ID: 1166052028

View in Genome Browser
Species Human (GRCh38)
Location 19:40266083-40266105
Sequence GTCCCTGAGGACAGAAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166052028_1166052031 -2 Left 1166052028 19:40266083-40266105 CCTTCACTTCTGTCCTCAGGGAC 0: 1
1: 0
2: 5
3: 34
4: 323
Right 1166052031 19:40266104-40266126 ACCAGCAACCAACAGACTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 161
1166052028_1166052034 7 Left 1166052028 19:40266083-40266105 CCTTCACTTCTGTCCTCAGGGAC 0: 1
1: 0
2: 5
3: 34
4: 323
Right 1166052034 19:40266113-40266135 CAACAGACTGAGGGACGCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1166052028_1166052036 25 Left 1166052028 19:40266083-40266105 CCTTCACTTCTGTCCTCAGGGAC 0: 1
1: 0
2: 5
3: 34
4: 323
Right 1166052036 19:40266131-40266153 CGAGGCCACTGCTTCGTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 72
1166052028_1166052030 -3 Left 1166052028 19:40266083-40266105 CCTTCACTTCTGTCCTCAGGGAC 0: 1
1: 0
2: 5
3: 34
4: 323
Right 1166052030 19:40266103-40266125 GACCAGCAACCAACAGACTGAGG 0: 1
1: 0
2: 1
3: 15
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166052028 Original CRISPR GTCCCTGAGGACAGAAGTGA AGG (reversed) Intronic
900430055 1:2597120-2597142 GTCCCTGGGGACAGATGAGCAGG - Intronic
902922514 1:19675147-19675169 GTTCCTGAGGCCAGAAATGATGG + Intronic
903056538 1:20640047-20640069 GGTGCTGAGGACATAAGTGATGG - Intronic
905279758 1:36841618-36841640 GGCCCTGGGGACAGGAGTGATGG - Intronic
905758148 1:40530140-40530162 GTCCTTGAGAAGAGAAGGGATGG - Intergenic
905838211 1:41149150-41149172 GTCCCAGAGGAGAGAAGTGATGG - Intronic
905925345 1:41745687-41745709 GTCTCTGAGGACCCCAGTGAAGG + Intronic
907251595 1:53143145-53143167 GTCACAGAGGTCAGAAGTCAGGG + Intergenic
907510544 1:54954746-54954768 GTTTCTGAGGACAGAAGGGAGGG - Intergenic
908108030 1:60865845-60865867 GTCCCTGAAAACAAAAGTAAGGG - Intronic
910688929 1:89946427-89946449 GTAAATGAGGACAGAATTGAAGG + Intergenic
911685858 1:100776595-100776617 GACCCAGAGGACTGAAGAGAAGG - Intergenic
913224871 1:116690112-116690134 TTCCCCGAGGACACAAGTGAGGG - Intergenic
914194712 1:145440029-145440051 GTCCACGAGATCAGAAGTGAGGG + Intergenic
914475986 1:148022594-148022616 GTCCACGAGATCAGAAGTGAGGG + Intergenic
914509307 1:148317494-148317516 GGCCCTCAGGACAAAAGGGATGG - Intergenic
916054572 1:161059525-161059547 GTTGCTGAGGACAGCAGAGATGG - Intronic
916557520 1:165906114-165906136 GTTCCTGAGGCCAGACGTGTAGG - Intronic
916574769 1:166057674-166057696 GTCCTGGAGGACAGAAGAGCAGG - Intronic
916583454 1:166129046-166129068 GTCCCTGAGAACATAAATGTGGG + Intronic
916845280 1:168644062-168644084 GGCCCTGAGGACAGAATGTAAGG - Intergenic
917742479 1:177974465-177974487 GTCCCAGAAGCCAGAGGTGATGG + Intronic
919893881 1:201996368-201996390 TTCCCTGATCCCAGAAGTGAAGG + Intronic
920287513 1:204891202-204891224 ATCCCAGAGAACAGAAGTGAAGG + Intronic
920364329 1:205440164-205440186 GTCCCTGAGGAGGGGAGTCAGGG + Intronic
921310515 1:213838430-213838452 TTCCCTGAGCAAAGAAGTGATGG + Intergenic
922336882 1:224625080-224625102 GACACTGAGGCCACAAGTGAGGG - Intronic
923115724 1:230935854-230935876 GTCTCTGAGGAGAGAAAAGAAGG + Intronic
923574351 1:235144325-235144347 CTGCCTGAGGACAGAGGTGGAGG + Intronic
923699337 1:236284835-236284857 GTCCATCAGGACAGAATTCAGGG + Intergenic
924553137 1:245097122-245097144 GTCCCTGAGGTCACAAGTTTAGG - Intronic
