAGGAGCTCGG - Intronic
990559795 5:56972506-56972528 CAGCGAGTTCAGGAGGAGCTGGG + Intergenic
991958020 5:72015047-72015069 AGGCAAAGACAGGAGGAGCTAGG - Intergenic
997872511 5:137517617-137517639 AGGCGAGTTCAGGAGGGGCTGGG + Intronic
999618200 5:153447800-153447822 GGGCCGGGACAGGAGGAGCTTGG - Intergenic
1006181929 6:32158864-32158886 TGGCTAGTGCACAAGGAGCTGGG + Intronic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1012366493 6:98447080-98447102 CGTGTAGTAGAGGAGGAGGTTGG - Intergenic
1013101660 6:106992277-106992299 GGGGTGGTACAGGAAGAGCTGGG - Intergenic
1015306161 6:131710959-131710981 GGGCTGGTCCTGGAGGAGCTAGG - Exonic
1019729503 7:2622518-2622540 CAGCTGGGGCAGGAGGAGCTGGG - Intergenic
1019824397 7:3271806-3271828 CAGCTAGTAAAGGCGGAACTAGG + Intergenic
1027233147 7:76283280-76283302 GGGCTAGAACTGGAGGTGCTGGG + Intronic
1032093224 7:128922614-128922636 GGGCTGCTACAGGGGGAGCTTGG - Intergenic
1036068696 8:5415228-5415250 CTGTGAGCACAGGAGGAGCTGGG + Intergenic
1037443125 8:18937762-18937784 AGGCTAGTAAAAGAGGAACTCGG + Intronic
1047268467 8:123331054-123331076 CTGGGATTACAGGAGGAGCTGGG + Intronic
1047923407 8:129657899-129657921 CAGCTGGAACAGGAGCAGCTGGG + Intergenic
1049706503 8:144045606-144045628 CGGAAACTGCAGGAGGAGCTTGG + Intronic
1051720358 9:20030398-20030420 ATGGTTGTACAGGAGGAGCTCGG - Intergenic
1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG + Intronic
1057631276 9:96720746-96720768 CTGCCAGTGCAGGAGGAGCTAGG - Intergenic
1060540936 9:124429601-124429623 GGGCTGGCACTGGAGGAGCTGGG + Intergenic
1061061288 9:128251561-128251583 GGGCTAGGACAGGAGCAGCTGGG + Intronic
1187016219 X:15331907-15331929 TGGCCTGTAGAGGAGGAGCTGGG - Exonic
1198612964 X:138422321-138422343 AAGCAAGTACAGGAGGATCTTGG + Intergenic
1202368425 Y:24182206-24182228 CAGCTAGGACAGAAGCAGCTGGG - Intergenic
1202502360 Y:25487911-25487933 CAGCTAGGACAGAAGCAGCTGGG + Intergenic