ID: 1166050812

View in Genome Browser
Species Human (GRCh38)
Location 19:40257832-40257854
Sequence GAGACATGCTGCCATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166050812 Original CRISPR GAGACATGCTGCCATGTGGA GGG Intronic
900867574 1:5279383-5279405 GAGATCTGCTGCCTTCTGGAGGG - Intergenic
902020160 1:13339844-13339866 GAGATATGCAGACAAGTGGAGGG + Intergenic
902438835 1:16416013-16416035 GACACCTGGTGCCAGGTGGAAGG - Intronic
905338312 1:37260475-37260497 GGGCCATGCTGCCATGTGGTGGG + Intergenic
905770951 1:40637469-40637491 GAGACAGACTGACATGTTGATGG - Intronic
905949868 1:41941122-41941144 GAAACATGCTGAAAAGTGGATGG + Intronic
909319545 1:74266101-74266123 CAGACAGGATGCCGTGTGGATGG + Intronic
910089491 1:83445528-83445550 GATACATGCTGGAATGTTGATGG + Intergenic
911513448 1:98837373-98837395 GAAACATGCTGAATTGTGGAAGG + Intergenic
913113960 1:115679889-115679911 GAGTCTTACAGCCATGTGGAGGG + Intronic
914319316 1:146544283-146544305 GACAAATGAAGCCATGTGGATGG - Intergenic
915667540 1:157458687-157458709 GAGTAATGGTGCCATATGGAGGG + Intergenic
915803300 1:158817673-158817695 GAGACATGCCTACCTGTGGAAGG + Intergenic
918410878 1:184256753-184256775 GAGAGTTGCAGCCCTGTGGAAGG - Intergenic
918815191 1:189172208-189172230 GAGAAATGGTGACATATGGAGGG - Intergenic
918973960 1:191456544-191456566 CAGACATTCTGAAATGTGGAAGG + Intergenic
919612082 1:199758031-199758053 CAAACTTGCTTCCATGTGGAGGG - Intergenic
920349647 1:205329409-205329431 GAGTCTAGCAGCCATGTGGAGGG + Intergenic
921908310 1:220519293-220519315 GAGAAATTTTGCCATGTTGATGG - Intergenic
922096319 1:222445940-222445962 GACTCATGCTGCCATGTGCATGG - Intergenic
922780914 1:228251616-228251638 GAGAAATGGTGCCATATCGAGGG + Intronic
922807787 1:228399459-228399481 GAGACATTGTGGCATGTGGGCGG - Intronic
923454086 1:234147947-234147969 GAGAAATGCTGCCTTAGGGAGGG + Intronic
923672427 1:236052201-236052223 GAGACTTGCACCCAAGTGGACGG - Intronic
924599505 1:245476093-245476115 GATGCATGCTGCCATGTGGATGG + Intronic
1063467479 10:6256527-6256549 CAGCCAGGCTGCCATGTGCATGG + Intergenic
1063530423 10:6825592-6825614 TAGACAAGCTGTCATTTGGATGG - Intergenic
1067715783 10:48690469-48690491 GAGGGATGCAGTCATGTGGAGGG + Intronic
1069219206 10:65862411-65862433 GACACATGTTGCCAGATGGAAGG - Intergenic
1070392634 10:75984462-75984484 GAGACAAGCAGCCATGTGGCTGG + Intronic
1070998341 10:80806475-80806497 GAGAAAAGCTGCCCTGTGGTGGG + Intergenic
1073628335 10:105122017-105122039 AAGACTTGCTGGCATGTGGAAGG - Intronic
1074105467 10:110386356-110386378 GATACATGCTGCAACATGGACGG - Intergenic
1074148250 10:110736015-110736037 AAGACAGGCTGGCGTGTGGAAGG - Intronic
1075256489 10:120929705-120929727 GAGACAGGATGCCACTTGGAAGG - Intergenic
1075422427 10:122311943-122311965 GCTACATGCAGCCACGTGGATGG - Intronic
1075584335 10:123646211-123646233 GACCCCTGCTGCCTTGTGGATGG + Intergenic
1076919345 10:133443244-133443266 GAAGCAGGCGGCCATGTGGAGGG - Intergenic
1077433572 11:2527695-2527717 AACACATGCTGCCACGTGGATGG - Intronic
1077585405 11:3447837-3447859 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1079166756 11:18051231-18051253 GATACATGCTGCAACATGGATGG + Intergenic
