ID: 1166046390

View in Genome Browser
Species Human (GRCh38)
Location 19:40233227-40233249
Sequence GAACCAGGAGTGGCCGGGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 429}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166046390_1166046403 18 Left 1166046390 19:40233227-40233249 CCCAGCCCGGCCACTCCTGGTTC 0: 1
1: 0
2: 1
3: 36
4: 429
Right 1166046403 19:40233268-40233290 GGATCTGACTCCATTCACCAGGG 0: 1
1: 0
2: 0
3: 7
4: 155
1166046390_1166046402 17 Left 1166046390 19:40233227-40233249 CCCAGCCCGGCCACTCCTGGTTC 0: 1
1: 0
2: 1
3: 36
4: 429
Right 1166046402 19:40233267-40233289 AGGATCTGACTCCATTCACCAGG 0: 1
1: 0
2: 1
3: 41
4: 597
1166046390_1166046397 -3 Left 1166046390 19:40233227-40233249 CCCAGCCCGGCCACTCCTGGTTC 0: 1
1: 0
2: 1
3: 36
4: 429
Right 1166046397 19:40233247-40233269 TTCCCCATGGTACAGATCCTAGG 0: 1
1: 0
2: 0
3: 18
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166046390 Original CRISPR GAACCAGGAGTGGCCGGGCT GGG (reversed) Exonic
900164548 1:1239530-1239552 GAGCCAGGGGAGGCAGGGCTGGG - Intergenic
900530244 1:3149468-3149490 CAGCCAGGAGTGGCAGGGCAGGG - Intronic
901066221 1:6495983-6496005 GATCCTGGAGTGCCAGGGCTTGG - Intronic
901476798 1:9495383-9495405 GCACGAGGAGTGGCCGCTCTGGG - Intergenic
901802854 1:11719192-11719214 GTACCAAGAGAGGCCGGGCACGG - Intronic
901822663 1:11840227-11840249 GCACCAGGAGAGGGTGGGCTGGG - Exonic
902031081 1:13422660-13422682 GAGCCAGCAGGGGACGGGCTGGG + Intergenic
902785024 1:18727747-18727769 GAACCAGGAGTCAGGGGGCTGGG + Intronic
903218078 1:21854165-21854187 GAGCCAGGTGTGGCTGGGCCGGG - Intronic
903270976 1:22188073-22188095 AACCCAGGAGAGGCCGGGCATGG - Intergenic
903645909 1:24896443-24896465 GAACCAGGTGTCGCTGAGCTGGG - Intergenic
903758992 1:25684705-25684727 GCACCAGGAGTGGCCGAGCATGG + Intronic
904404207 1:30275432-30275454 GTACCAGGGGTGGTCTGGCTGGG - Intergenic
904565482 1:31425858-31425880 GAACCAGCGGTGGCTGGGCAAGG + Exonic
904906484 1:33900967-33900989 GATCCTGGAGTGGCTGGCCTAGG + Intronic
904917803 1:33982917-33982939 GAACAAGGGATGGCAGGGCTAGG + Intronic
905172095 1:36115378-36115400 GCAGCAGGAGGGGCTGGGCTGGG + Intronic
905205904 1:36342753-36342775 GGACCAGGAGGGGCCGTGCCTGG - Intronic
905259196 1:36705708-36705730 GAACAAAGAGTGGCCTGGTTTGG - Intergenic
905304817 1:37010192-37010214 GAGCAAGGAGTGGCCCGGCTTGG - Intronic
905449272 1:38046563-38046585 GCACCACGAGTGGCTGGGCGCGG - Exonic
905498465 1:38416354-38416376 GATCCGGGACTGGCAGGGCTTGG + Intergenic
905812692 1:40924415-40924437 GAAACAGGAGTGGCCGGTGAAGG + Intergenic
905821080 1:40991981-40992003 GAACCAGGAGAGGCAGGGAATGG - Intronic
906511006 1:46410504-46410526 GCACAAGGAGTGGAGGGGCTAGG + Intronic
906915264 1:50002657-50002679 GAACTAGGGCTGGCCGGGCGCGG - Intronic
906945446 1:50290665-50290687 GAAGGAGGAGTGCCCAGGCTTGG + Intergenic
907640856 1:56188990-56189012 GAACAAGGAGGGTCAGGGCTGGG - Intergenic
910472624 1:87571632-87571654 TATCCAGGCGTGGCCGGGCACGG - Intergenic
912659683 1:111516373-111516395 AAATCAGCAGAGGCCGGGCTTGG + Intronic
912762958 1:112385429-112385451 GAAACAGGAGTGGCCGGGCACGG + Intergenic
912969820 1:114270198-114270220 GAACTGTGAGTGGCAGGGCTTGG + Intergenic
915143428 1:153780510-153780532 GAATCAGGTGTGGCCGGGCCTGG + Intergenic
915221946 1:154381739-154381761 GAAACAGCAGTGGCCAGGCACGG - Intergenic
916040659 1:160958473-160958495 TATCCAGAATTGGCCGGGCTTGG - Intergenic
917268794 1:173250747-173250769 GAAACTGGAGAGGCCGGGCGCGG - Intergenic
917763896 1:178197165-178197187 TAGCCAGGTGTGGCCGGGCGTGG + Intronic
919795600 1:201319750-201319772 GATCTGGGGGTGGCCGGGCTGGG - Intronic
920299941 1:204982530-204982552 GCACCAGGAGGGGCTGGTCTGGG - Intronic
921966568 1:221096726-221096748 GAACCAGGAAGGGCCGGGGACGG - Intergenic
922225472 1:223642420-223642442 GAACCAGGAGTGGAGGTGCCGGG - Intronic
922695333 1:227728478-227728500 GAGCCAGGTGGGGCGGGGCTGGG - Intergenic
923338958 1:232991802-232991824 GATCCAGGTGTGGGCAGGCTTGG - Intronic
923686643 1:236158078-236158100 GCACCAGGAGGGGGCAGGCTGGG + Intronic
924861543 1:247928802-247928824 GAAACAGGATGGGCCGGGCGCGG + Intergenic
1062989757 10:1804442-1804464 GAAACAGAAGTGGCCCGGCCTGG - Intergenic
1063132019 10:3186188-3186210 GAAACAGGATAGGCCGGGCGCGG - Intergenic
1064748517 10:18502016-18502038 GAACAAAGATTGGCCGGGCATGG + Intronic
