ID: 1166049761

View in Genome Browser
Species Human (GRCh38)
Location 19:40251408-40251430
Sequence TAGTTTGCCAACCCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166049755_1166049761 16 Left 1166049755 19:40251369-40251391 CCAATAAAACTTTATTTACAAAA 0: 706
1: 1239
2: 1334
3: 1303
4: 2323
Right 1166049761 19:40251408-40251430 TAGTTTGCCAACCCTGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166049761 Original CRISPR TAGTTTGCCAACCCTGTTCC TGG Intronic
901347135 1:8555114-8555136 TAGTTTGCCAACTCTGCTGTGGG - Intronic
903334559 1:22616343-22616365 TAGTTTGCCAGACCAGTTCTAGG - Intergenic
906011592 1:42532167-42532189 TAGTTTCCAAACTGTGTTCCAGG + Intronic
909101731 1:71357412-71357434 TAGTTGGCCGGGCCTGTTCCTGG - Intergenic
915198308 1:154207121-154207143 TAGTTCACCTTCCCTGTTCCAGG - Exonic
917982778 1:180282254-180282276 TTGCTTGCCAACCCTGGACCAGG + Intronic
920113764 1:203605107-203605129 TAGTCTGCCATCCCTGGTCAAGG - Intergenic
920960790 1:210662384-210662406 TGGTGTGCCATCCCTGTTTCAGG + Intronic
921160165 1:212466869-212466891 TAATTTGCCCACCCTAATCCAGG + Intergenic
921166176 1:212508860-212508882 TCTTTTGCCACCCATGTTCCTGG + Intergenic
1067756173 10:49007543-49007565 TAGTTTGCAAAGTGTGTTCCTGG - Intergenic
1068790589 10:61026608-61026630 TAGTTTGCAAACTGTGCTCCAGG - Intergenic
1070724018 10:78775708-78775730 TGCTTTTTCAACCCTGTTCCTGG - Intergenic
1071731053 10:88248987-88249009 TAGTGTGCCAATCCTGGGCCTGG + Intergenic
1073187117 10:101622025-101622047 GAGTTTCCCATCCCTGTTCTTGG + Intronic
1073873007 10:107887874-107887896 TAGTTTACCAACTCAGTTTCTGG + Intergenic
1079947643 11:26764237-26764259 TTGTTTCCCCACCCTGTTGCAGG + Intergenic
1082149358 11:48714979-48715001 TAGTTTGGAAACTCTGTTCTTGG - Intergenic
1085468634 11:76741634-76741656 TATTTTGGCAACTCTGCTCCAGG - Intergenic
1087081182 11:94172476-94172498 TAGTCTGCCAACCCTGGCTCTGG - Intronic
1087938227 11:104060689-104060711 TGATGTGCCAACCCTGTTTCAGG + Intronic
1089023727 11:115245532-115245554 TATTTTTACAACCCTGTTCAGGG + Intronic
1093380987 12:18492966-18492988 TAGGTGCCCAACCCTGTGCCAGG - Intronic
1094868483 12:34569848-34569870 CAGTTTGCAAACCCTGTTTTTGG - Intergenic
1095684344 12:45015513-45015535 TATTTTGCAAACCCTGGTCTAGG + Exonic
1101959983 12:109241726-109241748 TACTTTCCCAACCATGTTCTAGG + Intronic
1102935098 12:116889861-116889883 TAGTTTGCCAACCCCTGTTCTGG - Intergenic
1111237375 13:85427193-85427215 TAGTTTTCCAACCCTGTTCTAGG - Intergenic
1116635619 14:47390940-47390962 TATTTTTCCAACCCTTATCCTGG + Intronic
1118439012 14:65796113-65796135 GATTTTGCCAGCCCTGGTCCAGG + Intergenic
1119548586 14:75491728-75491750 GGGTTTTCCAGCCCTGTTCCCGG - Intergenic
1119933736 14:78571472-78571494 TTGTTTCCCAACCCTGCTTCAGG - Intronic
1120163241 14:81168010-81168032 TAGGTTTCCATCCATGTTCCTGG + Intergenic
1122260786 14:100521048-100521070 TAGTTTGCCAATCCTTTCTCTGG - Intronic
1126651932 15:50931841-50931863 TAGTTTGCCAACCCTTGCTCTGG + Intronic
1133676808 16:8081151-8081173 AAGTTTGCCAACCCTACTCTAGG + Intergenic
1133966211 16:10533715-10533737 TAGTTTGCCAACCTTCTTCTTGG + Intronic
1134237429 16:12478286-12478308 TAGTTTGCCAACCCCTGTTCTGG + Intronic