1079851480 11:25541295-25541317 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1080747530 11:35121789-35121811 GACACATGCTGCAACATGGATGG - Intergenic
1080896191 11:36450391-36450413 CAAACATGCTGTCATGTTGAGGG - Intronic
1082108532 11:48245946-48245968 GAGAAATGCTGAAATGAGGAAGG + Exonic
1084242309 11:67830396-67830418 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1085405762 11:76260877-76260899 GATACATGCAGCCACTTGGACGG + Intergenic
1085525037 11:77159204-77159226 CAGGCATGGTGCCATGTGCAGGG + Intronic
1085540656 11:77265961-77265983 GAAACATGCTGCTATTTGGATGG - Intronic
1086178642 11:83922995-83923017 GACACATGCTGCCATTTACAGGG + Intronic
1088836793 11:113584342-113584364 GAGGAATGCTGCCATATCGAGGG - Intergenic
1089512447 11:119008515-119008537 GAGAAAAGCTGCCCTGTGGCGGG - Intronic
1089672171 11:120064112-120064134 GAGACCCTCTGCCATGCGGAGGG + Intergenic
1090477371 11:127035862-127035884 GAGACATTCTGCCCTACGGAAGG - Intergenic
1090924328 11:131236226-131236248 CACACATGCTGGCATGTGCAGGG + Intergenic
1092405705 12:8220771-8220793 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1092412551 12:8265097-8265119 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1094815615 12:34180686-34180708 GAGAAAAGCTGCCCTGTGGTGGG - Intergenic
1096181147 12:49551107-49551129 GAGACTTGGCGCCAGGTGGATGG - Intronic
1098455887 12:70672616-70672638 AAGACCTGCTGCCAAGTGAATGG + Intronic
1098802944 12:74985187-74985209 GAGGAATGCTGACAAGTGGAGGG + Intergenic
1099375781 12:81894911-81894933 AAGAAATGGTGCCATATGGAGGG - Intergenic
1100702738 12:97165145-97165167 GCCACATGCTGCCACGTGGTGGG + Intergenic
1100959303 12:99944912-99944934 TAGACATGCTGAAATGGGGATGG + Intronic
1101264272 12:103067077-103067099 GAGGAATGGTGCCATGTTGAGGG - Intergenic
1101337338 12:103808129-103808151 GACACAAGCTACCCTGTGGATGG + Intronic
1101446679 12:104741956-104741978 GAGAAATGCTGTCAGGTGAAAGG + Intronic
1101769551 12:107736392-107736414 AAGACATGCAGGCATCTGGAGGG + Intronic
1102498809 12:113337268-113337290 GAGCCCTGTGGCCATGTGGAGGG - Intronic
1103177941 12:118880802-118880824 GAGACATGGGGCCATTGGGAAGG - Intergenic
1103216063 12:119202298-119202320 GAGGAAGGCAGCCATGTGGAAGG + Intronic
1103396668 12:120612409-120612431 GAGGAATGCTGCCATATCGAGGG - Intergenic
1103613747 12:122139433-122139455 GAGCCGTGCTGCCACCTGGAAGG - Intronic
1103736180 12:123062183-123062205 CAGACAGGCAGCCAGGTGGAAGG + Intronic
1104238063 12:126959085-126959107 GAGAAAAGCTGCCTTGTGGCGGG - Intergenic
1106668344 13:31877500-31877522 CTGCCATGCTGCCATGTGCAAGG + Intergenic
1108113388 13:47101898-47101920 GAGATCTGCTCCCATGTGGTGGG - Intergenic
1108559369 13:51627719-51627741 GAGGCATGCAGGCAAGTGGAGGG + Intronic
1109510465 13:63365543-63365565 GAGACATGCTACCTAGAGGATGG + Intergenic
1111959425 13:94793776-94793798 GATACACGCTACAATGTGGATGG + Intergenic
1112369819 13:98784774-98784796 GAACAATGCTGCCATGTGGGCGG - Intergenic
1113166669 13:107450628-107450650 GAGAAAGGCTGCAATGTGCAAGG + Intronic
1115645040 14:35363410-35363432 GAGAAATCCTGCCACATGGATGG + Intergenic
1117197270 14:53353171-53353193 GAGGCTTGCTGCTATGTAGACGG - Intergenic