1065673759 10:28152227-28152249 AATCCAGGAGTGGGCAGGCTAGG - Intronic
1067479291 10:46584862-46584884 GAAACAGGAGGGGCAGGGCCTGG - Intronic
1067494724 10:46751440-46751462 TAACCAGGAGTGGCAGTGCATGG + Intergenic
1067599931 10:47588957-47588979 TAACCAGGAGTGGCAGTGCATGG - Intergenic
1067615448 10:47756939-47756961 GAAACAGGAGGGGCAGGGCCTGG + Intergenic
1072439497 10:95441292-95441314 GAACCAGGAGTCACCTGGCCAGG + Intronic
1072703379 10:97661279-97661301 AATCCAGCAGTGGCCGGGCGCGG - Intronic
1072703594 10:97663533-97663555 GAAACAGGGTTGGCCGGGCATGG + Intronic
1073558743 10:104479490-104479512 AAACCAGGAGTGGGTGGGCAGGG + Intergenic
1074281216 10:112053370-112053392 GGGACAGGAGTGGCCGGGCACGG - Intergenic
1074312039 10:112330318-112330340 GGACCGGGAGGGGCCTGGCTGGG + Intergenic
1075792489 10:125094989-125095011 GAAGCAAGTGTGGCAGGGCTGGG + Intronic
1076772889 10:132676734-132676756 GAAACAGGAGGGGCCGGTCAGGG - Intronic
1077008383 11:369555-369577 GAGCCGGGAGCGGCCGGGCGGGG + Intergenic
1077425185 11:2472773-2472795 CAAGCTGGAGTGGCAGGGCTGGG - Intronic
1077527641 11:3077158-3077180 GGCCCAGCAGTGGCCAGGCTGGG - Intergenic
1077576440 11:3387143-3387165 GAGCCAGGGGGGGCCGGGCGCGG + Intergenic
1078417042 11:11174425-11174447 AAATCAGGAGTGGCCGGGCAGGG - Intergenic
1080280026 11:30546108-30546130 GAATCAGTTGTGGCCGGGCACGG - Intronic
1080419285 11:32095696-32095718 TAGCCAGGAATGGCCGGGCATGG - Intronic
1083284151 11:61647150-61647172 AAACCAGGAGTGGCCGGGTGCGG + Intergenic
1083816913 11:65138110-65138132 TAGCCAGGCGTGGCCGGGCGTGG + Intergenic
1083920358 11:65778989-65779011 GAGCCAGCATGGGCCGGGCTTGG + Exonic
1084701297 11:70787846-70787868 GAAGCAGGGGTGGCCGGCCCAGG - Intronic
1084744018 11:71156110-71156132 GATCAAGGTGTGGCAGGGCTGGG - Intronic
1085369701 11:75989337-75989359 GTTCCAGAAGTGGCCGGGCATGG - Intronic
1085611347 11:77953220-77953242 TCACCAAGAGTGGCAGGGCTGGG + Intronic
1085788682 11:79477012-79477034 GAAGAAAGAGTGGCCGGGCAGGG - Intergenic
1086262062 11:84952253-84952275 AAACCAGAACTGGCCGGGCGCGG + Intronic
1086382551 11:86272346-86272368 AAACCAACAGTGGCCGGGCGCGG - Intronic
1087763218 11:102123915-102123937 GAAAATGGAGTGGCCGGGCATGG - Intronic
1088806577 11:113358469-113358491 CAAGCAGGTGTGGCCTGGCTGGG + Intronic
1089393521 11:118118115-118118137 GCACCAAGTGTGGCCGAGCTAGG - Exonic
1089615593 11:119693000-119693022 GAAGGAGGAGTGGCAGGGGTGGG - Intronic
1090086352 11:123654268-123654290 GAAGCAGGAGCCGCGGGGCTGGG - Exonic
1090832852 11:130431123-130431145 GAAGCAGCAGTGGCCAGGCTCGG - Intergenic
1091299505 11:134498456-134498478 GAAGCCGGAGTGGGCTGGCTGGG + Intergenic
1092103355 12:5903589-5903611 GAACCAAGAGTGGCAGAGCTGGG - Intronic
1092139898 12:6176473-6176495 TAGCCAGGTGTGGCCGGGCGCGG + Intergenic
1092505430 12:9093768-9093790 AAGCCAGGAGAGGCCGGGCGCGG + Intronic
1092943014 12:13427973-13427995 GAATCAGGATTGGCGGGGTTAGG + Intergenic
1094370950 12:29737226-29737248 AAAACAGGGGTGGCCGGGCATGG + Intronic
1097191965 12:57223794-57223816 GAGGCAGGAGCGGCCGGGCCAGG - Intronic
1097311786 12:58127054-58127076 TATCCAGGATTGGCTGGGCTTGG + Intergenic
1101429553 12:104615634-104615656 GAATAAGAATTGGCCGGGCTCGG + Intronic
1101986454 12:109451097-109451119 GAACCAGGAGTGGACCTGCTGGG + Exonic
1103088215 12:118078447-118078469 CAACCAGCAGTGGCTGGGCGTGG - Intronic
1103096083 12:118133515-118133537 TAGCCAGGCGTGGCCGGGCGCGG - Intronic
1103609678 12:122115295-122115317 AAACCAGTAGTGGCTGGGCGCGG + Intronic
1103821966 12:123706044-123706066 GAAAGAGGAGGGGCCGGGCACGG - Intronic
1104941112 12:132395804-132395826 GAAACAGGAGTGGCACGGCAGGG + Intergenic
1104981688 12:132575835-132575857 GGACCAGGAGGGGCCGGCCCAGG + Intronic
1105540040 13:21308372-21308394 GAGCCAGGGGTGGGTGGGCTGGG + Intergenic
1105776626 13:23668027-23668049 CAACCAAGAGTCGCCGGGTTGGG - Exonic
1106028668 13:25978649-25978671 GACTCAGGAGAGGCCGGGCGCGG + Intronic
1106483182 13:30151949-30151971 AATTCAGGAGTGGCTGGGCTGGG + Intergenic
1107553001 13:41494448-41494470 GAACCAGAAGAGTCAGGGCTTGG + Intergenic
1108000915 13:45904924-45904946 CAACCAGGAGAGGCTGGTCTGGG - Intergenic
1108114035 13:47108560-47108582 GACCCAGATGTGGCCGGGCACGG - Intergenic
1113517563 13:110915087-110915109 GGGCCTGGAGCGGCCGGGCTGGG + Intergenic