1135984206 16:27172167-27172189 TAGTGTGCCAACCCTGTCTTGGG + Intergenic
1137585608 16:49662511-49662533 TACTCTGCCAGCCCTGTTCGAGG + Intronic
1137901455 16:52273448-52273470 AAGTTTGCCAACTCTGCTCTAGG - Intergenic
1138211744 16:55168868-55168890 TAATTTGCTAACCTTGTTCTAGG + Intergenic
1140218507 16:73026915-73026937 AAGTTTGCCAACCCTAGTCTAGG - Intronic
1141300830 16:82814165-82814187 TAGTCTGTGAACCCAGTTCCTGG + Intronic
1143412542 17:6719614-6719636 TGGTTTGGCAACTCTGCTCCAGG + Intergenic
1144471037 17:15541484-15541506 TAGTTTGCCAACCCTTGTTCTGG + Intronic
1144925431 17:18803193-18803215 TAGTTTGCCAACCCTTGTTCTGG - Intronic
1146558864 17:33850919-33850941 TAGTTTTCCAACCTTGCCCCAGG - Intronic
1147229707 17:39008487-39008509 TTGATTGCCAATCATGTTCCAGG - Intergenic
1149137785 17:53390609-53390631 TACTTTCCCAAACCTGTTCGTGG - Intergenic
1150927389 17:69547276-69547298 AAGTTTGCCAACCGTGGTCTAGG - Intergenic
1152236830 17:79143294-79143316 GAGTTCCCCAAGCCTGTTCCTGG + Intronic
1156376962 18:36523372-36523394 TAATTTTCCAACTCTGTTCTTGG - Intronic
1156474598 18:37397642-37397664 TGGTTTGCCCACCCTGGGCCTGG - Intronic
1160191169 18:76715004-76715026 TAGTTTGCCAACCCCTGTACAGG + Intergenic
1162741895 19:12778235-12778257 CACTTTGCCCACCCTGCTCCGGG - Intronic
1166049761 19:40251408-40251430 TAGTTTGCCAACCCTGTTCCTGG + Intronic
925792135 2:7501036-7501058 TAGGTTCCCTACTCTGTTCCTGG - Intergenic
927500913 2:23582613-23582635 TTGTGTTCCAACCCTGTTCTTGG + Intronic
927918282 2:26950558-26950580 TAATTTGGCAACCTTGTCCCTGG - Intergenic
928253122 2:29699216-29699238 TAGTTTCCCACCCCTGCCCCTGG - Intronic
935494251 2:103758907-103758929 TAGTTTTATAAACCTGTTCCTGG + Intergenic
939820317 2:146949058-146949080 AAGTTTGCCAACCCTGGTCTGGG + Intergenic
944420379 2:199523808-199523830 TAGTTTGCAAACCCTAATCTAGG - Intergenic
944425005 2:199571872-199571894 TAGTTTGCCAACCCCTTTATGGG - Intergenic
1169491081 20:6071963-6071985 TAATTTGCCTTCCCTGTTACCGG + Intergenic
1170056458 20:12210373-12210395 GAGTTTGCCAACCTTTGTCCCGG + Intergenic
1173282379 20:41640610-41640632 TAGGTGCCCAACACTGTTCCTGG - Intergenic
1174584716 20:51599193-51599215 GACTTTGCAAACCCTGTACCTGG - Exonic
1183274533 22:36885317-36885339 TGGTTTGGGGACCCTGTTCCTGG + Intergenic
1183787183 22:40036590-40036612 AAGTCTGCCAACCCTTCTCCAGG + Exonic
1184286071 22:43472301-43472323 TAGTTTGCAAACTCTGGCCCAGG + Intronic
952204500 3:31166827-31166849 TAGTTTGCAAACCCTTGTTCTGG + Intergenic
952981312 3:38738398-38738420 GAGTTTGCCACCCCTAATCCAGG + Intronic
953141274 3:40231386-40231408 TGGTGTGCCAGCTCTGTTCCAGG - Intronic
953487875 3:43319437-43319459 TAGTATGCCTACTCTGTGCCTGG - Intronic
954514261 3:51157711-51157733 TAATTTGTAAACCCTGTTGCAGG - Intronic
955144726 3:56305733-56305755 TAGTTTGCCATCCCGGCTTCAGG - Intronic
955600081 3:60635789-60635811 AAGTTTGCCAACCCTGCTCTTGG - Intronic
963097123 3:141555580-141555602 TAGATTGCCAACCTTTTTCAGGG - Intronic
964361823 3:155906674-155906696 CAGTTTGCCAACCCTGGTTCAGG - Intronic
966080019 3:175989352-175989374 TAGCTGGTCAATCCTGTTCCTGG - Intergenic
969276720 4:6140700-6140722 TACTTTGTCATCCCTTTTCCAGG - Intronic
972310864 4:37881023-37881045 TAATTTGCTAACCCTGCTCTAGG - Intergenic
