ID: 1166047579

View in Genome Browser
Species Human (GRCh38)
Location 19:40238505-40238527
Sequence CTCTGTAAGGGGAAGCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166047570_1166047579 29 Left 1166047570 19:40238453-40238475 CCACTGCACAGAGAAGGCGCGAG 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1166047579 19:40238505-40238527 CTCTGTAAGGGGAAGCTGAGCGG 0: 1
1: 0
2: 1
3: 16
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166047579 Original CRISPR CTCTGTAAGGGGAAGCTGAG CGG Intronic
904113277 1:28143463-28143485 CTCTGTAAGGGGAGGGACAGAGG - Intergenic
906092987 1:43198625-43198647 CTCTGTTAGAGGATGCGGAGAGG + Exonic
906241066 1:44242608-44242630 CTCTGTCAAGGGATGCAGAGGGG + Intronic
907267310 1:53270707-53270729 CTCTGAAAGGTGACGCAGAGTGG - Intronic
908438224 1:64128000-64128022 CTCAGTGAGGGGCAGCTGACAGG + Intronic
908982597 1:69976816-69976838 CTCTCCAAGGGGAATGTGAGGGG - Intronic
912254380 1:108044285-108044307 ATTAGGAAGGGGAAGCTGAGTGG - Intergenic
916266625 1:162896600-162896622 ATCTGGAAAGGGCAGCTGAGAGG + Intergenic
916517206 1:165530413-165530435 TTCTGGAAGGGGAAGCTGAGTGG + Intergenic
917012213 1:170487682-170487704 CTCTGTGCAGGGAAGGTGAGAGG + Intergenic
920667296 1:207972379-207972401 CTCTGTTAGTGGCAGCTGCGAGG + Intergenic
921614430 1:217249802-217249824 ATTTGTAAGTGGAAGATGAGTGG + Intergenic
921785702 1:219227308-219227330 CTTTGAAAGAGGAAGCAGAGTGG - Intergenic
923104096 1:230841141-230841163 GTCTGTAAGGAGGAGCTGATGGG + Intronic
923617348 1:235548814-235548836 CTCTGTCAGTGGAAGATGAATGG - Exonic
923769005 1:236920904-236920926 CTATGTATGGGGAAAATGAGAGG + Intergenic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1067455261 10:46414580-46414602 CACTTTAATGGGAAGCTGAAAGG - Intergenic
1067631941 10:47970054-47970076 TTCTTTAATGGGAAGCTGAAAGG + Intergenic
1069098622 10:64290576-64290598 TTCTTTAAGGGGGATCTGAGTGG - Intergenic
1069807503 10:71135093-71135115 CGCAGTAGGGGGAAGCTGGGAGG - Intergenic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1070829927 10:79411932-79411954 CTCTGTAAGGGGCACATGTGGGG - Intronic
1073574846 10:104613773-104613795 CTCTGAAAGGGGAATGTTAGAGG + Intergenic
1073764072 10:106662797-106662819 TTCTGTAAAGGAAAGCTGAGGGG - Intronic
1075737970 10:124675713-124675735 CTCTGGAAGGGCCAGCTGATTGG + Intronic
1075921852 10:126220063-126220085 CCCTGTAGGAGGAGGCTGAGAGG + Intronic
1075953428 10:126501905-126501927 CTCAGAAAGGGGAGGGTGAGAGG + Intronic
1077439320 11:2560631-2560653 GTGTGGAAGGGGAGGCTGAGGGG - Intronic
1077478639 11:2802807-2802829 CCCGGAATGGGGAAGCTGAGTGG + Intronic
1078387161 11:10902763-10902785 CTATAAAGGGGGAAGCTGAGTGG + Intergenic
1079785603 11:24667557-24667579 CTGTGTAATGGGGAGCTGAGTGG + Intronic