1113555482 13:111230574-111230596 AAGCCAGGAGTGGCCTTGCTGGG + Intronic
1114059102 14:19002638-19002660 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
1114103441 14:19399116-19399138 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1114315630 14:21507367-21507389 AAACAAGGTGTGGCCGGGCGCGG + Intronic
1114472836 14:22975568-22975590 GACTCAGGACTGGCCGGGCGCGG + Intronic
1114961247 14:27892680-27892702 GAACCAGGTGGGGCAGGGCGTGG - Intergenic
1115689249 14:35826460-35826482 GAAGCGGCGGTGGCCGGGCTGGG + Exonic
1115754349 14:36518059-36518081 AAAACAGGGGTGGCCTGGCTCGG - Intronic
1115883413 14:37945629-37945651 TAAGCAGGTGTGGCCAGGCTGGG - Intronic
1116308727 14:43293234-43293256 GAACCAGGAGTGGGCCAGGTGGG + Intergenic
1116473846 14:45317287-45317309 GAATCAGGATTGGCCGGGGACGG - Intergenic
1120837270 14:89052256-89052278 GCTACAGTAGTGGCCGGGCTCGG + Intergenic
1122115664 14:99526125-99526147 GACCCAGGAGAGTCTGGGCTGGG - Intronic
1122647920 14:103207340-103207362 GTACCAGGACTGTCCGGGCAGGG - Intergenic
1202836547 14_GL000009v2_random:81423-81445 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1123496708 15:20833997-20834019 TAAGCAGGTGTGGCCTGGCTGGG + Intergenic
1123553943 15:21407589-21407611 TAAGCAGGTGTGGCCTGGCTGGG + Intergenic
1123590187 15:21844954-21844976 TAAGCAGGTGTGGCCTGGCTGGG + Intergenic
1124912833 15:33939129-33939151 GAAATAGGTGTGGCCGGGCGTGG - Intronic
1124931092 15:34120232-34120254 TAACAAAGAGTGGCCGGGCGCGG - Intergenic
1125595911 15:40886024-40886046 AGACCAGGAGTGGCCGGGCGCGG - Intergenic
1125847862 15:42874695-42874717 GTTCCAGAAGTGGCCGGGCGCGG + Intronic
1125850584 15:42899448-42899470 TAGCCAGGTGTGGCCGGGCACGG + Intronic
1126149266 15:45507776-45507798 GAACCAGGAGAAGCTGGGCATGG - Intronic
1126506172 15:49406676-49406698 GACCCAGCAGTGGCAGGGCAGGG + Intronic
1127106561 15:55622679-55622701 TAGCCAGGTGTGGCCGGGCGCGG - Intronic
1128114674 15:65097768-65097790 GAAGCAGGAGTGGGTGGGCAAGG + Intronic
1128668936 15:69559720-69559742 GCACCACGAGTGGCAGAGCTGGG + Intergenic
1128686307 15:69688499-69688521 AATCCAGGAGTGGCTTGGCTGGG - Intergenic
1129257564 15:74342725-74342747 GAGAGAGGAGTGGCCGGGCATGG - Intronic
1129268521 15:74407650-74407672 GCACCAGGAGAGGCTGGGCTGGG - Intergenic
1129402859 15:75294386-75294408 GCACCAGGAGTGGCCAGGGAGGG + Exonic
1129520546 15:76183404-76183426 GAAGAAGGATCGGCCGGGCTTGG - Intronic
1132044515 15:98552061-98552083 AAACCAGGAGAGGCCAGGCGCGG - Intergenic
1132399396 15:101496248-101496270 GTACACGAAGTGGCCGGGCTGGG + Intronic
1202962290 15_KI270727v1_random:134785-134807 TAAGCAGGTGTGGCCTGGCTGGG + Intergenic
1132660187 16:1057789-1057811 GAACCAGGTGTGGTGGAGCTGGG + Intergenic
1132946730 16:2535887-2535909 AATCCAGGAGAGGCCAGGCTGGG - Intergenic
1132968921 16:2675426-2675448 AATCCAGGAGAGGCTGGGCTGGG + Intergenic
1133184971 16:4089586-4089608 AACCCAGGAGTGGCATGGCTGGG + Intronic
1133228758 16:4356241-4356263 TAACCAGGTGTGGCCAGGCATGG - Intronic
1133893450 16:9903256-9903278 AAACCAAGAGAGGCCGGGCACGG - Intronic
1134068743 16:11247375-11247397 GAAGAAGGAGAGGCCGGGCGCGG - Intergenic
1134336283 16:13302581-13302603 GAAGCAGGAGTGGCACAGCTGGG - Intergenic
1135280069 16:21146730-21146752 GAAACAGGAGTGGAAGGGTTGGG - Intronic
1136588724 16:31204116-31204138 CAACCAGGATGGGCCGGGCACGG + Intergenic
1136637328 16:31532994-31533016 AAGCCAGAAGTGGCTGGGCTTGG - Intergenic
1137559255 16:49492499-49492521 GGAGCAGGAGTGGCCCGTCTCGG - Intronic
1137634632 16:49975179-49975201 TATCTAGGAGTGGACGGGCTGGG - Intergenic
1137752010 16:50870694-50870716 CACCTAGGAGTGGACGGGCTGGG + Intergenic
1138899815 16:61255058-61255080 GAATCAAGAGTGGCTGGGCATGG - Intergenic
1139176980 16:64700767-64700789 GAACCTGGAGTTGCAGGGCCTGG - Intergenic
1139521318 16:67484116-67484138 GGAGCAGGAGTGGGCGGTCTTGG - Intergenic
1139561619 16:67746189-67746211 GAGCCAGGTGTGGCTGGGCATGG + Intronic
1139574733 16:67833749-67833771 GACCCCGGAGTGCTCGGGCTGGG - Exonic
1139599603 16:67978677-67978699 GAGGCAGGAGTGGCAGGCCTAGG - Intronic
1140224596 16:73067390-73067412 GTACCTGGAGGGGCCAGGCTGGG - Intergenic
1141107878 16:81248719-81248741 GCACCAGTGGTGGCCGGGCGCGG + Intronic
1141590448 16:85065313-85065335 GAGCAAGGAGTGGCCGGTCGGGG - Intronic
