ID: 1166052328

View in Genome Browser
Species Human (GRCh38)
Location 19:40267735-40267757
Sequence GGTGCATCCTAGACCCCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166052322_1166052328 10 Left 1166052322 19:40267702-40267724 CCAGACTCTCTTCATGACACCAA 0: 1
1: 0
2: 2
3: 19
4: 156
Right 1166052328 19:40267735-40267757 GGTGCATCCTAGACCCCGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
1166052326_1166052328 -9 Left 1166052326 19:40267721-40267743 CCAATCTTTTTTGGGGTGCATCC 0: 1
1: 0
2: 2
3: 5
4: 99
Right 1166052328 19:40267735-40267757 GGTGCATCCTAGACCCCGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
1166052321_1166052328 24 Left 1166052321 19:40267688-40267710 CCAGGGACACACTACCAGACTCT 0: 1
1: 0
2: 1
3: 41
4: 886
Right 1166052328 19:40267735-40267757 GGTGCATCCTAGACCCCGGATGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166052328 Original CRISPR GGTGCATCCTAGACCCCGGA TGG Intronic
906411486 1:45582985-45583007 GGAGAATACTAGAACCCGGAAGG - Intergenic
907417152 1:54322468-54322490 GCTATATCCTAGATCCCGGAGGG - Intronic
912735371 1:112145410-112145432 GATGCCTCCTAGTCCCCAGAAGG + Intergenic
1073225801 10:101917751-101917773 GGTGTTTCCTATACCCGGGAGGG - Intronic
1077440524 11:2566744-2566766 ATTGCATCCTTGACCCCGGGGGG + Intronic
1094161575 12:27396521-27396543 GTTGCTTCCTAGATGCCGGAAGG + Intronic
1098141812 12:67457648-67457670 GCTGAATCCTTGACCCCAGAGGG - Intergenic
1122323622 14:100869738-100869760 GGTTCTTCCTAGACACCAGAGGG - Intergenic
1122323809 14:100870780-100870802 GGTTCTTCCTAGACACCAGAGGG - Intergenic
1124102190 15:26705954-26705976 GGTGGATCCTGGAACCCAGATGG - Intronic
1125598967 15:40905318-40905340 GGAGAATCCTTGAACCCGGAAGG - Intergenic
1131119822 15:89815030-89815052 GGTGCATCCCAGGCCCCGGGGGG - Intronic
1132679609 16:1134349-1134371 GGGGCATCCTAGGCCCAGGACGG + Intergenic
1132812804 16:1809662-1809684 GGTACGTCCGAGACCCCAGATGG - Intronic
1132904202 16:2273859-2273881 GCTCCACCCTAGACCACGGAGGG - Intergenic
1135146456 16:19966954-19966976 GCTGCATCCTAGTCCCAGGGTGG + Intergenic
1136771558 16:32845861-32845883 GTTGCATCCTTGAGCCCGCATGG - Intergenic
1142213167 16:88817934-88817956 GGTTCATCCTGGGCCCCGGGTGG + Intronic
1203073983 16_KI270728v1_random:1107972-1107994 GTTGCATCCTTGAGCCCGCATGG - Intergenic
1145760054 17:27420693-27420715 GGTGTACCCTAGACCCTGGCAGG + Intergenic
1145998680 17:29118670-29118692 GATGCAACCTGGCCCCCGGAAGG + Intronic
1148845267 17:50526267-50526289 GGTGCTTCCAAGACCCTGGAAGG + Exonic
1149682169 17:58514324-58514346 GGTGCCTCCTAGGCCCCCAAAGG + Intronic
1150239637 17:63621827-63621849 GGGGCCTCCGAGAACCCGGAGGG + Intergenic
1154124602 18:11679182-11679204 GGTGAACCCAAGACCCAGGAGGG - Intergenic