1080329616 11:31120816-31120838 ATCTGTAGGGGGATGGTGAGTGG - Intronic
1080546513 11:33324529-33324551 CTCTTGAAGGGGATTCTGAGTGG - Intronic
1080679469 11:34460694-34460716 CTCTGGAAGGCCAAGGTGAGAGG - Intronic
1081617669 11:44600238-44600260 CTGGGTCTGGGGAAGCTGAGGGG - Intronic
1082842212 11:57698956-57698978 CCCAGCAACGGGAAGCTGAGAGG + Exonic
1084908044 11:72363912-72363934 TTCAGTGAGAGGAAGCTGAGAGG - Intronic
1085261374 11:75207137-75207159 CTGACCAAGGGGAAGCTGAGTGG - Intergenic
1086190104 11:84069093-84069115 CTCTGGAGGGGGAAGCTCAGTGG - Intronic
1089073094 11:115716366-115716388 CTTTCTAAGGGGAAGGAGAGAGG + Intergenic
1089462885 11:118663023-118663045 CTCTGGAAGGGGAACAAGAGAGG - Intronic
1089796592 11:120986048-120986070 CTCAGCAACGGGAAGCTGTGCGG + Exonic
1090404663 11:126469466-126469488 CCCTGGGAGGGGAAGCAGAGGGG + Intronic
1091409884 12:232400-232422 AGTTGTAGGGGGAAGCTGAGTGG - Intronic
1091755925 12:3051493-3051515 CTCTGTCAAGGGAAGGGGAGAGG - Intergenic
1091933515 12:4416450-4416472 GTGTGGAAGGGGAACCTGAGCGG + Intergenic
1092044259 12:5417609-5417631 ATTTGTAAGTGGAAGCTGAGAGG - Intergenic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1094299794 12:28950132-28950154 GTCTGAAACAGGAAGCTGAGTGG + Intergenic
1094433663 12:30397841-30397863 CTCTGGAGGAGGAGGCTGAGGGG + Intergenic
1094560288 12:31546441-31546463 CTCTGGAAGGCTAAGGTGAGTGG + Intronic
1095874691 12:47067918-47067940 CTCTGTTAGCAGATGCTGAGAGG + Intergenic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1097088380 12:56486482-56486504 CTCTTTAAGAAGAAGCTGATGGG + Intronic
1097178325 12:57156443-57156465 GGCTGGCAGGGGAAGCTGAGGGG - Intronic
1099102109 12:78455257-78455279 TTCTGTAAATGGAGGCTGAGTGG - Intergenic
1102555232 12:113722401-113722423 TTCTGAGAGGGGGAGCTGAGTGG - Intergenic
1103506824 12:121446789-121446811 CTCAGTATTGGGAAGCTGTGCGG - Intronic
1104509196 12:129360646-129360668 CTCTGGCCGGGGATGCTGAGTGG + Intronic
1105477687 13:20742723-20742745 CTCAGTAAGAGGCAGCTAAGAGG - Intronic
1107708503 13:43130589-43130611 CTCTGTGAGGGGCTGGTGAGAGG - Intergenic
1109836395 13:67863028-67863050 CTCTGAAAGGGTAAGGAGAGTGG + Intergenic
1111158781 13:84365353-84365375 CTTTGTAAGGGAAAACTTAGTGG + Intergenic
1111703958 13:91724746-91724768 CTCTGTAAGGCCAAGGTGGGAGG + Intronic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1112342638 13:98565382-98565404 CTCTGGAAGGCGAAGGCGAGAGG + Intronic
1112609945 13:100946227-100946249 CTCTGGAAGAGGATGCTGTGGGG - Intergenic
1113054208 13:106250721-106250743 CTCTGGGAGGCGAAGGTGAGTGG + Intergenic
1113798746 13:113075576-113075598 CTCTGAGAGGTGAAGGTGAGAGG - Intronic
1113988745 13:114341313-114341335 CTCTGTAAGTGTGTGCTGAGCGG + Intergenic