1141656831 16:85421156-85421178 GAAACAGGAAGGGCAGGGCTGGG + Intergenic
1141718376 16:85740410-85740432 TATCCAGGTGTGGCCGGGCGCGG + Intronic
1141727809 16:85800912-85800934 AAACAAGGAGAGGCCGGGCGCGG - Intronic
1142378392 16:89718408-89718430 GAAATAGGAGTGGGCGGGGTGGG - Intronic
1142715869 17:1746715-1746737 TCACCAGGAGGGGCCGGGCGCGG - Intronic
1142716148 17:1748007-1748029 GATCCAGGAGGGGCTGGGCGCGG + Intronic
1142771913 17:2104239-2104261 TAGCCAGGTGTGGCCGGGCGCGG - Intronic
1144249490 17:13401304-13401326 AAAACAGTAGTGGCCGGGCGCGG + Intergenic
1145058341 17:19717240-19717262 GAGCCAGGGGTGGCAGTGCTTGG + Intronic
1146166493 17:30593754-30593776 TAACCAGGCGTGGCCGGGTGTGG + Intergenic
1146314415 17:31795901-31795923 TAACCAGGAGAGGCCGGGCATGG + Intergenic
1146587678 17:34096569-34096591 GAGGCAGGATTGGCCGGGCATGG + Intronic
1146736305 17:35242150-35242172 GAACCAGGAGCGGGCTGCCTGGG - Intergenic
1147296978 17:39491836-39491858 GATACAGGAGTGGCTGGGCGCGG + Intronic
1147968303 17:44206064-44206086 GAGCCTGGGGTGGCCAGGCTTGG + Exonic
1148652592 17:49260492-49260514 TAACGAGGCGTGGCCGGGGTTGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1151614988 17:75204155-75204177 GAACAAGGATAGGCCGGGCGCGG - Intergenic
1151796693 17:76351224-76351246 TAGCCAGGTGTGGCCGGGCGCGG + Intronic
1152177479 17:78797416-78797438 GAAGCAGGGGAGGGCGGGCTCGG + Exonic
1152401128 17:80066892-80066914 GAGCCAGCTGTGGCCGGGCAAGG + Intronic
1152760310 17:82104013-82104035 GACCTAGGACTGGCTGGGCTGGG - Intronic
1153314784 18:3711079-3711101 GAGCCAGGAGGGGCCGCCCTGGG + Intronic
1153454147 18:5261856-5261878 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
1154454449 18:14508432-14508454 TAAGCAGGTGTGGCCAGGCTGGG - Intronic
1154454618 18:14509681-14509703 TAAGCAGGTGTGGCCTGGCTGGG + Intronic
1157626702 18:49056835-49056857 GACCCAGGTGTGGCCGGGCGCGG - Intronic
1158473490 18:57759517-57759539 AAACCAGGAAGGGCCGGGCACGG + Intronic
1160801459 19:971989-972011 GAACCAGCGGCGGCCAGGCTGGG + Exonic
1160929232 19:1561969-1561991 TAGCCAGGTGTGGCCGGGCACGG + Intronic
1161239847 19:3216284-3216306 TAGCCAGGCGTGGCCGGGCGCGG + Intergenic
1161579577 19:5073429-5073451 GCACCAGGAGGGGCCCGCCTGGG - Intronic
1161655396 19:5511264-5511286 GGACCAGGCCTGGCCGGGCGCGG - Intergenic
1161720573 19:5900050-5900072 GAACTGGGAGTGGACGAGCTGGG + Intronic
1162076539 19:8191617-8191639 CAACCAGGAATGGCCAGGCATGG + Intronic
1163169613 19:15521852-15521874 GAACCACCAGTGGCCGGGCGTGG + Intronic
1163288621 19:16364583-16364605 GGACCAGGAGTGGCCCTGCATGG - Intronic
1163596404 19:18223632-18223654 GAAACAGGAGAGGCCGGGTGCGG - Intronic
1163615372 19:18324187-18324209 GAAAAAGGAGCGGCCGGGCTCGG - Intergenic
1163664817 19:18598298-18598320 AACCCGGGAGTTGCCGGGCTGGG + Intronic
1163796786 19:19342456-19342478 GGAGCAGGGGTGGCTGGGCTGGG + Intronic
1164615585 19:29665353-29665375 GAAGCGGGAGGGGCGGGGCTTGG - Exonic
1165092346 19:33393769-33393791 GGGCCAGGATTGTCCGGGCTGGG - Intronic
1165162398 19:33824753-33824775 GAGTCAGGAATGGCCGGGCACGG - Intergenic
1165346926 19:35254384-35254406 AAACCAGGATAGGCCGGGCATGG - Intronic
1165903449 19:39179346-39179368 GAGGCAGGGGTGGGCGGGCTGGG - Exonic
1165939009 19:39406059-39406081 GTACTGGGATTGGCCGGGCTTGG + Intergenic
1166046390 19:40233227-40233249 GAACCAGGAGTGGCCGGGCTGGG - Exonic
1166442095 19:42823893-42823915 GAACCAGGAGAGGCAGGGCCCGG + Intronic
1166461519 19:42992176-42992198 GAACCAGGAGAGGCAGGGCCCGG + Intronic
1166478812 19:43152161-43152183 GAACCAGGAGAGGCAGGGCCCGG + Intronic
1166501485 19:43344492-43344514 GAACCAGGAGAGGCAGGGCCCGG + Intergenic
1166508631 19:43388966-43388988 GAACCAGGAGAGGCAGGGCCCGG - Intergenic
1166525511 19:43507551-43507573 GAAGGAGGAGGGGCTGGGCTGGG - Intronic
1167281292 19:48570467-48570489 GAAAAAGAACTGGCCGGGCTCGG - Intronic
1167430101 19:49449292-49449314 GAACCAGGACTGCCCGGGTGTGG + Intronic
1167462977 19:49636079-49636101 TAACCAGGAGTGGGCAGGCAGGG + Intronic
1167511940 19:49899843-49899865 TAGCCAGGTGTGGCCGGGCGAGG - Intronic
1167617253 19:50542230-50542252 GAGCGAGGAGTGGACAGGCTGGG + Intronic
1168082452 19:54020244-54020266 GCAGCAGGAGGGGCGGGGCTGGG - Intergenic
1168609493 19:57787715-57787737 GAAACTGGAGAGGCCGGGCGTGG + Intronic
1202636092 1_KI270706v1_random:45942-45964 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