1063162196 10:3426627-3426649 GCCCCTGGGGACTGAAGTGCAGG - Intergenic
1065092039 10:22244948-22244970 GTCATTTAGGAGAGAAGTGATGG - Intergenic
1065208626 10:23381331-23381353 GTCCCAGAAGACAAAAATGAAGG - Intergenic
1065967456 10:30781362-30781384 TTTCCTGAGGGCAGAGGTGAAGG - Intergenic
1067431486 10:46248817-46248839 ATCCCAGAGGACAGCAGTCAGGG + Intergenic
1068007610 10:51409121-51409143 ATCCCTGAGGAAAGCGGTGAAGG - Intronic
1068493567 10:57755771-57755793 TTTCCTGAGGACAGATGTGGAGG - Intergenic
1069705485 10:70456699-70456721 CTCCCTGAGGGCAGAGGTGGGGG + Intergenic
1069850157 10:71398868-71398890 GTGCTGGAGGACAGCAGTGAGGG + Intronic
1069902180 10:71712775-71712797 GTCCCTGAGGACATCCCTGAAGG + Exonic
1072526592 10:96277107-96277129 GGCTCTGAGGACAGAAGGCAAGG - Intergenic
1073299149 10:102460340-102460362 GTCCCTTAGCAAAGAAGTGTTGG + Intergenic
1073635354 10:105192565-105192587 GTCTCTGAGGACAGAAAAGAAGG + Intronic
1074128656 10:110553081-110553103 ATCCCAGGGAACAGAAGTGATGG - Intergenic
1074185355 10:111096300-111096322 GAGCCTGAGGGCAGAAGTTAGGG + Intergenic
1074235598 10:111581650-111581672 ATCCCTGAGGATAGTGGTGAAGG - Intergenic
1074981176 10:118621080-118621102 GCCCCAGAGGAAGGAAGTGAGGG - Intergenic
1075133355 10:119759838-119759860 GTACCTGAGGAGAGAAGAAAAGG - Intronic
1075274968 10:121085074-121085096 GACCCTTTGGACAGAAGAGAGGG - Intergenic
1075721390 10:124589660-124589682 GTCCCAGAGAACAGGAGTGAAGG - Intronic
1076343584 10:129765983-129766005 CTCCCTGAGGACTGCACTGAAGG + Intronic
1077581248 11:3418665-3418687 GTCCCTGGGGACAGGATGGAGGG + Intergenic
1079136645 11:17779330-17779352 GTCCCTGAGGACGGAAAAGCGGG - Intronic
1079406781 11:20154708-20154730 TTCTCTGAGGACTGAAATGATGG - Intergenic
1079470261 11:20771149-20771171 GTCCCAGAGGTCAGTGGTGAGGG - Intronic
1080004006 11:27385418-27385440 GTCCCCGAGGACAGTTTTGAAGG - Exonic
1080793402 11:35541038-35541060 GTCCCTGAGGGCAGAAGAGTGGG + Intergenic
1081765162 11:45605385-45605407 CTCCCTGGGGACAGAAGGGGAGG - Intergenic
1081975766 11:47233779-47233801 CTCCCTGAGGAATTAAGTGAGGG + Intronic
1082807471 11:57460147-57460169 GTCCCAGGGGACAGAAATGCTGG + Intergenic
1083725993 11:64628530-64628552 GTCCCTGAGGAGAGGAGAGCAGG + Intronic
1083789352 11:64974439-64974461 GTTCCTGAGGCCAGGCGTGATGG + Intergenic
1083797880 11:65028317-65028339 GTCACTGGGGACAGGAGTTAGGG + Intronic
1083889513 11:65588931-65588953 AGCCCTGAGGACAGAAGGGGAGG + Intronic
1084834239 11:71791331-71791353 GTCCCTGGGGACAGGATGGAGGG - Intronic
1085277112 11:75307329-75307351 CTTCCTGAGGACAGAGGTCAGGG + Intronic
1085306240 11:75487615-75487637 GTCTCTTGGGACAGAAGTGTTGG - Intronic
1085864237 11:80269638-80269660 TTCCCTGAGGACAGATGCCATGG - Intergenic
1086428825 11:86715615-86715637 TTCACTGAGGAGAAAAGTGAGGG + Intergenic
1087721260 11:101667675-101667697 GTGCCAGAGAACAGAATTGAGGG - Intronic
1088122955 11:106391121-106391143 GTGCCTGAGGAAATCAGTGAAGG + Intergenic
1089202583 11:116733278-116733300 GTCCCTGAGTACAGAGGTATAGG + Intergenic
1089491771 11:118888384-118888406 GTCCCTGAGGGCTGATGTCAAGG - Intronic
1089620190 11:119717706-119717728 GTCCCAGAGGGCAGAGGAGAGGG + Intronic
1091102869 11:132891966-132891988 GTCCTTGAGGAGAGAAGCAAGGG - Intronic
1092093341 12:5822088-5822110 ATCCCTAAGGACAGCAGTGAAGG + Intronic
1092408844 12:8239135-8239157 GTCCCTGGGGACAGGATGGAGGG + Intergenic