1114610715 14:24038310-24038332 CTCTGTAAGCTGAAGAAGAGGGG - Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1115865977 14:37746860-37746882 CTCAGTAAAGGGAAGATAAGTGG + Intronic
1116030122 14:39561148-39561170 CCCTGTGAGTGGTAGCTGAGTGG + Intergenic
1118941187 14:70339859-70339881 GTCTGTAGGAGGAAGATGAGAGG - Intronic
1119659475 14:76439964-76439986 CTGTGCATGGGGGAGCTGAGGGG - Intronic
1119933021 14:78566441-78566463 CTGAGTAAGGGAAAGCTAAGAGG + Intronic
1120732987 14:88023543-88023565 CTCTGAGAGGGCAAGCAGAGGGG + Intergenic
1121362697 14:93276396-93276418 CTCTGTCAAGGGCAACTGAGTGG + Intronic
1122559495 14:102601823-102601845 CTCTTGAAGGGAAATCTGAGTGG + Intronic
1122574307 14:102732079-102732101 CTCTGCAGGGGGCCGCTGAGGGG - Intergenic
1122871658 14:104641525-104641547 CTCTGTGAGCGTAAGCAGAGGGG - Intergenic
1124965856 15:34433201-34433223 TTCTGGAAGGGAAAGCAGAGTGG + Intronic
1124982477 15:34579300-34579322 TTCTGGAAGGGAAAGCAGAGTGG + Intronic
1125695577 15:41634592-41634614 CTCAGTAAGGGGAAGGAAAGGGG - Intronic
1127384946 15:58459842-58459864 CTGTGAAGGAGGAAGCTGAGAGG - Intronic
1128052234 15:64674616-64674638 CTCTGTAAGAAAAAGTTGAGTGG + Exonic
1128330890 15:66754863-66754885 CTAGGTAAGGGGAGGCTGTGTGG + Intronic
1128802913 15:70508364-70508386 CTCTGGAAGGGGCAGGGGAGGGG + Intergenic
1129159630 15:73740124-73740146 CTCTGTATGGGCAGGCTCAGGGG + Exonic
1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG + Intergenic
1129691471 15:77716216-77716238 GTCTGTATTGAGAAGCTGAGAGG - Intronic
1130065811 15:80604221-80604243 CTCTGGGAGTGGAGGCTGAGAGG - Intergenic
1130535964 15:84785127-84785149 CCCTTTGAGGGGAAGTTGAGTGG - Intronic
1131736225 15:95335267-95335289 CTCTGTAAGGGCAGGCTAAAGGG - Intergenic
1132348449 15:101122441-101122463 CTCTGCAGGGGGAGGCTCAGGGG - Intergenic
1132933378 16:2469681-2469703 CTCTTTATCAGGAAGCTGAGGGG + Intergenic
1133543123 16:6775625-6775647 CTCTGTAAGGGGACAGAGAGAGG - Intronic
1136179418 16:28540686-28540708 CTCTGGGAGGGTAAGCTGGGAGG + Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1138061783 16:53898916-53898938 CTCTGTGAGGCCAAGGTGAGAGG - Intronic
1138686906 16:58733979-58734001 CCCAGTAAGGGAAAGCCGAGGGG + Intronic
1140129933 16:72151710-72151732 CTACGTAAGGGGAAGAAGAGAGG + Intronic
1141963678 16:87426576-87426598 CTCTGGAGGGGGAGGCTGTGTGG - Intronic
1143002153 17:3801206-3801228 CTGGCTGAGGGGAAGCTGAGTGG - Exonic
1144363800 17:14522570-14522592 CTAAGTCAGAGGAAGCTGAGAGG + Intergenic
1146784795 17:35710213-35710235 CTCTGTATGGGAAAGCAGAGGGG - Exonic
1147408683 17:40233023-40233045 CTCTGTTAGAGTAAGCTGTGGGG + Intronic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1147728649 17:42582606-42582628 CTCTGTTCAGGGAAGCTAAGAGG + Intronic
1148741932 17:49897915-49897937 CTAGGGAAGGGGAAGGTGAGAGG + Intergenic