926058892 2:9792972-9792994 TAACCTGCAGTGGCCGGGCGCGG + Intergenic
928431653 2:31223816-31223838 GAAACAGAAGCGGCCAGGCTTGG - Intronic
928554383 2:32408256-32408278 GAGCCAGGTCTGGCCGGGCACGG - Intronic
930080742 2:47446334-47446356 GAAACAGAAGTGGCCCGGCATGG - Intronic
931489226 2:62725967-62725989 CAAGCAGAAGTGGCCAGGCTAGG + Intronic
932241245 2:70158736-70158758 TAGCCAGGCGTGGCCGGGCGTGG - Intronic
935028111 2:99296629-99296651 CACCCTGGAGTGGCAGGGCTTGG - Intronic
935168050 2:100586834-100586856 TAAACAGGAGTGGCCAGGCACGG - Intergenic
936025411 2:109027743-109027765 GCTCCAGGAGTGGGCGGGGTGGG + Intergenic
936400091 2:112158185-112158207 GAACCAGGACAGGCTGGGCACGG - Intronic
938282081 2:130071592-130071614 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
938332707 2:130460164-130460186 TAAGCAGGTGTGGCCAGGCTGGG + Exonic
938357100 2:130660507-130660529 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
938433534 2:131267313-131267335 TAAGCAGGTGTGGCCAGGCTGGG - Intronic
938967299 2:136399801-136399823 GAACCAGTTCTGGCCGGGCACGG - Intergenic
939789375 2:146552712-146552734 GAAGCACTAGTGGCCTGGCTGGG - Intergenic
940918100 2:159280399-159280421 TACCCAGAAGTGGCCGGGCGCGG + Intronic
942914307 2:181284610-181284632 AAAACAGGAATGGCCGGGCGCGG - Intergenic
943761852 2:191618655-191618677 GAATCTGGAGTGGCTTGGCTAGG - Intergenic
946394229 2:219435186-219435208 GAACCAGCGGAGGCTGGGCTGGG - Exonic
947548341 2:231028279-231028301 GAAACTGGAGTGGCCTGTCTGGG - Intergenic
947678804 2:232010838-232010860 GAAGCATGAGTGGCAGGGCCAGG - Intronic
947718052 2:232351647-232351669 GAAGCGGGAGGGGCCGGGCACGG + Intergenic
948304953 2:236939951-236939973 GAACCAGGAGCAGCTGAGCTAGG + Intergenic
948309258 2:236972750-236972772 GTACCAGGAGGGGCTGAGCTGGG - Intergenic
948348908 2:237322405-237322427 GAACCAAGAATGGCAGGGATGGG + Intergenic
948855663 2:240729437-240729459 GAATGAGGAGTGCCTGGGCTGGG - Intronic
1169223446 20:3840842-3840864 GAGCCAGTGGTGGCCGGGCGCGG + Intergenic
1170414641 20:16126877-16126899 GAAGGAGGACTGGCCGGGCATGG + Intergenic
1170563457 20:17578668-17578690 GAGCAAGAAGTGGCCGGGCGTGG + Intronic
1170607062 20:17882424-17882446 GAACCAGGAGGTGCGGGGGTGGG - Intergenic
1171882233 20:30626882-30626904 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
1171882400 20:30628130-30628152 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1172457944 20:35092581-35092603 GGACCAGGAGGGGCGGGGCGGGG - Intronic
1172709422 20:36909376-36909398 GAACCAGCTGTGGCTGGGCGCGG + Intronic
1173514089 20:43652713-43652735 GAAACCAGAGTGGCCGGGCGCGG + Intergenic
1173982102 20:47232479-47232501 AACCCAGGAGTGGCCAGCCTGGG + Intronic
1174849926 20:53983874-53983896 GAAGTAGGAGTGGCAGAGCTAGG - Intronic
1174940275 20:54919198-54919220 AAACCAGGAGGGGCCGGGCGCGG + Intergenic
1174990821 20:55507363-55507385 GAACCAGGAATGGTCGGGCGTGG + Intergenic
1176052355 20:63126614-63126636 AGACCAGGAGTGGCCGAGGTTGG + Intergenic
1176180139 20:63746090-63746112 TCAGCAGGAGCGGCCGGGCTGGG + Exonic
1176819550 21:13643627-13643649 TAAGCAGGTGTGGCCTGGCTGGG - Intergenic
1176819721 21:13644870-13644892 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1177179760 21:17732244-17732266 TAGCCAGGTGTGGCCGGGCGCGG - Intergenic
1178166456 21:29983591-29983613 GAAGCAGTAGTTGCTGGGCTTGG - Intergenic
1178692068 21:34758631-34758653 GAGCCAGGATTGGGAGGGCTGGG - Intergenic
1179666330 21:42915191-42915213 GAAGCAGGGGTGGCCAGGCGCGG + Intergenic
1179708029 21:43193813-43193835 GAACCAGGAGGGGCCTCGCCAGG - Intergenic
1180364626 22:11927294-11927316 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1180477586 22:15725254-15725276 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
1180786635 22:18551296-18551318 GGACTAGGAGTGACTGGGCTGGG + Intergenic
1181131925 22:20737109-20737131 GGACTAGGAGTGACTGGGCTGGG + Intronic
1181243550 22:21490817-21490839 GGACTAGGAGTGACTGGGCTGGG + Intergenic
1181577785 22:23806629-23806651 GAATCAGGATTGGCCAGGCGTGG + Intronic
1181722793 22:24788773-24788795 AAACCATGCGTGGCCGGGCGCGG + Intergenic
1182298038 22:29321403-29321425 AAACCAGGAGCAGCCAGGCTGGG - Intergenic
1182306165 22:29370160-29370182 GAAACAAAAGTGGCCGGGCGTGG + Intronic
1183360004 22:37378571-37378593 GAGCTTGGAGTGGCTGGGCTTGG - Intronic