1117384536 14:55197681-55197703 GAAATATGCTGGCATGTGCATGG - Intergenic
1117710301 14:58521542-58521564 GATACATGCTGACATTTCGAGGG - Intronic
1119467632 14:74871905-74871927 GAGAAAGGCTGCCATGTAGGAGG - Intronic
1120859818 14:89245012-89245034 GATACATACTGTCAGGTGGATGG + Intronic
1121366373 14:93315709-93315731 GATAAATGCTACAATGTGGATGG - Intronic
1121367669 14:93329632-93329654 GACACATGCTACAATATGGATGG + Intronic
1123008758 14:105337115-105337137 GACACAGGCTGCAACGTGGATGG + Intronic
1123216623 14:106814048-106814070 GAAGTATGCAGCCATGTGGAGGG - Intergenic
1123777067 15:23590562-23590584 GAGAGAAGCTGCAATGTGGAGGG + Intronic
1124205562 15:27716079-27716101 GAGACATGTTACCATGGAGATGG - Intergenic
1124436354 15:29652382-29652404 GAGGCATGCAGACAAGTGGAGGG - Intergenic
1129326318 15:74801982-74802004 GAGAATTTCTGCCATGTGGATGG - Exonic
1129860391 15:78856109-78856131 GATACATGCTACCATATGGATGG + Intronic
1131536272 15:93240423-93240445 AAGCCATGCTGCCAGGAGGATGG + Intergenic
1133070051 16:3240219-3240241 GACACATGCTGCAACGTGGATGG + Intergenic
1133817473 16:9209208-9209230 GAAACAGCCTGCCCTGTGGAAGG + Intergenic
1134079301 16:11314142-11314164 GAGTCTTGCTGTCATGTGGTGGG - Intronic
1135378293 16:21970118-21970140 GACACATGCTACAATATGGACGG - Intronic
1135464507 16:22673633-22673655 GTGAAAGGCTGCCATGTGCATGG - Intergenic
1135504465 16:23024208-23024230 GATACATGCAACCATTTGGATGG - Intergenic
1135905449 16:26507780-26507802 GAGACATGGAGCCATGGAGAAGG + Intergenic
1136295571 16:29299947-29299969 GACACATGCTACCACATGGACGG + Intergenic
1136872784 16:33823975-33823997 GAGGTATGCAGCCATGTGGTGGG + Intergenic
1137236480 16:46622622-46622644 GAGAAATGCTGCCATTTGTGAGG - Intergenic
1137368876 16:47886548-47886570 GAGACATCCTGCCTGGAGGAGGG - Intergenic
1137656354 16:50162102-50162124 GATACATGCAGCAATTTGGATGG - Intronic
1138396946 16:56711744-56711766 GACACATACAGCCATATGGATGG - Intronic
1138529812 16:57628785-57628807 GGTACCTGCTGCCAGGTGGAGGG - Intronic
1140014208 16:71165801-71165823 GACAAATGAAGCCATGTGGATGG + Intronic
1141902939 16:87004474-87004496 GACCCATGCTGCAACGTGGATGG - Intergenic
1203099388 16_KI270728v1_random:1292079-1292101 GAGGTATGCAGCCATGTGGTGGG - Intergenic
1142534760 17:606468-606490 GTTACGTGCTGCCATGAGGATGG + Intronic
1143882270 17:10038882-10038904 GACATATGCAACCATGTGGATGG + Intronic
1144864651 17:18327370-18327392 GAGACAAGCTGCCATCTCCAGGG - Intergenic
1145868081 17:28253410-28253432 TAGGCCTGCTGCCATGGGGAAGG + Intergenic
1148217559 17:45841491-45841513 GATACCTGCTACCATGTGGATGG - Intergenic
1148435831 17:47684245-47684267 TAGAGATGCTGCCATATGGATGG - Exonic
1149286537 17:55171612-55171634 GATACATGGTGCCATGTACATGG + Intergenic
1149526846 17:57363198-57363220 GATAGATGCTACAATGTGGATGG + Intronic
1149696600 17:58621190-58621212 GAGACTTGCTGCCAGCTGGATGG - Intronic
1150635881 17:66912933-66912955 GCCACATGCTGCCACATGGATGG + Intergenic
1150748592 17:67837865-67837887 CAGACATCCTGCCATTTGGGAGG - Intronic
1151825561 17:76522102-76522124 GAAACCTGCTGCCCTGTGGGTGG + Intergenic
1152124740 17:78439633-78439655 GATACATGCTACAACGTGGATGG - Intronic