1149485160 17:57036848-57036870 CTCTTTCTGGGGAAACTGAGAGG + Intergenic
1150802670 17:68294174-68294196 CACTGTAAAGGAAAGCCGAGAGG - Intronic
1151623194 17:75259904-75259926 CTTTGTAAGGGAAAGGTGGGAGG + Intronic
1151783045 17:76260193-76260215 CTTTGTAAGGTCAAGGTGAGAGG + Intergenic
1152807160 17:82361641-82361663 TTCTGTCAGGTGAAGCTGATGGG + Intronic
1154932003 18:21008850-21008872 CTCTACTGGGGGAAGCTGAGTGG - Intronic
1155378369 18:25188115-25188137 CTCTGTATGGGGCAGCCGTGTGG - Intronic
1156160312 18:34350980-34351002 CTCTGGAAGGGGAAGCTAATGGG + Intergenic
1158307082 18:56117571-56117593 CTCTGCCAGGGGAAGAGGAGGGG - Intergenic
1158688229 18:59634242-59634264 CTCTGCAAGGGGAAGCAGCAGGG + Intronic
1160488899 18:79320316-79320338 CTCTGCCAGGGGAAGGGGAGGGG + Intronic
1161063445 19:2226569-2226591 CGCTGCGAGGGGAAGCTCAGCGG - Exonic
1161280472 19:3442862-3442884 CTCTGCACGGGGCAGCTGTGAGG + Intronic
1161418904 19:4164618-4164640 CTTAGTGAGGGGCAGCTGAGTGG - Exonic
1163641815 19:18466386-18466408 CTTTGTGGGGGGATGCTGAGAGG - Intronic
1166047579 19:40238505-40238527 CTCTGTAAGGGGAAGCTGAGCGG + Intronic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166251760 19:41576283-41576305 CTCTGTGGGGACAAGCTGAGGGG - Exonic
1166281405 19:41796686-41796708 CTCTGTGGGGAGAGGCTGAGGGG - Exonic
1167343919 19:48933519-48933541 CTCTGTAAGGCGGAGCTAAACGG + Intergenic
1168373526 19:55856388-55856410 CACTGGAAGGGGAAGGGGAGTGG - Intronic
925231168 2:2235276-2235298 CCCTCTAAGGGGAAGCTCTGAGG - Intronic
925231178 2:2235345-2235367 CCCTCTAAGGGGAAGCTCTGAGG - Intronic
925231191 2:2235414-2235436 CCCTCTAAGGGGAAGCTGTGAGG - Intronic
927474772 2:23404606-23404628 TTTTCTAAAGGGAAGCTGAGAGG + Intronic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
929911498 2:46093426-46093448 CTTTGGAAGGGGAAATTGAGGGG - Intronic
930252656 2:49052828-49052850 CTCTGAAGGGCAAAGCTGAGTGG + Intronic
934724832 2:96609259-96609281 CTCTGTCAGGGGGAGCTCTGGGG + Intronic
936817567 2:116477307-116477329 GTCTGCCATGGGAAGCTGAGTGG + Intergenic
937379342 2:121362548-121362570 CTCTGCAAGATGAGGCTGAGTGG - Intronic
937698531 2:124837015-124837037 CTCTCACAGGGGAAGATGAGAGG - Intronic
937990624 2:127660046-127660068 CACTGAAAGGGGAAGCTGGCTGG + Intronic
940085099 2:149850339-149850361 CTCTGTCAATGGAAACTGAGAGG + Intergenic
942211590 2:173676735-173676757 GTCTGTAAAAGGAAGCAGAGAGG + Intergenic
943045547 2:182857375-182857397 CTCTGTAAGGCCAAGGTGGGTGG + Intronic
948783329 2:240338309-240338331 CTCAGTAAGGGGAGGCTGTCAGG + Intergenic
948783627 2:240339937-240339959 TTCTGGAATGGGAAGCTGCGTGG - Intergenic
1170521503 20:17190463-17190485 TTCTGTGATGGGAAGCTTAGAGG - Intergenic
1172335331 20:34111481-34111503 CTCTGTTAAGGGAAGCTCAGGGG + Intronic