1183411111 22:37655502-37655524 GGACCTGGGGAGGCCGGGCTGGG - Exonic
1183413963 22:37672237-37672259 GAATCAGAAGAGGCCGGGCACGG - Intergenic
1183725849 22:39589317-39589339 CACCCAGGAGTGGCCCCGCTGGG + Intronic
1184000122 22:41667174-41667196 AAACCAGAAGAGGCCGGGCGCGG + Intergenic
1184572601 22:45335645-45335667 GAACCAAGAGTGACGGGACTTGG + Intronic
1184586333 22:45450515-45450537 GCACCAGCAGTGCCCAGGCTGGG - Intergenic
1184592667 22:45495581-45495603 GACCCAGGAGTGACTGGGCGTGG + Intergenic
1184846761 22:47092473-47092495 GAAACTGGAGTGGAGGGGCTTGG + Intronic
1185311497 22:50158212-50158234 GAACCAGGCGTGCCTGGGCAGGG - Intronic
1185314094 22:50171309-50171331 GGACCAGGAAAGGCCGGGATGGG + Intronic
949491119 3:4589910-4589932 GAACCAGGAGAGCCCGAGATAGG - Intronic
950185164 3:10940238-10940260 GACCCAGGAAGGGCCAGGCTGGG + Exonic
950203164 3:11059008-11059030 TAAGCAGGAGTGGCCAGGCAGGG - Intergenic
950269020 3:11598315-11598337 GAAGCAGCAGAGGCCGGGCGAGG - Intronic
951027207 3:17843018-17843040 GAATCAGTAGGGGCCGGGCACGG + Intronic
951822399 3:26827341-26827363 CAAGCAGGTGTGGCCAGGCTGGG - Intergenic
953167288 3:40476854-40476876 AAAACAGGAGCGGCCGGGCGCGG + Intergenic
953915481 3:46917533-46917555 GAATCAGGAGTGGCTTAGCTGGG - Intergenic
955317875 3:57953785-57953807 GAACCAGGAGGGGTCAGGCCCGG + Intergenic
955937241 3:64113390-64113412 TAAGCAGGTGTGGCCAGGCTGGG - Intronic
956371746 3:68570849-68570871 CAAGCAAGAGTGGCCAGGCTGGG - Intergenic
957991739 3:87635265-87635287 AAAATAGGATTGGCCGGGCTCGG + Intergenic
959842187 3:110990407-110990429 TAACTAGGAGTGACCAGGCTTGG + Intergenic
960628309 3:119702914-119702936 AAAGCAGGAGTGGCCAGGCCAGG - Intergenic
961013882 3:123452632-123452654 GAACCAGTATTGGCCGGGCGCGG + Intergenic
961365886 3:126398952-126398974 GAACCAGGCCTGGCCTGGCCAGG - Intronic
964804935 3:160598535-160598557 CAACCAGGATTGGATGGGCTTGG - Intergenic
967189387 3:186972538-186972560 TAACAAGCAGTGGCCGGGCATGG - Intronic
967595932 3:191327203-191327225 GAACTAGGGGAGGCCGGGCGTGG + Intronic
968051696 3:195658651-195658673 GTGCGAGGAGTGGCCGGGCTCGG + Intergenic
968104119 3:195989682-195989704 GTGCGAGGAGTGGCCGGGCTCGG - Intergenic
968185799 3:196632908-196632930 GAACCGGGAGGGCGCGGGCTCGG - Intergenic
968302421 3:197627272-197627294 GTGCGAGGAGTGGCCGGGCTCGG - Intergenic
968498507 4:932213-932235 GCAGCCGGAGTGGTCGGGCTCGG + Exonic
968603615 4:1521233-1521255 GCACCGGGAGGGGCCGGGCATGG - Intergenic
969027821 4:4188730-4188752 CAACTAGGAGTGGCCAGGTTGGG - Intergenic
970101169 4:12524324-12524346 CAAACAGGTGTGGCCAGGCTGGG - Intergenic
970399226 4:15701886-15701908 GAGCCAGGATTGGCCGGGCGCGG - Intronic
970431876 4:15996218-15996240 TAAACAGTAATGGCCGGGCTTGG + Intronic
970885612 4:20984620-20984642 GAACAAGGAGTGGCGTGGCGGGG - Intronic
973365900 4:49209328-49209350 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
973366069 4:49210577-49210599 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
973394530 4:49581874-49581896 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
973394699 4:49583123-49583145 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
977064187 4:92292937-92292959 AAACCAGGAGAGGCTGGGCGCGG + Intergenic
978057859 4:104294986-104295008 GTACCAGGAATGGCTGGGCATGG - Intergenic
978813766 4:112879520-112879542 GATTCAGGAGTGGCTTGGCTGGG - Intronic
981170338 4:141615748-141615770 GCTGCAGGAGTGCCCGGGCTAGG + Intergenic
981276250 4:142901044-142901066 CAAGCAGGTGTGGCCAGGCTGGG + Intergenic
982226970 4:153175308-153175330 GCACCAGTTGGGGCCGGGCTCGG - Intronic
982304148 4:153911871-153911893 GAGCCAGGAATGGCTGTGCTGGG - Intergenic
984293018 4:177819018-177819040 GACCCAGTGGTGGCCGGGCATGG + Intronic
984773005 4:183454548-183454570 GAAGCAGGATCGGCCGGGCGTGG - Intergenic
985087859 4:186332397-186332419 AAACCAGGGGAGGCCGGGCACGG - Intergenic
1202763407 4_GL000008v2_random:131809-131831 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
985497765 5:218921-218943 GTGCGAGGAGTGGCCGGGCTCGG + Intronic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
986370340 5:7073969-7073991 GAACCAGCCCTGGCCGGGCATGG + Intergenic
987046769 5:14116063-14116085 GAACCAGGAGAGCCAGGGGTGGG + Intergenic
987065883 5:14289095-14289117 TAGCCAGGTGTGGCCGGGCGCGG + Intronic