1152305290 17:79516823-79516845 GACACACGCTGCAATATGGATGG + Intergenic
1153906311 18:9664757-9664779 GACACATGCTACAATGTGGATGG - Intergenic
1154506293 18:15043847-15043869 GAGAAATGTTGCCATATTGAGGG - Intergenic
1155337855 18:24783713-24783735 GAGGCAGCCTGCCATGTGGAAGG - Intergenic
1155717497 18:28963458-28963480 GATACATGCAACAATGTGGATGG - Intergenic
1156484638 18:37457047-37457069 GAGACCTGCCCCCATCTGGAAGG + Intronic
1157393992 18:47326690-47326712 GAGACATGCTGTCATGAACAAGG - Intergenic
1159013579 18:63082686-63082708 AAGAGATGATGCCCTGTGGATGG + Intergenic
1159606487 18:70479715-70479737 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1160160434 18:76466405-76466427 CACCCATGCTGCCACGTGGACGG + Intronic
1162529850 19:11229518-11229540 GAGAAATGCTTCCACATGGATGG + Intronic
1163147894 19:15394257-15394279 GATACATGCTACAATGTGGCTGG + Intronic
1163561223 19:18020696-18020718 GAGACAGAGTGCCAGGTGGAAGG - Intergenic
1164759949 19:30721166-30721188 GATACATGCTACCAAGTGGCTGG - Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166050812 19:40257832-40257854 GAGACATGCTGCCATGTGGAGGG + Intronic
1166248064 19:41545172-41545194 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1168113904 19:54210106-54210128 CAGGCATGCTGCCAGGAGGAGGG + Intronic
925037628 2:702962-702984 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
926098096 2:10095631-10095653 GAAGAATGCTGCCATTTGGAAGG - Intergenic
926443799 2:12919889-12919911 TAGACTTCCTGCCATGTGGGAGG - Intergenic
926493878 2:13559558-13559580 GAGACAGGCTTCCATGAGTAAGG + Intergenic
927151313 2:20198102-20198124 GATACCTGCTGTCATGTGGCAGG + Intergenic
929155044 2:38781535-38781557 CAGACATGCTGCCATCTTCAAGG - Exonic
929393753 2:41499051-41499073 CACTCATGCTGCCATTTGGAAGG + Intergenic
929601135 2:43205484-43205506 CAGACATGCTGCCATGGGGCTGG + Intergenic
930509130 2:52322960-52322982 AAGACATGGTGCTATGTGAAAGG + Intergenic
930717353 2:54605274-54605296 GGTACATGCTTCCATGTGAAAGG - Intronic
930844613 2:55888828-55888850 GAGACCTGCTTCAAAGTGGATGG + Intronic
931557336 2:63519416-63519438 AGTACATGCTGCCATGTGGCTGG + Intronic
931809124 2:65837258-65837280 GATACCTTCTGCCATGAGGAGGG + Intergenic
934165331 2:89289016-89289038 CATACATGTGGCCATGTGGAAGG + Intergenic
934201943 2:89893446-89893468 CATACATGTGGCCATGTGGAAGG - Intergenic
935656190 2:105425621-105425643 GAGAAAAGCTGCCCTGTGGCGGG + Intronic
939196013 2:138973505-138973527 AAGGCATTCTGCTATGTGGAGGG + Intergenic
940783328 2:157956659-157956681 GATACATGCTACGATATGGATGG + Intronic
941668156 2:168262088-168262110 GAGGAATGGTGCCATGTGGAGGG - Intergenic
942130173 2:172870683-172870705 GAGATATGCTGCTGTGTGCATGG + Intronic
943182290 2:184560078-184560100 GAGATATGCAGACAGGTGGAGGG + Intergenic
944901746 2:204223040-204223062 GAGGCATGCAGACAAGTGGAGGG + Intergenic
946381347 2:219351134-219351156 GAGCCCTGCTGCCATGGTGATGG + Intergenic
948004958 2:234600575-234600597 GACACATGCTACAATGTGGATGG + Intergenic
948573977 2:238938013-238938035 AAGACAAGCTGCCTTGTGCAAGG + Intergenic
1168916665 20:1493821-1493843 GAGACTTGCTGTCTTGAGGAAGG - Intergenic
1171166498 20:22976531-22976553 CTGACATGCTGACATGAGGATGG + Intergenic