1172881654 20:38203664-38203686 CTCTGATAGGGGACCCTGAGGGG + Intergenic
1173073271 20:39790885-39790907 CACTGTAAGGGCAAGGTGGGAGG + Intergenic
1173406915 20:42774381-42774403 CTCTGAAAGGGGACACTGAAAGG + Intronic
1173905446 20:46625027-46625049 TGCTGTAAAGGGAAGCTGAGGGG + Intronic
1174051852 20:47772480-47772502 CAATGTAAGGGGAAGCGCAGAGG - Intronic
1176077773 20:63256174-63256196 CTCTCTCAGGGGAAGCTGCCTGG + Intronic
1178826046 21:36017810-36017832 CTCTGAAAGGGGAAGAAGAGAGG - Intergenic
1179976513 21:44871277-44871299 CACTGTAAGGAGCAGCTGAGTGG + Intronic
1182957017 22:34436149-34436171 CTCTGTAAAGAGTAGCTTAGAGG + Intergenic
1183960177 22:41406717-41406739 CTCTGTATGGGGAAGAGGGGAGG - Intergenic
1184759670 22:46537347-46537369 CTCTCGAAGTGGAAGCTGCGGGG - Intergenic
1184847172 22:47095820-47095842 CCCAGTGAGGGGATGCTGAGCGG + Intronic
949559361 3:5187917-5187939 CGCTGGAAGCCGAAGCTGAGCGG - Exonic
949836760 3:8278404-8278426 CTCTTTAAGGAGAAGCTAATTGG + Intergenic
949991787 3:9585363-9585385 CTCAGAAGGGGGAGGCTGAGAGG - Intergenic
950932193 3:16801406-16801428 CTCTTTAAGAGGAACTTGAGAGG - Intergenic
952225378 3:31370097-31370119 CTCTGTAAGAGGAATGTCAGTGG + Intergenic
953117834 3:40010305-40010327 CTCTGAGAGTGGCAGCTGAGGGG + Intronic
953844371 3:46415619-46415641 CTCTGGGAGGCGAAGGTGAGAGG + Intergenic
955745477 3:62136045-62136067 CTCTGAAAGGGGGATCTCAGGGG + Intronic
955794298 3:62619620-62619642 CTCTCTAATGGGAGGCAGAGGGG - Intronic
958844874 3:99253898-99253920 CTCTGAATGGGTAAGCAGAGTGG - Intergenic
959446784 3:106450206-106450228 CTCTGTAAAGGGATGCACAGTGG + Intergenic
959884155 3:111479347-111479369 CTCTGTAACGGGAAGCCGTAAGG - Intronic
959915491 3:111812374-111812396 CTCTGCAAGGGGAAATGGAGAGG + Intronic
960176926 3:114528638-114528660 CACTGGAATGGGAAACTGAGAGG + Intronic
963302281 3:143612116-143612138 CTCTATAGGGGCAAGCTAAGAGG - Intronic
964753599 3:160074784-160074806 GTCTGGGAGGGGAAGCTGTGGGG + Intergenic
966128998 3:176614988-176615010 CTCAGTAAGGGGGTGTTGAGAGG - Intergenic
967467759 3:189827355-189827377 GTCTGTAAGGGGGAGCTGGTGGG - Intronic
970329535 4:14965344-14965366 CTCTTAAAAGGGAATCTGAGTGG + Intergenic
971062709 4:22990490-22990512 CTCCGTAAGGTTAAGGTGAGTGG + Intergenic
971710539 4:30105616-30105638 CTCTGTGTGGGGATTCTGAGTGG + Intergenic
972343150 4:38170315-38170337 CTCCCTAAAGGGAAGATGAGGGG - Intergenic
974088279 4:57284105-57284127 CTCTATTGGGGGAAGCTGGGTGG - Intergenic
974200795 4:58637287-58637309 TTCTCTGAGTGGAAGCTGAGGGG + Intergenic
975887945 4:78987851-78987873 CTCTGAAAAGGGAACTTGAGGGG + Intergenic
976319571 4:83698263-83698285 CTTTGGAAGGTGAAGTTGAGAGG - Intergenic
976679989 4:87745799-87745821 GTGTGGGAGGGGAAGCTGAGGGG - Intergenic
983919507 4:173330995-173331017 CTCTTTAATGGGAAGAAGAGGGG - Intergenic