987191256 5:15480670-15480692 TTAGCAGGAGTGGCTGGGCTCGG + Intergenic
987345578 5:16975939-16975961 GAACCTGGACTGGCCAGGCATGG + Intergenic
990439863 5:55833651-55833673 GAACCAGACCTGGCCGGGCACGG + Intergenic
992587906 5:78260294-78260316 GAATGAGGAGGGGCCGGGCGTGG + Intronic
992902803 5:81315839-81315861 GAACCAGGAGTGCCAGTGTTAGG - Intergenic
995509590 5:112894941-112894963 GAATCAGGAGAGGTGGGGCTGGG + Intronic
995555416 5:113323232-113323254 AATCCAGGAGTGGCTTGGCTGGG - Intronic
996756340 5:126939356-126939378 GGTCCAGGAGCGGCTGGGCTGGG + Intronic
997196945 5:131986576-131986598 GAACCAAGGGTGGCCAGGATTGG + Intronic
997434137 5:133862035-133862057 GAAGCAGGAGGGGCCAGGCGCGG + Intergenic
997523722 5:134539487-134539509 GAGCCAGGATTGGCCGGGCGCGG - Intronic
997985260 5:138496264-138496286 GAACAAGGATTGGCCAGGCGTGG - Intergenic
999465847 5:151803782-151803804 GAACCAGCAGAGGCTGGGCACGG - Intronic
999937734 5:156505635-156505657 GAAACAGGAATGGCCATGCTGGG - Intronic
1001696397 5:173673520-173673542 GGCACAGGATTGGCCGGGCTGGG - Intergenic
1002082989 5:176748508-176748530 GGGCCAGGAGTGCCCGGGCAAGG - Intergenic
1002851953 6:1004099-1004121 GACCCAGGAGGGGCCTGGCAGGG - Intergenic
1002872445 6:1179068-1179090 GCCCCAAGAGTGGCCTGGCTTGG - Intergenic
1003848636 6:10199508-10199530 GAAACAGAACTGGCCGGGCGCGG - Intronic
1004099152 6:12591297-12591319 TAGCCAGGCGTGGCCGGGCGCGG + Intergenic
1004607649 6:17208940-17208962 GAAGTAGGCGTGGCCGGGCGTGG + Intergenic
1005894124 6:30163650-30163672 GAGACCGGAGTGGACGGGCTGGG + Exonic
1005899418 6:30204949-30204971 AAACCAGAAGCGGCCGGGCGCGG + Intronic
1006142539 6:31938941-31938963 TAGCCAGGTGTGGCCGGGCATGG - Intronic
1006389165 6:33748475-33748497 GAACAAGGGGTGGCTGGGCACGG + Intergenic
1010266238 6:73871581-73871603 GAAAGAAGAGTGGCCGGGCATGG + Intergenic
1011686560 6:89828702-89828724 TAGCCAGGGGTGGCCGGGCGTGG + Intergenic
1012490776 6:99780424-99780446 CAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1013162656 6:107560730-107560752 AGCCCAGGAGTGACCGGGCTGGG + Intronic
1013585527 6:111575296-111575318 GAAGAAGGAGTGGCCGGGTGCGG + Intronic
1013992145 6:116265673-116265695 CAAGCAGGAATGGCCAGGCTGGG + Intronic
1015700523 6:136031447-136031469 TTACCAGGAGGGGCCGGGCGCGG + Intronic
1016910953 6:149198642-149198664 AAACTAGGAGAGGCCGGGCGTGG + Intergenic
1017139151 6:151174866-151174888 CCACCAGGAGTGGCCGGGAGCGG - Intergenic
1017781173 6:157716459-157716481 ACACCTGGAGTGGCAGGGCTGGG + Intronic
1018312608 6:162526359-162526381 GAACCAAAGGTGGCCGGGCACGG + Intronic
1020072965 7:5239609-5239631 TAGCCAGGTGTGGCCGGGCATGG + Intergenic
1020365273 7:7373987-7374009 AAACCAGAAGGGGCCGGGCGCGG - Intronic
1021351194 7:19595941-19595963 CAAGCAGGGGTGGCCAGGCTAGG + Intergenic
1021744440 7:23724522-23724544 AAACCAGGTGAGGCAGGGCTGGG - Intronic
1023181819 7:37492318-37492340 GCTCCGGGAGTGCCCGGGCTAGG + Intergenic
1025841749 7:65155841-65155863 TCACCAAGAGTGGCAGGGCTGGG - Intergenic
1025881299 7:65540135-65540157 TCACCAAGAGTGGCAGGGCTGGG + Intergenic
1025892140 7:65662480-65662502 TCACCAAGAGTGGCAGGGCTGGG - Intergenic
1025990987 7:66496714-66496736 GAAGCAGAAGTGGCCGGGCGCGG + Intergenic
1026068222 7:67094786-67094808 GATCCAGGAGTGGCCAACCTGGG + Intronic
1026099145 7:67370353-67370375 GAACAAGGACTGGCCGGGCATGG + Intergenic
1026875190 7:73875382-73875404 GAGCCAGGGGAGGCCGGGCACGG - Intergenic
1028349915 7:89833652-89833674 GAAAAAGCAGTGGCCGGGCACGG + Intergenic
1029246897 7:99208544-99208566 AAGCCAGGTGTGGCCGGGCACGG - Intergenic
1029953386 7:104611076-104611098 GAACCAGGAAAGGCAGTGCTAGG + Intronic
1030581352 7:111359590-111359612 GAACCTGGAGAGGCCGGGCACGG - Intronic
1032016822 7:128385417-128385439 GAAGCAGGAGGGGCAGGGATGGG + Intergenic
1032068266 7:128789070-128789092 GAACCAGGAGGAGCTGCGCTGGG + Intergenic
1032409854 7:131687003-131687025 GACCCTGAAGTGGCCAGGCTGGG + Intergenic
1034440046 7:151081711-151081733 CAGCCCGGAGGGGCCGGGCTCGG + Exonic
1034895901 7:154876117-154876139 GAAGCAGGAGAGGCCGGGAGGGG + Intronic
1034958818 7:155351663-155351685 GACCCAGGAGGGCCCTGGCTGGG - Intergenic
1036155441 8:6338049-6338071 GACCGAGGAGTGGCCGGGCACGG + Intergenic
1036656749 8:10681880-10681902 GAACCAGGAGTGGCCATGGGTGG - Intronic