1096858583 12:54505480-54505502 TTGCCTGGGGCCAGAAGTGAAGG - Intronic
1096862649 12:54541018-54541040 GACTCTGGGGACAGAAGTGCTGG - Intronic
1097237512 12:57550144-57550166 GTCTCTGGGGACAGAGTTGAGGG - Exonic
1097247556 12:57614881-57614903 TCCCCTGAGGACACCAGTGAGGG - Intronic
1097986184 12:65785581-65785603 GTCCCTGAGGGCAAAATAGATGG - Intergenic
1098731115 12:74037781-74037803 AACCCTGAGGACAGCAGTGAAGG + Intergenic
1098886866 12:75969383-75969405 GTGCTTGAGGAAGGAAGTGATGG - Intergenic
1100129833 12:91478062-91478084 GTTCCTGAAGACAGAATTAAGGG + Intergenic
1100184232 12:92121726-92121748 GTAACTAAGGACAGAAGAGAAGG + Intronic
1100550865 12:95645088-95645110 GTCCCTGAGGCCAGGCGTGGTGG - Intergenic
1101647480 12:106644865-106644887 GCCCCTGAGGACAGAGAGGAGGG + Intronic
1101679885 12:106955344-106955366 GTCCCTGAGGACAGCATGCAAGG + Intergenic
1101916578 12:108900626-108900648 TTCTTTGAGGAAAGAAGTGAGGG - Exonic
1102617454 12:114166983-114167005 CTCCCTGAGGACAGAGATGTTGG - Intergenic
1103586951 12:121963178-121963200 GGCCCTGAGGGCAGAAAAGAGGG + Intronic
1103702655 12:122855812-122855834 GTCCCTGGGGACAGAGGTCCTGG - Exonic
1103769296 12:123308243-123308265 GTCTCTGTGGACAGAACTAAGGG - Intronic
1104058270 12:125246760-125246782 GTTCCTGTGGACAGAAGTGATGG + Intronic
1104924553 12:132307076-132307098 GACCCTGAGGAGAGCAGTCAGGG + Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1108305848 13:49131772-49131794 CTCCCTGAGGGCAGAGGTTATGG - Intronic
1111259541 13:85718527-85718549 GTTCCTGAGGACATACATGATGG - Intergenic
1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113725069 13:112592496-112592518 GTCTGTGAAGACAGCAGTGAAGG + Intergenic
1113839956 13:113353468-113353490 ATCCCTGAGGACTGAGGCGAGGG + Intronic
1114080491 14:19198832-19198854 GTCCATGAGGAGAGATGTGCTGG - Intergenic
1114688200 14:24555036-24555058 GTCCCAGAGCAGAGCAGTGAAGG - Intergenic
1115785215 14:36817764-36817786 GTCTCTGACCACAGAAGGGAAGG - Intronic
1116867803 14:50045401-50045423 TTCACTGGGGGCAGAAGTGAAGG - Intergenic
1118468350 14:66052309-66052331 GGCCCTGAGGCAAGAAGGGAGGG - Intergenic
1118705060 14:68472511-68472533 ATCCCTGAGGAAAGGAGTAACGG - Intronic
1118726687 14:68633792-68633814 GTCCTGGAGGACAGAGGTAAGGG + Intronic
1119544350 14:75460756-75460778 GACCCTGGGGGCAGAAGCGAGGG + Intronic
1119630517 14:76227920-76227942 CTCCCTGAGGACAGGAATCAGGG - Intronic
1119736901 14:76988390-76988412 GTCCGTGAGGAGAGAAGGAAAGG + Intergenic
1120861323 14:89257309-89257331 GTCATAGAGGACAGAAGTAAAGG + Intronic
1121941750 14:98077351-98077373 GTCCCTGTGGGCAGCAGAGAAGG - Intergenic
1122447613 14:101781278-101781300 GTCCCTGAGGACAGAAGCCAGGG - Intronic
1122541771 14:102501968-102501990 GTTCTTGAGGACAGAAGTGGAGG - Exonic
1122686497 14:103510492-103510514 GGCCCAGAGGACGGAAGGGATGG + Intergenic
1123138447 14:106052080-106052102 GTCCCTGAGTAAAGGAGAGATGG - Intergenic
1125227227 15:37408779-37408801 GTCCCTTAGCACAGCTGTGATGG - Intergenic
1125305069 15:38302685-38302707 GTGCCTGAGGAGAGAAGAGTTGG + Intronic
1131213842 15:90520635-90520657 GTGCCTGAGAACCAAAGTGAAGG + Intergenic
1131846619 15:96495593-96495615 GTCTCAGAGGACAGAGGAGATGG - Intergenic
1132089364 15:98935405-98935427 GTCTCTGAGGCCAGAAATGGAGG + Exonic
1133349815 16:5093950-5093972 GTCCCTGGGGACAGGATGGAGGG + Intronic
1134131676 16:11654559-11654581 CTCCCTCAGGACAGAAAAGAAGG - Intergenic