984292595 4:177814107-177814129 CTCTGAAAGGGGAATCTGGCAGG - Intronic
986383573 5:7209163-7209185 ATCTGGAACAGGAAGCTGAGGGG - Intergenic
986723254 5:10575655-10575677 CCCTGTGAAGGGAAGCAGAGTGG - Intronic
987343413 5:16957992-16958014 CTGAGTAAGGGGAAGTTTAGTGG + Intergenic
988227980 5:28438219-28438241 CACAGAAAGGGGAAGTTGAGGGG + Intergenic
988841961 5:35092035-35092057 CTCTGGGATGGGAAGCAGAGTGG + Intronic
988993467 5:36693099-36693121 CTCTGGGAGAGGAAGCTGGGTGG - Intergenic
990028544 5:51226153-51226175 CACTGTTAGGGGAAACAGAGAGG + Intergenic
993642421 5:90421401-90421423 CTCTTGAAGGGAAATCTGAGCGG + Intergenic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994761490 5:103859914-103859936 CTTTGTAAGAGGGAGCTGGGAGG + Intergenic
995853025 5:116566517-116566539 CTCTGTAAGTGGAAACAGAATGG - Intronic
997696200 5:135862979-135863001 CTCTGGAAGGGGCAGAAGAGTGG + Intronic
997768022 5:136524657-136524679 GGCTGGAAGGGGAAGCTGAGAGG - Intergenic
998355006 5:141527770-141527792 CTCTGAAAGGTGAAACTAAGGGG - Intronic
998587427 5:143441931-143441953 CTTTGGGAGGGCAAGCTGAGGGG - Intergenic
999470909 5:151854649-151854671 CTCAGCAAGAGGGAGCTGAGAGG - Intronic
999782273 5:154858834-154858856 GTCTGTAGGGGGAAGGGGAGTGG + Intronic
1002064415 5:176644952-176644974 GTCTGTCGGGGGGAGCTGAGTGG + Intronic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1003801078 6:9668152-9668174 CTCTGGAAGGTGAAGCTGGCTGG + Intronic
1010653706 6:78486250-78486272 TTCTGTTAGCAGAAGCTGAGAGG - Intergenic
1012203596 6:96435652-96435674 GTCTGTATGGGGAAGCTTATGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1016385972 6:143531250-143531272 CTCAGAAAGGGGAGGGTGAGAGG + Intergenic
1016533465 6:145084669-145084691 TTCTGGAAGGTGAAGGTGAGTGG + Intergenic
1016783886 6:147989150-147989172 GAATGTAAGGGGAAACTGAGTGG + Intergenic
1018997793 6:168723660-168723682 CTCTGTAACTGCAAGCTGAGTGG + Intergenic
1019077129 6:169396697-169396719 AGCCGAAAGGGGAAGCTGAGGGG - Intergenic
1019926785 7:4198250-4198272 CTCTGTGAGGGGCAAATGAGGGG - Intronic
1020491082 7:8785238-8785260 CTCAGAAGGGGGAAGATGAGAGG + Intergenic
1021436544 7:20624155-20624177 TGGTGTAAGGGGATGCTGAGGGG + Intronic
1022183006 7:27940107-27940129 CTCTGTAGGGAGCAGGTGAGAGG - Intronic
1022647463 7:32244661-32244683 CTCTGTGATGGGAAGATGTGTGG - Intronic
1023565277 7:41518136-41518158 CTCTGGAAGGTGCAGCTGTGAGG + Intergenic
1023810543 7:43907915-43907937 CTCTGTAAATGGGAGCTGATAGG + Intronic
1028532200 7:91850437-91850459 TTCTGAAAGGGGCAGCTGAGAGG + Intronic
1029286374 7:99468691-99468713 CTGGGGCAGGGGAAGCTGAGGGG + Intergenic
1032115931 7:129117051-129117073 CTCTGTAAGGGGAATAGGAATGG + Intergenic
1033212823 7:139472873-139472895 CGCTGCATGGGGAAGATGAGTGG - Intronic