1171415759 20:24979504-24979526 GTGACATACTGGCATGTGGATGG - Intronic
1171456248 20:25274314-25274336 GACACATGCTCCGATCTGGATGG - Intronic
1173153412 20:40587164-40587186 CAGACAAGCTTCCCTGTGGACGG + Intergenic
1174906295 20:54555612-54555634 GAAATATACTGCCATGTAGAGGG - Intronic
1175112428 20:56658004-56658026 GGAACTTGCTGCCAGGTGGACGG + Intergenic
1175793624 20:61757712-61757734 GATTCTTGCTGCCATGTGGAGGG + Intronic
1176998302 21:15581226-15581248 GAGAAATGATGCCATATTGAGGG - Intergenic
1177990225 21:28028139-28028161 GAGAAATGTTGCCATATTGAGGG - Intergenic
1179411110 21:41163903-41163925 GACACATGCTGCCATATTTATGG - Intergenic
1179789006 21:43744945-43744967 GACACACTCTGCAATGTGGATGG + Intronic
1182126562 22:27820215-27820237 GAGACATGCTGCAACATGGATGG - Intergenic
1182592883 22:31395959-31395981 AAGACATGATCCCATGAGGAAGG - Intergenic
951003701 3:17593445-17593467 GAGAAATGGTGCCATATCGAGGG - Intronic
951915795 3:27799538-27799560 GAGACATGCTGCCGTGCAGATGG + Intergenic
953716386 3:45319962-45319984 CAGACAGGCTGCCTTGTGGAAGG + Intergenic
954104082 3:48399741-48399763 GGGACATTCTGGCATGTGGCAGG - Intronic
955075767 3:55611632-55611654 GAGACATGCTGATAGCTGGAGGG - Intronic
955170197 3:56556737-56556759 GATACATGCTGCAATGTTAAAGG + Intergenic
955944377 3:64178372-64178394 GAGATATGCCTCCATGAGGATGG + Intronic
956277011 3:67513153-67513175 GACACATGCTGCAGTATGGATGG - Intronic
956283277 3:67582069-67582091 GAGAAATTTTGCCATGTGCATGG + Intronic
959377331 3:105602732-105602754 GAGGAATGGTGCCATATGGAGGG + Intergenic
960854512 3:122089016-122089038 AACACATGCTACAATGTGGATGG + Intronic
961363876 3:126387167-126387189 GGCACATGCATCCATGTGGATGG + Intergenic
961371131 3:126432531-126432553 GACACATGCTGCAACATGGAGGG + Intronic
961865575 3:129951284-129951306 GAGAAATGCCGCCTTGGGGATGG - Intergenic
961890116 3:130123749-130123771 GAGAAAAGCTGCCCTGTGGCAGG - Intergenic
962484499 3:135829343-135829365 GAGACATGCTCCAATAGGGAGGG - Intergenic
963024943 3:140910448-140910470 GATACATGCTACCACATGGATGG + Intergenic
963216290 3:142752458-142752480 GAGAAAAGCTGCCCTGTGGCGGG - Intronic
964093137 3:152899476-152899498 GAGACTTGCTGACAGCTGGAGGG - Intergenic
964213529 3:154254209-154254231 CAGAAATGCTGACATGTGGCCGG - Intronic
965928284 3:174009899-174009921 GAGAAATGCTGCCATGCATAGGG + Intronic
966733600 3:183170572-183170594 GAGAAAAGCTGCCCTGTGGTGGG + Intergenic
966772589 3:183517396-183517418 GAGACATACTGCCACGGGAACGG - Intronic
968141444 3:196261020-196261042 GATACATGCTACCACTTGGATGG + Intronic
969000586 4:3977737-3977759 GAGAAAAGCTGCCCTGTGGTGGG - Intergenic
969001511 4:3986314-3986336 GAGAAAAGCTGCCCTGTGGCAGG - Intergenic
969760414 4:9177212-9177234 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
969812407 4:9658546-9658568 GAGAAAAGCTGCCCTGTGGCAGG + Intergenic
969813332 4:9667118-9667140 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
971100884 4:23465462-23465484 GAGAAATGGTGCCATATCGAGGG + Intergenic
971448496 4:26778087-26778109 GAGACATGGTGGGGTGTGGAGGG + Intergenic
971484696 4:27147361-27147383 GACCCATGGTTCCATGTGGATGG + Intergenic