1163469237 19:17487106-17487128 GGTGCATCCCAGGCCTCGGGAGG + Intronic
1166039225 19:40191917-40191939 GGAGCTCCCTAGACCCCGCAGGG + Exonic
1166052328 19:40267735-40267757 GGTGCATCCTAGACCCCGGATGG + Intronic
925324835 2:3010306-3010328 TGTGCAGCCTGGACCCCGGAGGG - Intergenic
932025126 2:68124836-68124858 TGTCCATCCTAGACCCAGTAGGG + Intronic
932056619 2:68449485-68449507 GGAGCATCCTGGATCCTGGATGG - Intergenic
937338718 2:121077425-121077447 GATGCATCCCAGACTCTGGAAGG - Intergenic
942497387 2:176553931-176553953 AGTGCTGCCTGGACCCCGGAGGG - Intergenic
945335821 2:208591881-208591903 AGGGCATCCTAGATCCTGGAGGG + Intronic
948424222 2:237877453-237877475 GATCCTTTCTAGACCCCGGAAGG + Intronic
1173866384 20:46315056-46315078 AGAGAATCCTGGACCCCGGAAGG - Intergenic
1174542271 20:51298875-51298897 TGTGCATCCTACAGCCAGGAAGG + Intergenic
1180626706 22:17198721-17198743 GGCTCTTCCAAGACCCCGGAGGG - Intronic
1181314871 22:21964527-21964549 GCTGAATCCTACACCCAGGATGG + Intronic
949480178 3:4486325-4486347 GGAGAATCCTGGAACCCGGATGG - Intergenic
954792681 3:53144707-53144729 GGTGCCTCCTAGTCCTCTGAGGG - Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
969354287 4:6616196-6616218 GGTGCTTCCTAAACCCTGGCTGG - Intronic
972291563 4:37694558-37694580 GGTCCATGCTAAACCCAGGATGG - Intergenic
977148781 4:93481848-93481870 AGTGCATCTTAGATCCCAGAGGG + Intronic
978593188 4:110348874-110348896 GGAGCAACCTAGACCCCACAGGG + Intergenic
979877736 4:125914316-125914338 GGAGAATCCTTGAACCCGGAAGG + Intergenic
985647962 5:1093921-1093943 GGAGCACCCTAGATCCAGGAAGG + Intronic
986809483 5:11340453-11340475 GGTACATCCTGGCCCCAGGATGG - Intronic
988307840 5:29516252-29516274 GGTGCATCCTAGACTCCCTCGGG - Intergenic
996616610 5:125449573-125449595 GGTGCAACATAGACCAGGGAAGG - Intergenic
1001765205 5:174240317-174240339 GGTGCACCATAGACCCAGCAGGG + Intronic
1006866747 6:37214809-37214831 AGTGCACCCTAGAACCTGGAGGG + Intronic
1006985043 6:38170361-38170383 GGTGCAGCCAAGAGCCAGGAAGG + Exonic
1019340863 7:508175-508197 TGTGACTCCTAGGCCCCGGAGGG - Intronic
1041414279 8:57590125-57590147 CTTGCATCAGAGACCCCGGAAGG - Intergenic
1049844532 8:144793436-144793458 GGTGTTTCCTAGACCCTGCAGGG + Intergenic
1053002735 9:34586192-34586214 GCTGCATCCTAGGCCCCCCAGGG + Intronic
1056774077 9:89498541-89498563 GGTTCATCCAGGACCCCAGAAGG - Intergenic
1059389359 9:113989089-113989111 GGTGCATGCTGGAGACCGGAGGG - Intronic
1060166914 9:121425029-121425051 GGTGCATGGTAGACTGCGGAAGG - Intergenic
1185474128 X:403528-403550 GGTCCTTCCTCAACCCCGGAAGG + Intergenic
1192549459 X:72042402-72042424 GGTTCATCCTAGACCCCAATGGG - Intergenic
1200165877 X:154034775-154034797 GCTGCTCCCTAGAACCCGGACGG + Intronic