1034165333 7:149021133-149021155 CTCTGTTAGAAGAATCTGAGTGG + Exonic
1034380161 7:150685246-150685268 CACAGAAAGGGGAACCTGAGAGG - Intergenic
1035736084 8:1888526-1888548 GTCTGTGAGGAGACGCTGAGTGG + Intronic
1036480570 8:9135383-9135405 CTTTGTATATGGAAGCTGAGTGG + Intergenic
1037097513 8:15003250-15003272 CTCTGAAAGACGAAGCAGAGAGG + Intronic
1037368311 8:18146153-18146175 CCCTGAAAGAGGAAGATGAGCGG + Intergenic
1037700209 8:21267070-21267092 CTCTGTCAGGGGAGGATGACAGG - Intergenic
1040401585 8:47055402-47055424 CTCTGCAAGGCCAAGGTGAGTGG + Intergenic
1040704523 8:50109792-50109814 CTCTGAAAGGTGAGGCAGAGTGG + Intronic
1040968702 8:53111647-53111669 CTCTGTATGGGGTCTCTGAGTGG + Intergenic
1043838567 8:85073984-85074006 CTCTGTAAGTAAAAGTTGAGGGG + Intergenic
1047701770 8:127456114-127456136 TCCTGTATGGAGAAGCTGAGAGG - Intergenic
1048159250 8:131997456-131997478 CTATGTAATGGGAAGTTGAATGG - Intronic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1050492241 9:6200291-6200313 TTCTGTGAGGGGAAGATGATGGG - Intergenic
1051934251 9:22425647-22425669 CTCTCAAAGGGAGAGCTGAGTGG - Intergenic
1052747172 9:32452185-32452207 CTCAGTAATGGAGAGCTGAGAGG - Exonic
1053199029 9:36140336-36140358 CTCTGCAGGGAGAAGCTGTGTGG + Intronic
1053505600 9:38640913-38640935 CTGAGGAAAGGGAAGCTGAGAGG + Intergenic
1053789550 9:41677104-41677126 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054155593 9:61637648-61637670 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054177888 9:61888795-61888817 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054475362 9:65568658-65568680 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054659641 9:67692029-67692051 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1056943428 9:90974577-90974599 CTCTCTTAGGTGAAGGTGAGAGG + Intergenic
1057480186 9:95439209-95439231 CCATGTAAGTGGAAGCTGTGTGG + Intergenic
1061746137 9:132741542-132741564 TTCTGGAAGGGGGATCTGAGTGG - Intronic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1189576574 X:42359860-42359882 CCCTGTAAGAGGAAGCCCAGTGG - Intergenic
1192731579 X:73806819-73806841 CTCTGTAAGAGGAAACTGTTGGG + Intergenic
1193468470 X:81873407-81873429 CTGGGTAAGGAGGAGCTGAGGGG + Intergenic
1195507259 X:105672359-105672381 GGCTGTCAGTGGAAGCTGAGTGG - Intronic
1195599465 X:106728511-106728533 CTCAGTAAGGGTTAGCTGATAGG + Intronic
1195739470 X:108048892-108048914 CACTGTAAGGGTGAGCTCAGAGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196000950 X:110785213-110785235 GTCTGTAAGTGAAAGCTGGGCGG - Intronic
1196937987 X:120748685-120748707 CTCTGAAGGGGGAGGCTGGGAGG + Intergenic
1198722624 X:139639533-139639555 CTCTGGGAGGGAAAGATGAGAGG - Intronic
1199180534 X:144848743-144848765 CTCTGTAATGGGTTGCTGTGAGG + Intergenic