ID: 1166048012

View in Genome Browser
Species Human (GRCh38)
Location 19:40241056-40241078
Sequence GGAATTACAGGCGTGAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9657
Summary {0: 1, 1: 20, 2: 249, 3: 3131, 4: 6256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166048005_1166048012 4 Left 1166048005 19:40241029-40241051 CCTCCCACCTCAGCCTTCTAAAG 0: 37
1: 1876
2: 29930
3: 90648
4: 185689
Right 1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG 0: 1
1: 20
2: 249
3: 3131
4: 6256
1166048006_1166048012 1 Left 1166048006 19:40241032-40241054 CCCACCTCAGCCTTCTAAAGTGC 0: 53
1: 2368
2: 41433
3: 150127
4: 248421
Right 1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG 0: 1
1: 20
2: 249
3: 3131
4: 6256
1166048004_1166048012 20 Left 1166048004 19:40241013-40241035 CCTGGGCTCAAGCGATCCTCCCA 0: 2941
1: 23967
2: 57835
3: 95998
4: 177394
Right 1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG 0: 1
1: 20
2: 249
3: 3131
4: 6256
1166048010_1166048012 -9 Left 1166048010 19:40241042-40241064 CCTTCTAAAGTGCTGGAATTACA 0: 14
1: 1257
2: 31334
3: 334530
4: 260484
Right 1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG 0: 1
1: 20
2: 249
3: 3131
4: 6256
1166048009_1166048012 -3 Left 1166048009 19:40241036-40241058 CCTCAGCCTTCTAAAGTGCTGGA 0: 4
1: 461
2: 11034
3: 112734
4: 234220
Right 1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG 0: 1
1: 20
2: 249
3: 3131
4: 6256
1166048007_1166048012 0 Left 1166048007 19:40241033-40241055 CCACCTCAGCCTTCTAAAGTGCT 0: 66
1: 4000
2: 71167
3: 157724
4: 161165
Right 1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG 0: 1
1: 20
2: 249
3: 3131
4: 6256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166048012 Original CRISPR GGAATTACAGGCGTGAGCTG TGG Intronic
Too many off-targets to display for this crispr