1135489002 16:22891733-22891755 GTCTCTGAGGAGGGAACTGAAGG - Intronic
1136140991 16:28288626-28288648 GTCCCTCAGGACTGAAGGGTCGG - Intergenic
1136479416 16:30532556-30532578 GTCCCCGCGGACAGGAGTCAGGG + Exonic
1137389272 16:48067874-48067896 GTTCCTGAGGGGAGAAGTCAAGG + Intergenic
1137562060 16:49509246-49509268 GTCCCAGGGGACAGCAGGGATGG - Intronic
1138265864 16:55659021-55659043 GTCACTGAGGACAGGCGGGATGG - Intronic
1138527518 16:57617691-57617713 GACCCTGAGGCCAGAGGTCATGG + Intronic
1140046006 16:71441087-71441109 GTCCCTGGGGAGATAAGAGATGG - Intergenic
1140279333 16:73540834-73540856 GCCTCTGAGGACATCAGTGAGGG + Intergenic
1143093794 17:4465853-4465875 GGCCCAGGGGACAGAAGAGAAGG - Intronic
1143800597 17:9376924-9376946 GTCCCTGTGGCCAGAAGTTATGG + Intronic
1145768411 17:27475259-27475281 GTCTCTGAGCACAGGTGTGAAGG + Intronic
1146667019 17:34712004-34712026 GTCTCTGAGTACAGAGGAGAGGG + Intergenic
1147272437 17:39284669-39284691 GTCCCTGAGGCCAGGCGTGATGG - Intronic
1147725537 17:42564257-42564279 GCCCCAGAGGAGAGAAGTGGGGG + Intronic
1147746477 17:42697812-42697834 GACACAGAGGACAGAAGGGAGGG + Intronic
1149307539 17:55363553-55363575 GTCCCTGACCACATTAGTGAGGG + Intergenic
1149333486 17:55609961-55609983 GTCCCTGTGGTCAGCAGGGAGGG + Intergenic
1151552559 17:74830402-74830424 GGCCGTGAGGACAGATGTGGAGG + Intronic
1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG + Intronic
1151999383 17:77635800-77635822 GTCCTGGAGGAGAGAAATGAAGG + Intergenic
1152232508 17:79121159-79121181 ATCCCTGGGGACAGAAGGGAGGG - Intronic
1152265454 17:79291683-79291705 GTCCCTGAGAACAGAGATCAAGG - Intronic
1152656633 17:81522967-81522989 GACCCCGAGGGCAGAAGCGAAGG - Intronic
1152807923 17:82365937-82365959 GTGCCTGAGGTCAAAAGTAAAGG + Intergenic
1152900830 17:82940136-82940158 GTTCCTGGGAACAGCAGTGATGG + Intronic
1153202349 18:2658995-2659017 TCCCCTAAGGACAAAAGTGATGG - Intronic
1153224128 18:2884945-2884967 ATACCTGTGGACAGAAGGGATGG - Exonic
1153331953 18:3882588-3882610 GTTCTTGAGGACATGAGTGAAGG + Intronic
1154312003 18:13274055-13274077 CTCGCTGAGGAGAGAAGAGAAGG - Intronic
1155242793 18:23879373-23879395 TTCACTGAGCGCAGAAGTGAGGG - Intronic
1155531860 18:26775559-26775581 GTCTCTGATGACAGAAGTCATGG + Intergenic
1157387054 18:47266268-47266290 GTCACTGAGGCCAGATGTGGTGG - Intergenic
1157569655 18:48704024-48704046 GTCTCTGAGTACAGAAATGAGGG + Intronic
1161678475 19:5666928-5666950 GTCACTCGGGACAGAAGTGCTGG - Intronic
1161796038 19:6387350-6387372 GTGGCTGGGGACAGAAGTGAGGG - Intronic
1163328018 19:16617829-16617851 CTCCCTTAAGGCAGAAGTGAAGG + Intronic
1163811663 19:19436394-19436416 TTCCCTGAGGCCTGAAGGGACGG - Intronic
1164052833 19:21597716-21597738 GTCCCTGATCACAGAGGGGATGG + Intergenic
1164555546 19:29248275-29248297 GTCCCTGGGGAAAGAAGAGCAGG + Intergenic
1166008923 19:39926942-39926964 GTCGCGGAGAAGAGAAGTGAGGG + Intronic
1166052028 19:40266083-40266105 GTCCCTGAGGACAGAAGTGAAGG - Intronic
1167387259 19:49171338-49171360 GTCCCTGAGGCAAGAAGAGAAGG - Exonic
1167532232 19:50025260-50025282 GTCCCCAAGTACAGAGGTGAGGG - Intronic
1167749614 19:51371867-51371889 GTCCCTGAGGACAGAGGGCAGGG - Intronic
925751293 2:7092013-7092035 ATCCCTGTGGACAGAACTCAGGG - Intergenic
925992908 2:9268368-9268390 GTGCCTAAGGACAGATGAGAAGG - Intronic
926162666 2:10499860-10499882 GACCCTGAAGAAGGAAGTGAAGG + Intergenic