1037373621 8:18205836-18205858 CAAGCAGGTGTGGCCAGGCTGGG + Intronic
1037822008 8:22139624-22139646 GCACCAGGTGGGGCTGGGCTGGG - Intronic
1038002567 8:23403964-23403986 GGATCCGCAGTGGCCGGGCTGGG + Exonic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1039783829 8:40814982-40815004 AAAACAGGAGAGGCCAGGCTTGG + Intronic
1040087942 8:43365242-43365264 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
1040088176 8:43366811-43366833 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1040404293 8:47085306-47085328 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
1043527486 8:81112182-81112204 GAGCCGGGCGGGGCCGGGCTGGG + Intergenic
1043738282 8:83774974-83774996 CAAGCAGGAGGGGCCAGGCTAGG - Intergenic
1045302326 8:100922672-100922694 AAACCAGGGTTGGCCGGGCGTGG - Intronic
1045948741 8:107828164-107828186 GAGCCATGTGTGGCCGGGCGCGG + Intergenic
1046473410 8:114709589-114709611 AAAACAGTGGTGGCCGGGCTCGG + Intergenic
1046916955 8:119688155-119688177 TAGCCAGGAGTGGCTGGGCGTGG - Intergenic
1047424680 8:124734435-124734457 GTTCCAGGTGTGGCCGGGCATGG + Intergenic
1048994940 8:139788459-139788481 GCACCAGGAAGGGCCAGGCTGGG - Intronic
1049175293 8:141189009-141189031 GAACCAGGTGTGGGTTGGCTCGG + Exonic
1049223391 8:141438116-141438138 GAACCAGGTGTGGCTGGGGCAGG - Intergenic
1049614243 8:143569241-143569263 GAAACAGGAGGGGCGGGGCGGGG + Intronic
1050380117 9:5020034-5020056 GTACCAGGAGTGGCAGTGATGGG + Intronic
1053121525 9:35550783-35550805 AAACCAGGAGAGGCCGGGCATGG + Intronic
1053542988 9:38993899-38993921 CAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1053807431 9:41817416-41817438 CAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1054623161 9:67370011-67370033 CAAGCAGGTGTGGCCAGGCTGGG - Intergenic
1055117930 9:72625396-72625418 GAATCAGGGGTGGCCAGGCACGG + Intronic
1055478265 9:76685040-76685062 GAGGCAGAAGTGGCCGGGCGCGG - Intronic
1057108528 9:92444897-92444919 CAAGCAGGTGTGGCCAGGCTGGG + Intronic
1057143908 9:92745820-92745842 GATCCAGAAGTGGCTGGGCCTGG + Intronic
1058443507 9:105032028-105032050 GAAAGAGAAATGGCCGGGCTTGG + Intergenic
1058567243 9:106299366-106299388 GAACTATGAATGGCCGGGCCTGG + Intergenic
1059682085 9:116595613-116595635 GAAGCAAGAGTGGCCGGGCGCGG - Intronic
1059923867 9:119186808-119186830 GAACCAGGAATGGCAGGGCGTGG - Intronic
1060275006 9:122175822-122175844 GAGCAAGGAGAGGCCGGGCGCGG + Intronic
1060562460 9:124557421-124557443 GAAGGAGGATTGGCCGGGCGCGG - Intronic
1060701294 9:125751006-125751028 GAAGCAGGAGTGGGGGGGCTTGG - Intronic
1060837878 9:126770727-126770749 GAACCAGCTTTGGCCGGGCAGGG - Intergenic
1060853544 9:126897070-126897092 CAGCCAGGTGTGGCCGGGCACGG - Intergenic
1061058440 9:128237557-128237579 GAACAAGGACAGGCCGGGCGGGG - Intronic
1061424365 9:130489881-130489903 AAACCAGAAGTGGCCTAGCTGGG + Intronic
1061959984 9:133983027-133983049 GAGACGGCAGTGGCCGGGCTGGG + Intronic
1062529169 9:136992405-136992427 GAACCCGGCGGGGCGGGGCTTGG - Exonic
1203527640 Un_GL000213v1:104700-104722 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
1203527809 Un_GL000213v1:105943-105965 TAAGCAGGTGTGGCCTGGCTGGG + Intergenic
1203544165 Un_KI270743v1:116682-116704 TAAGCAGGTGTGGCCAGGCTGGG - Intergenic
1185576650 X:1179958-1179980 TATCCAGGTGTGGCCGGGCACGG - Intergenic
1186179180 X:6956312-6956334 GAAATAGTAGTGGCCGGGCGTGG - Intergenic
1186891830 X:13966659-13966681 AAGCCACGAGTGCCCGGGCTGGG - Intergenic
1188307137 X:28572245-28572267 GAACAAGGAGTGACTGGCCTTGG + Intergenic
1188743837 X:33817481-33817503 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1189558188 X:42166402-42166424 CAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1189678278 X:43486748-43486770 CAAGCAGATGTGGCCGGGCTGGG - Intergenic
1192935157 X:75851077-75851099 CAAGCAGGAATGGCCAGGCTGGG + Intergenic
1193233971 X:79083989-79084011 AAATCAGTAGTGGCCGGGCATGG - Intergenic
1195346367 X:103954333-103954355 TAAGCAGGTGTGGCCAGGCTGGG - Intronic
1195361088 X:104084511-104084533 TAAGCAGGTGTGGCCAGGCTGGG + Intergenic
1197242400 X:124133924-124133946 GTACCAGGATAGGCCGGGCGCGG + Intronic
1197785491 X:130193118-130193140 CTACCAGGATTGGCCGGGCGCGG + Intergenic
1199758007 X:150882879-150882901 CAACCATGAGAGGCCGGGCATGG + Intronic
1201147683 Y:11073802-11073824 GATCAAGGTGTGGCAGGGCTGGG - Intergenic