973870185 4:55158236-55158258 CACACATGCTGCCATGTGGTTGG - Intergenic
974539090 4:63210013-63210035 GAGACATGCTGCAATATGGATGG + Intergenic
974954015 4:68616753-68616775 GAGAATTGCTTCCATCTGGAAGG - Intronic
975519664 4:75287009-75287031 GAGAAAAGCTGCCCTGTGGTGGG - Intergenic
976595934 4:86894770-86894792 GAGACTGGCTGCCATTTGAAAGG + Intronic
977218978 4:94316331-94316353 GATAGACGTTGCCATGTGGAAGG - Intronic
980637314 4:135524580-135524602 CAAACTTGCTGACATGTGGAAGG - Intergenic
981257771 4:142683406-142683428 CAGACAGGTTTCCATGTGGAGGG + Intronic
982847915 4:160275259-160275281 GAGGAATGGTGCCATATGGAGGG - Intergenic
983412733 4:167420080-167420102 TAATCATGCTGCCATTTGGAAGG + Intergenic
985609335 5:878223-878245 GACCCAGGCTGCCATATGGACGG + Intronic
986503815 5:8429363-8429385 GAGATATGCAGACAAGTGGAGGG + Intergenic
987504523 5:18750796-18750818 GAGGAATGCTGCCATATCGAGGG - Intergenic
988361338 5:30239928-30239950 GAAACATGCTGACATTTCGAAGG - Intergenic
990001537 5:50899051-50899073 AAGAAATGCTGCCATGAGGAAGG + Intergenic
991123877 5:63047948-63047970 AAGAGATGCTGTCATGTTGAAGG + Intergenic
991172894 5:63648918-63648940 GGGACATGCTGCCATGGGATTGG - Intergenic
992136931 5:73755428-73755450 GAGACTTGCTGGCCTGGGGAGGG - Intronic
992616355 5:78549444-78549466 GGGAGATGCTGACATGTGGTAGG - Intronic
995640632 5:114252815-114252837 GTGACAAGATGACATGTGGATGG + Intergenic
997054374 5:130423293-130423315 GTTACATCCTGCCATGTGCAAGG - Intergenic
997626722 5:135336150-135336172 GGCACCTGCTGCCAGGTGGAGGG + Intronic
999361615 5:150990888-150990910 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
999446416 5:151643731-151643753 GACACATGCTACCATGTGGATGG - Intergenic
1000527044 5:162370696-162370718 GAGAAAAGCTGCCCTGTGGTGGG + Intergenic
1002431047 5:179204033-179204055 TACACATGCTGCAATGTGGATGG + Intronic
1002621444 5:180491466-180491488 GAGACTTGCTGCCACCAGGAGGG - Intergenic
1002852571 6:1009792-1009814 GAGACACACAGCCATGAGGATGG - Intergenic
1003170175 6:3715101-3715123 GAGACAAGCTCCAAAGTGGACGG - Intergenic
1003226592 6:4211489-4211511 GAGGCATGATGCAAAGTGGAGGG + Intergenic
1003318166 6:5030142-5030164 TAAACATGCTGCCTTGAGGAGGG + Intergenic
1004217411 6:13715626-13715648 GAAGCAAGCTGCCATGTTGAAGG - Intergenic
1006169138 6:32083058-32083080 GAGAGCTGCTGCCTGGTGGAGGG - Intronic
1006418945 6:33921584-33921606 GAGAGGTGCTCCCATTTGGAAGG + Intergenic
1006700949 6:35972632-35972654 GGGACATGCCTCCCTGTGGAGGG + Intronic
1007057202 6:38898563-38898585 GACATTTGCTGCCATGTAGATGG - Intronic
1007650015 6:43413493-43413515 GAGGCATGCAGACAAGTGGAGGG - Intergenic
1007945063 6:45818846-45818868 GAGACATGGTTCCACGTGAATGG - Intergenic
1008269151 6:49468895-49468917 GTGAAATTCTGTCATGTGGATGG + Intronic
1009326775 6:62360444-62360466 GACACATGCTACAATATGGATGG + Intergenic
1009845181 6:69125545-69125567 GAGGCCTGCTTCCACGTGGAAGG - Intronic
1010573760 6:77508380-77508402 TACTCATGCTGCCATTTGGAAGG - Intergenic
1010950612 6:82032945-82032967 GATTCCAGCTGCCATGTGGAGGG + Intergenic
1011009507 6:82687836-82687858 GAGTCCTGCTTCCATGTGGGTGG - Intergenic
1011337100 6:86273477-86273499 GAGAGATACAGCCATGTGCATGG + Intergenic