926467266 2:13206282-13206304 GCCCTTGAGAACAGCAGTGAGGG + Intergenic
926662126 2:15479178-15479200 GACCCTGAGAACAGAAGACACGG + Intronic
927259343 2:21071011-21071033 GGCTCTGGGGACAGAAGAGAAGG + Intergenic
928666460 2:33554882-33554904 ATCCCTGAGGGGAGATGTGAGGG - Intronic
929535908 2:42783997-42784019 AGGCCTCAGGACAGAAGTGACGG - Intronic
929539888 2:42811194-42811216 GTCTCTGCAGACAGAAGCGAGGG - Intergenic
930372701 2:50524189-50524211 GTCCCTGAGGACGGGTGTGGTGG + Intronic
931890293 2:66663715-66663737 GTAGCTGAGGACAGAGGGGAAGG + Intergenic
932422065 2:71607017-71607039 GTCCCTGTGTACAGAATTGCTGG + Intronic
933693595 2:85198426-85198448 GCCTCTGAGACCAGAAGTGAGGG - Intronic
933759174 2:85662418-85662440 GTCCTTGAGACCAGATGTGATGG + Intronic
934035582 2:88086308-88086330 GTCCCTGAGGAGAGATCTGCTGG - Intronic
934491276 2:94763240-94763262 GTCCCTGTGGACAGCTGGGATGG - Intergenic
934926262 2:98383596-98383618 ATCCCTGTGGACAGAAGTCGGGG + Intronic
937085749 2:119170617-119170639 GTCCCTGAGAGGAGCAGTGAGGG + Intergenic
937096804 2:119240864-119240886 GTCCCTGCGGCCTGAGGTGAGGG - Intronic
937291519 2:120784942-120784964 ATCCTTGACCACAGAAGTGAGGG - Intronic
938391781 2:130912321-130912343 GTCCCAGAGGAGAGAAGTGAAGG - Intronic
939549021 2:143590501-143590523 GACCTGGAGGACAGGAGTGAGGG - Intronic
940271775 2:151898898-151898920 GGGCCTGAGGACAGAGGTAAAGG + Intronic
940676317 2:156727928-156727950 GTCCCTGAAAACAGGAGTTAGGG - Intergenic
941037921 2:160587741-160587763 GTGCAAGAGGACAGAAGTGCTGG + Intergenic
941579051 2:167272480-167272502 TTCCCTGAGGACACAGGTGAAGG - Intergenic
945024815 2:205610177-205610199 CTCCCTGAGAACAGACGTGATGG - Intronic
947484991 2:230539860-230539882 GTGCCTTTGGACAGAGGTGATGG + Intronic
948525716 2:238569772-238569794 GGCCCTCAGGACAGAACAGAAGG + Intergenic
948936441 2:241168241-241168263 ATCCCTGAGCTCAGAGGTGATGG + Intronic
1168827347 20:822853-822875 GTCCCAGAGGAGACAAGAGAGGG + Intergenic
1170417940 20:16164356-16164378 GTCCCTGGGGCCAAAAGTGTTGG - Intergenic
1172377727 20:34459042-34459064 GTCGCTGATGTCTGAAGTGAGGG - Intronic
1175201489 20:57280898-57280920 ACCCCTGAGGACAGAGGGGAGGG + Intergenic
1176177952 20:63737514-63737536 GGCCCTGGGGACAGAAGAAAGGG - Exonic
1176882902 21:14218540-14218562 GTCCTTGAAGCCAGAAGGGAAGG + Intronic
1178145149 21:29730798-29730820 GTCCCATAGGACAAAAGTGTAGG - Intronic
1178803059 21:35815080-35815102 GTCCCAGAGGTCAGGAGGGAAGG - Intronic
1179989779 21:44941630-44941652 GCCTCTGAGGGCAGAAATGAAGG - Intronic
1180307903 22:11144783-11144805 GACCCTGAGGAAAAAAATGAAGG - Intergenic
1180500288 22:15923852-15923874 GTCCATGAGGAGAGATGTGCTGG + Intergenic
1180546379 22:16506596-16506618 GACCCTGAGGAAAAAAATGAAGG - Intergenic
1181359388 22:22323135-22323157 GACTCTGAGGACAAAAGTGGTGG - Intergenic
1181369484 22:22404887-22404909 GACTCTGAGGACAAAAGTGGTGG - Intergenic
1181370393 22:22410451-22410473 GACTCTGAGGACAGAAGGGGAGG - Intergenic
1182140200 22:27948253-27948275 GTCCCAGAGGACAGATTTCAGGG - Intergenic
1182317988 22:29460359-29460381 GTGGCTGGGGACAGAAGAGAAGG + Intergenic
1183588781 22:38768136-38768158 GCCCCTGAGGGCAGAGGGGAAGG - Intronic
1183690195 22:39383896-39383918 CTCCCAAAGGACAGCAGTGATGG + Exonic
1184066677 22:42125469-42125491 GTCGGTGAGGACAGACGTGGAGG + Intergenic
1184069145 22:42137621-42137643 GTCGGTGAGGACAGACGTGGAGG + Intergenic
