ID: 1166052928

View in Genome Browser
Species Human (GRCh38)
Location 19:40271335-40271357
Sequence GAGGTTGACCTGAGCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22959
Summary {0: 1, 1: 22, 2: 864, 3: 5238, 4: 16834}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166052919_1166052928 11 Left 1166052919 19:40271301-40271323 CCTGTAGTTTCAGGTACCTGGGA No data
Right 1166052928 19:40271335-40271357 GAGGTTGACCTGAGCCTGGGAGG 0: 1
1: 22
2: 864
3: 5238
4: 16834
1166052925_1166052928 -5 Left 1166052925 19:40271317-40271339 CCTGGGAGGCTGAGGTGGGAGGT 0: 19
1: 846
2: 2122
3: 3102
4: 12004
Right 1166052928 19:40271335-40271357 GAGGTTGACCTGAGCCTGGGAGG 0: 1
1: 22
2: 864
3: 5238
4: 16834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166052928 Original CRISPR GAGGTTGACCTGAGCCTGGG AGG Intronic
Too many off-targets to display for this crispr