1013926005 6:115473381-115473403 GAAACATGCAGCAATGTAGAAGG - Intergenic
1015057841 6:128925349-128925371 GACACATGCTACCATATGAATGG + Intronic
1015291882 6:131546859-131546881 GAGAAATGCTGACAGGTAGAGGG - Intergenic
1017557055 6:155583059-155583081 GGGACATTCTGCCATGGGGAAGG + Intergenic
1018060078 6:160083325-160083347 GAGAAAAGCTGCCCTGTGGCGGG - Intronic
1018600020 6:165528460-165528482 GAGAAATGGTGCCATATCGAGGG - Intronic
1018671055 6:166177780-166177802 GAGAGACACGGCCATGTGGAGGG + Intergenic
1019753869 7:2753424-2753446 GCCACATGCTGCCAGGTGCAGGG - Intronic
1019805519 7:3121152-3121174 GACACAGGCTGCCAAATGGATGG + Intergenic
1020392226 7:7670573-7670595 GAGACAGACTGCCTTGGGGAGGG - Intronic
1021639585 7:22724550-22724572 GTGCCATGCTGCGATGTGCAGGG + Intergenic
1022448376 7:30489936-30489958 GATACATGATACAATGTGGATGG + Intergenic
1023248319 7:38231255-38231277 GAGAAAAGCTGCCCTGTGGCAGG - Intergenic
1025075807 7:55942149-55942171 GAGCCCTGGTGCCATGTTGAGGG + Exonic
1025606224 7:63041767-63041789 GTGAAAGGCTGTCATGTGGAAGG - Intergenic
1027406924 7:77872047-77872069 GAGGAATGGTGCCATATGGAGGG + Intronic
1029305948 7:99620175-99620197 GGGAGATGCTGCCATGCAGAAGG + Intronic
1029853878 7:103493636-103493658 GAGAAATGCTGACATTTAGAGGG + Intronic
1031474327 7:122204404-122204426 TAGAAATGGTGCCATATGGAGGG + Intergenic
1031821195 7:126503884-126503906 GAGAAATGCTTCCATCTGGAAGG - Intronic
1032794842 7:135269127-135269149 GAGACATGTTGCTGTGGGGATGG - Intergenic
1035147344 7:156832586-156832608 GATACATGCTGCATTGTGGATGG - Intronic
1035228649 7:157447636-157447658 GACACATGCTACAATATGGAGGG - Intergenic
1035276520 7:157751194-157751216 GAGACATGCTGACATGTGAAGGG + Intronic
1036006720 8:4673381-4673403 GTGACCTGCTGCCATCTGTAAGG + Intronic
1036264047 8:7260954-7260976 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1036265343 8:7268576-7268598 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1036266644 8:7276198-7276220 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1036267950 8:7283820-7283842 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1036269254 8:7291442-7291464 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1036301252 8:7570933-7570955 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1036302551 8:7578582-7578604 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1036316087 8:7719493-7719515 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1036352106 8:8018926-8018948 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1036353405 8:8026572-8026594 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1036376643 8:8206266-8206288 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1036427994 8:8664059-8664081 GAGATATGCTGCTTTGTGGCCGG - Intergenic
1036846096 8:12171720-12171742 GAGAAAAGCTGCCCTGTGGAGGG + Intergenic
1036852894 8:12216872-12216894 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1036867461 8:12414039-12414061 GAGAAAAGCTGCCCTGTGGCGGG + Intergenic
1036874267 8:12459394-12459416 GAGAAAAGCTGCCCTGTGGCGGG - Intergenic
1036941567 8:13057331-13057353 GTGACTTGCTATCATGTGGAAGG - Intergenic