1184101917 22:42345208-42345230 GTCCCTGGGGGCAGGAGAGAGGG + Intergenic
1184131986 22:42522152-42522174 GTCAAGGAGCACAGAAGTGAAGG - Intergenic
1184971561 22:48025770-48025792 GTCCCTGAGGACCAGAGTGCAGG + Intergenic
1185078548 22:48696416-48696438 GTTCCTGAGGAAAGGAGGGAGGG - Intronic
950429397 3:12942154-12942176 CTCCCTGAGGACAGCAGTTTTGG + Intronic
952049460 3:29365715-29365737 GTACCTAACGGCAGAAGTGAAGG - Intronic
955663411 3:61325547-61325569 TTCTCTGATGTCAGAAGTGAAGG - Intergenic
955927129 3:64018189-64018211 CTTCATGGGGACAGAAGTGAGGG - Intronic
957054114 3:75431300-75431322 GTCCCTGGGGACAGGATGGAGGG + Intergenic
959106522 3:102071120-102071142 GTCCCTGATGACAAAAATGTTGG - Intergenic
960714270 3:120560023-120560045 GTCCCTGAGGTCAGCAGTGGGGG + Intergenic
961203749 3:125064559-125064581 GTCCATGCTGAGAGAAGTGAGGG - Intergenic
961215209 3:125154347-125154369 GACCCTGAGGTCAGAAGCCAGGG + Intronic
961300722 3:125920413-125920435 GTCCCTGGGGACAGGATGGAGGG - Intergenic
961663967 3:128485109-128485131 CTCCCTGAGGGCTGGAGTGAGGG - Intronic
961887780 3:130107675-130107697 GTCCCTGGGGACAGGATGGAGGG + Intronic
962376083 3:134859631-134859653 CTCCATGAGGACAGAAGCCAGGG - Intronic
962451947 3:135527063-135527085 GTCCCTGAAGACAGAATGAATGG + Intergenic
962867150 3:139456670-139456692 GTCCCTGAGGAGAGAACTTGTGG + Intronic
962962322 3:140322022-140322044 GGCCCTGAGGTCTGAAGAGATGG - Intronic
963326018 3:143863914-143863936 TTCCAGGAGGACAGAAGTGTTGG + Intergenic
965953144 3:174335044-174335066 TTCCCTGATGACAGCAGGGAAGG - Intergenic
967886404 3:194336618-194336640 GGCCCTGAGGACTGAAGGAAGGG - Intergenic
968845106 4:3036651-3036673 GCCTCTGAGGACAGCAGTGCCGG + Intronic
968872378 4:3248476-3248498 GCCGGTGAGGACAGCAGTGATGG - Exonic
968957971 4:3728642-3728664 CTCCCTGGGGACAGGAATGACGG - Intergenic
968996916 4:3951607-3951629 GTCCCTGGGGACAGGATGGAGGG + Intergenic
969297723 4:6279593-6279615 GGCCCTGGTGACAGGAGTGAAGG + Intronic
969757091 4:9157071-9157093 GTCCCTGGGGACAGGATGGAGGG - Intergenic
969817045 4:9694636-9694658 GTCCCTGGGGACAGGATGGAGGG - Intergenic
971856347 4:32049126-32049148 GTCCAGGAGTACAGAAGAGAAGG - Intergenic
972036316 4:34526284-34526306 GAACCAGAGAACAGAAGTGAAGG + Intergenic
974104726 4:57456763-57456785 CTACCTGATGACTGAAGTGAGGG + Intergenic
974273825 4:59689016-59689038 GTCCTTGAGTACAGATATGAGGG + Intergenic
976735134 4:88301486-88301508 TTCCCTGAGGGCAGGATTGATGG + Intergenic
978835090 4:113139662-113139684 GACTATGAGGACAGAAGTGTAGG - Intronic
981545167 4:145886032-145886054 CTTCCTGAGGACAGAAGCCAAGG - Exonic
987080639 5:14422227-14422249 GTCCCTGAGTTCTGAAGCGAGGG - Intronic
989456244 5:41647513-41647535 CTCTGTGAGGACAGAACTGAAGG - Intergenic
989609937 5:43281343-43281365 ATCCCAGAGCACAGGAGTGAAGG + Intergenic
990626156 5:57613583-57613605 TTCTCTGATGACAGAAATGAGGG + Intergenic
990797692 5:59563197-59563219 AGGCCTGAGGACAGAAGAGAAGG + Intronic
995272603 5:110239050-110239072 GTCTCTGAGGTCAGCAGTGCTGG + Intergenic
996939471 5:128986745-128986767 GTCCCTTAGGACAAAAGGAATGG + Intronic
999683470 5:154081624-154081646 CTCCCTGAGGACAGAGGTTTGGG - Intronic
1001283003 5:170401422-170401444 GTCTCTAAGGAGGGAAGTGAAGG + Intronic
1001400240 5:171442068-171442090 CTCCCTGGGGACAGAAGTTGTGG - Intronic
1002071820 5:176683132-176683154 GTCTTTGAGGAGAGCAGTGATGG + Intergenic