972474095 4:39434369-39434391 TGGTTTGCCAACCCTATCCATGG + Exonic
973966059 4:56163055-56163077 TAATTTGCCAACTCTGCTCTGGG + Intergenic
976232673 4:82861426-82861448 TAGTTCTCCAACCTTGTTTCTGG - Intronic
976414051 4:84751027-84751049 TAGTGTGCCAACCCCTTCCCTGG - Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982106658 4:152017169-152017191 TAGTTTGGCAAGCATTTTCCAGG + Intergenic
986610183 5:9559199-9559221 AAGTTTGTCAACCCTGGCCCTGG - Intergenic
986666514 5:10109268-10109290 GGCTTTGCCAACCTTGTTCCTGG + Intergenic
989537296 5:42579281-42579303 GAATTTCCCAACCTTGTTCCAGG + Intronic
992728704 5:79636086-79636108 TAGTTCGCCAACCCTGCTCTAGG + Intronic
993575944 5:89600972-89600994 TAGTTTGCCATCCCAGCTGCGGG + Intergenic
994720013 5:103369694-103369716 TTGTGTGACAACCCTGCTCCAGG + Intergenic
998023049 5:138787557-138787579 TAGTTTGCTAACCCTGATATAGG + Intronic
998101674 5:139439780-139439802 TAGTTTGCGAAGCCCTTTCCAGG - Intronic
1000188784 5:158887887-158887909 AAGTTTGCCAACACATTTCCAGG + Intronic
1002774072 6:314084-314106 TGTTTTGCCAGCCCTGATCCCGG + Intronic
1003562796 6:7197091-7197113 CAGTTTGCAAAGCTTGTTCCAGG + Intronic
1003652064 6:7970077-7970099 TAGTTTTCATTCCCTGTTCCTGG + Intronic
1004294552 6:14398457-14398479 TAGTTTGCTCACCCTGTTTTAGG - Intergenic
1004987997 6:21104565-21104587 TAGTTTGCCAACCCCTGTTCTGG + Intronic
1006602208 6:35233515-35233537 TGGTTTTACCACCCTGTTCCAGG + Intronic
1006736665 6:36278523-36278545 TAGTTTCCAAACTGTGTTCCAGG + Intronic
1010941680 6:81926460-81926482 CTATTTGCCATCCCTGTTCCAGG - Intergenic
1012667949 6:102001148-102001170 TAGGTGCCCAACACTGTTCCAGG + Intronic
1016707087 6:147121557-147121579 TTGAATGCCAACCATGTTCCAGG - Intergenic
1016748381 6:147605942-147605964 TTGTGTGCCAACCCTGCTCTGGG - Intronic
1030325053 7:108210623-108210645 TAGAATTCCAACCCTGTCCCTGG + Intronic
1031103356 7:117509326-117509348 TAAATTGCCACCCGTGTTCCAGG - Intronic
1031824978 7:126553014-126553036 TATTATGCCTACCCTGTTCTAGG - Intronic
1032704283 7:134408670-134408692 TAGCCTCCCATCCCTGTTCCAGG + Intergenic
1035491384 7:159281821-159281843 CAGTTTGCCAACCCTGATCTAGG + Intergenic
1038606911 8:29015929-29015951 TAATTTGCCAACTCTGTTTTAGG + Intronic
1041212386 8:55565310-55565332 CAGTTTCCCAACCCTGGTCATGG + Intergenic
1042875449 8:73436887-73436909 TATTTTGCCAATCTTGTTTCAGG + Intronic
1044153300 8:88810182-88810204 TAGTTTGCCAAACATTTTCTTGG + Intergenic
1044954832 8:97469165-97469187 CAGTTAACCAACCCTGGTCCTGG - Intergenic
1048786617 8:138057281-138057303 TAGTTTGCTATCCCTGTTCTAGG - Intergenic
1052374206 9:27699394-27699416 TTGGTTGCCAACCCTGTACCAGG + Intergenic
1054931099 9:70636030-70636052 AAGTTGGCCAACCCTTTTCTTGG - Intronic
1055561332 9:77524973-77524995 TACTTTGCTGACCCTGGTCCTGG - Intronic
1060877227 9:127092126-127092148 TAGAGTGCCTACCCTGTGCCAGG + Intronic
1186637470 X:11421993-11422015 TTGTATGCCTACCCTGTGCCAGG + Intronic
1187353426 X:18543242-18543264 TTGTTAGCCTACCCTTTTCCTGG + Intronic
1188666077 X:32822293-32822315 TATATTGCCACCCCTGTTCTGGG - Intronic
1198533470 X:137566334-137566356 GAGTTTGCCAATCCTGTCCCGGG - Exonic
1201274994 Y:12288266-12288288 TAGAATGCCTACCCTGTCCCAGG + Intergenic