1038740631 8:30213578-30213600 GGGACAAGCAGCCAGGTGGAAGG - Intergenic
1039122566 8:34164221-34164243 GAGACATGCTTACTTGTGGAGGG + Intergenic
1040985672 8:53291604-53291626 GAGACATGTGGCCAAGTTGAAGG - Intergenic
1041357214 8:57013811-57013833 GAGGTATGCAGCCAAGTGGAGGG + Intergenic
1042212166 8:66391769-66391791 TATACATGCTGCAATTTGGAAGG + Intergenic
1044359248 8:91262044-91262066 GAGGAATGCTGCTAAGTGGAAGG - Intronic
1046585653 8:116146780-116146802 GAGAAATGGTGCCATATTGAGGG + Intergenic
1046598259 8:116286768-116286790 GAGACATGCTTCCATTAGTAAGG + Intergenic
1047161777 8:122388523-122388545 GATACATGCTGCCACATAGATGG - Intergenic
1047955765 8:129974070-129974092 CAGACAGGCTGCCCTGTGGGTGG - Intronic
1048614087 8:136055440-136055462 CAGATCTGCTGCCACGTGGAGGG + Intergenic
1049159265 8:141086948-141086970 GACTCATGCTGCCAGGTGGCAGG - Intergenic
1050026854 9:1343769-1343791 GAGACATGAGGCCATGAGGGTGG - Intergenic
1051895612 9:21984739-21984761 GAGAAAAGCTTCCATGTAGATGG - Intronic
1052014442 9:23448520-23448542 GATACATGCTACAATATGGATGG + Intergenic
1052348466 9:27434284-27434306 AAGAGATGCTGCCAAGAGGAGGG - Intronic
1056639857 9:88361166-88361188 GAGACATCATGCCATGGGGATGG - Intergenic
1056673005 9:88647449-88647471 GGGACATGCTTCCCTGTGGCTGG - Intergenic
1057215609 9:93226820-93226842 GAGCCATGGTCCCATTTGGATGG + Intronic
1060980081 9:127786541-127786563 GAGACAGGCTGCCGGGTGGCGGG + Intronic
1061188244 9:129067703-129067725 GGGACAGGCTGGCCTGTGGATGG - Intronic
1061210100 9:129186519-129186541 GAGAGACGCTGCCATGAGGAAGG - Intergenic
1061225072 9:129276685-129276707 GAGAGATGGGGCCATGTGAAGGG - Intergenic
1061656042 9:132091025-132091047 GACACATGCTACAACGTGGATGG + Intergenic
1061707953 9:132467497-132467519 GACACATGCTACAATGTGGATGG - Intronic
1061757029 9:132822561-132822583 GAGACACACTGCCAGGTTGAAGG - Intronic
1061925265 9:133803095-133803117 GAGTGAGGCTGCCCTGTGGATGG - Intronic
1062411698 9:136429076-136429098 GCGACTTGCAGCCAAGTGGAGGG + Exonic
1185492045 X:525277-525299 GACACAGGCTGCAGTGTGGATGG + Intergenic
1185492064 X:525438-525460 GAGACAGGCTGCAGTGTGGGTGG + Intergenic
1185578646 X:1193417-1193439 GACACATGTGTCCATGTGGAAGG - Intronic
1186198838 X:7136280-7136302 GTGACATGCTGCTTTCTGGATGG + Intronic
1186388305 X:9132502-9132524 AATACATGCTGACATCTGGAAGG - Intronic
1190369552 X:49727663-49727685 GAGATATGCAGACAAGTGGAGGG - Intergenic
1191727436 X:64296142-64296164 GATACATGCTGCAACATGGATGG + Intronic
1193288051 X:79737184-79737206 GAGGAATGGTGCCATATGGAGGG - Intergenic
1195179010 X:102338979-102339001 GAGATATGCAGGCAAGTGGAGGG + Intergenic
1195309810 X:103621246-103621268 GATACATGCTACAATATGGATGG + Intronic
1197342271 X:125288111-125288133 GAGATATGCAGACAAGTGGAGGG - Intergenic
1197627956 X:128824058-128824080 GAAAGATGCTTCCATATGGAAGG + Intergenic
1197807779 X:130414036-130414058 GATACATGCTACAATGTGGATGG - Intergenic
1197861228 X:130972905-130972927 GATAAATGCTCCCAGGTGGAAGG + Intergenic
1198100528 X:133418132-133418154 GATACATGTTACCATATGGATGG - Intergenic
1200792369 Y:7311080-7311102 GAGTCCTGCTGCCATCTGGTGGG - Intergenic
1202510925 Y:25573800-25573822 GAGAAACGGTGCCATATGGACGG + Intergenic