1002413897 5:179107940-179107962 CTGCCTGGGGACAGGAGTGAAGG + Intergenic
1004039190 6:11959146-11959168 GGCCGTGGGGAAAGAAGTGAAGG - Intergenic
1005421418 6:25655197-25655219 GTCCCTGAGGACAGATTTTTAGG - Intronic
1005581177 6:27236592-27236614 GTCCCTGAAAACAGAACAGATGG - Intergenic
1006102984 6:31697777-31697799 GTCAGTGAGGAGAGAAGTTAGGG - Intronic
1006389386 6:33749593-33749615 GTCCCTGAGGACCTGAGTGGTGG - Intergenic
1007616829 6:43184780-43184802 CTCCCTGAAGACACCAGTGAGGG - Exonic
1007987223 6:46218864-46218886 CTCCCTGAGGACAGAGAAGAAGG - Intergenic
1008764227 6:54891782-54891804 GTGCCTGATGACAAAAGTGAAGG - Intronic
1011823197 6:91276360-91276382 GACACGGAGGACAGAAATGATGG + Intergenic
1012620082 6:101333356-101333378 GACGCTGAGGTCAGAGGTGATGG + Intergenic
1012975910 6:105780889-105780911 CTCCCTGTGGGCCGAAGTGATGG + Intergenic
1016613138 6:146016159-146016181 GTCCCCAAGGATAGAAGGGAAGG - Intergenic
1016974483 6:149793633-149793655 CTCCCTGAAGACAGAAGTGTTGG - Exonic
1017072791 6:150591033-150591055 GTCCCTGAAGAGAGAACTGAGGG - Intergenic
1018490860 6:164291609-164291631 GTCCCAAAGGAGAGAAGTGGAGG + Intergenic
1020264116 7:6549053-6549075 GCCCTGGAGGACAGGAGTGAAGG + Intronic
1020321206 7:6939989-6940011 GTCCCTGGGGACAGGATGGAGGG + Intergenic
1022485501 7:30774369-30774391 ATCCCTGAGCACACAAGAGAGGG - Intronic
1024000372 7:45185461-45185483 CTCCCTGAGGACAGAGGTCCTGG + Intronic
1024348344 7:48336449-48336471 GACCCTGAGGAAAGGAGAGAGGG + Intronic
1024637364 7:51301541-51301563 GTCCCGGAGGAAAGAAGAGAGGG - Intronic
1024689203 7:51780870-51780892 GTCCCTGAAGACAAAAGGAAAGG + Intergenic
1024995403 7:55270200-55270222 GTCTGTCAGGACACAAGTGATGG + Intergenic
1026982241 7:74533576-74533598 GTGCCTGAGGACAGCACTGAAGG + Intronic
1027123514 7:75539186-75539208 TTCCATGAGGAGAGAAGAGAAGG + Intronic
1027879216 7:83812047-83812069 TTGCCTGAGGACAGAATTTATGG - Intergenic
1028718909 7:94006624-94006646 TTCCCTGAAGACTGAAATGATGG + Intergenic
1032364342 7:131285251-131285273 TTCCCTGAGGAGTGATGTGAAGG + Intronic
1032438339 7:131920814-131920836 GTGACTGTGGCCAGAAGTGAGGG + Intergenic
1033492914 7:141862090-141862112 TTCACTGAGGACAAAAGTAAGGG + Intergenic
1034477497 7:151294395-151294417 GGCCCAGAAGACAGTAGTGAAGG - Intergenic
1034697446 7:153066423-153066445 GTCACTGAGGACTGGAGTGAGGG + Intergenic
1035365811 7:158348938-158348960 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365826 7:158348988-158349010 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365841 7:158349038-158349060 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365856 7:158349088-158349110 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365871 7:158349138-158349160 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365900 7:158349239-158349261 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365915 7:158349289-158349311 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365945 7:158349389-158349411 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365960 7:158349439-158349461 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365975 7:158349489-158349511 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035365990 7:158349539-158349561 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035366005 7:158349589-158349611 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035366020 7:158349639-158349661 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035366049 7:158349740-158349762 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1035366064 7:158349790-158349812 GTCCCTGAGGGCAGTGCTGAGGG + Intronic
1036380321 8:8232386-8232408 GTCCCTGGGGACAGGATGGAGGG - Intergenic
1036849239 8:12190274-12190296 GTCCCTGGGGACAGGATGGAGGG + Intronic
1036870600 8:12432548-12432570 GTCCCTGGGGACAGGATGGAGGG + Intronic
1038254599 8:25939817-25939839 GTTCCAGAGAACAGAAATGAGGG + Intronic
1039441406 8:37597905-37597927 GTTCCTCAGCACAAAAGTGAAGG - Intergenic
1039977937 8:42383203-42383225 TTCCCTGAGGTCAGAAGGTAAGG + Intergenic
1039998599 8:42557250-42557272 GTCTCTGAGGACAGAGCTCAGGG + Intergenic
1040530301 8:48261260-48261282 GGCTCTGGGGACAGCAGTGAGGG + Intergenic
1041087024 8:54266295-54266317 GTGACTGAGGCCAGATGTGACGG + Intergenic
1044021390 8:87110129-87110151 GCCCCTGAGGACAACTGTGAGGG - Intronic
1044794652 8:95884788-95884810 TTCCCTGAGGACAGTAGTGTCGG + Intergenic
1045504195 8:102767119-102767141 ATCTCTGAGGACAGAAGGGGAGG + Intergenic
1045826816 8:106407893-106407915 GTGCCTGAGTACACTAGTGAAGG - Intronic
1046141037 8:110092502-110092524 GTCCCTCAAGACAGAAGTCCAGG - Intergenic
1047166586 8:122446122-122446144 GTCCCAGAGAAAAGAAGGGAAGG + Intergenic
1047511675 8:125520543-125520565 GTCCCTGAAGACAGCCCTGAGGG - Intergenic
1047790557 8:128199349-128199371 GTCTGAGAGGACAGAAGTGGTGG - Intergenic
1049171163 8:141161651-141161673 CTCCCTGAGTCCAGCAGTGAAGG + Intronic
1049297910 8:141853050-141853072 ACCCCGGAGGACAGAACTGAAGG + Intergenic
1050599736 9:7238383-7238405 GGCCCTGAGTTCAGAAGTTAGGG - Intergenic
1050812492 9:9766077-9766099 ATTCCTGAGGACAGTCGTGAAGG - Intronic
1051166137 9:14264105-14264127 TTCCCTGAGGCCAGAAGTCTGGG - Intronic
1053409421 9:37905978-37906000 GTGGATGAGGACAGAAATGAAGG - Intronic
1056178768 9:84061505-84061527 AGCCCTGATGACAGAGGTGAAGG + Intergenic
1056713700 9:89011532-89011554 CTCCCAGAGGACAGATGTGCAGG + Intergenic
1056950832 9:91039691-91039713 GTCCCTGAAGACAGTGGTGGAGG - Intergenic
1057992046 9:99780898-99780920 GTGTCTGGGGAAAGAAGTGAAGG + Intergenic
1058980270 9:110162413-110162435 GGACCAGAGGACACAAGTGATGG + Intronic
1059379305 9:113910715-113910737 GGCCCTGAGCACAGGTGTGAAGG - Intronic
1062191389 9:135249615-135249637 GGCCCTGGGGAGAGAAGAGAAGG + Intergenic
1062426288 9:136507661-136507683 GTCCCATAGGATAGAGGTGAGGG + Intronic
1062616588 9:137399358-137399380 GTTCCTGAGGACAGAACTGAGGG - Intronic
1185922761 X:4112523-4112545 GTGACTGAGGACAGAAGCAAAGG + Intergenic
1186494895 X:10005069-10005091 GTCCCTGATGACATAATTTACGG + Intergenic
1186901720 X:14064614-14064636 GTCGATGATGACAGGAGTGAAGG + Intergenic
1187724430 X:22187686-22187708 TTTCCTGAGGAAACAAGTGAAGG - Intronic
1188814748 X:34698697-34698719 GGCCATCAGGAAAGAAGTGAAGG + Intergenic
1189417986 X:40831786-40831808 GTCCCTGAGGGCAGCTGTGCCGG + Intergenic
1192229431 X:69254998-69255020 GGCCCTGAGGACAGCAAAGAGGG + Intergenic
1198321893 X:135526388-135526410 GTCCATGAGAAGAGAAGAGAGGG - Intronic
1199541915 X:148966962-148966984 ATCCATGAGGCCAGTAGTGATGG - Exonic
1199722349 X:150550963-150550985 GACCTTGAGAAAAGAAGTGAGGG + Intergenic
1200171987 X:154083727-154083749 GTCTCCTGGGACAGAAGTGAAGG + Intronic
1200837608 Y:7748576-7748598 ATCTCTGAGGACAGAATTGCTGG - Intergenic