ID: 1166053350

View in Genome Browser
Species Human (GRCh38)
Location 19:40274241-40274263
Sequence CTGGGGACACAGTGGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 602}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166053350_1166053361 -1 Left 1166053350 19:40274241-40274263 CCTAGCCCCCACTGTGTCCCCAG 0: 1
1: 0
2: 8
3: 81
4: 602
Right 1166053361 19:40274263-40274285 GCTCCACTCAGCACAGGGATGGG 0: 1
1: 1
2: 1
3: 16
4: 187
1166053350_1166053357 -6 Left 1166053350 19:40274241-40274263 CCTAGCCCCCACTGTGTCCCCAG 0: 1
1: 0
2: 8
3: 81
4: 602
Right 1166053357 19:40274258-40274280 CCCCAGCTCCACTCAGCACAGGG 0: 1
1: 0
2: 6
3: 43
4: 395
1166053350_1166053367 24 Left 1166053350 19:40274241-40274263 CCTAGCCCCCACTGTGTCCCCAG 0: 1
1: 0
2: 8
3: 81
4: 602
Right 1166053367 19:40274288-40274310 CATAACTTTCATTACTTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 176
1166053350_1166053366 23 Left 1166053350 19:40274241-40274263 CCTAGCCCCCACTGTGTCCCCAG 0: 1
1: 0
2: 8
3: 81
4: 602
Right 1166053366 19:40274287-40274309 CCATAACTTTCATTACTTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1166053350_1166053360 -2 Left 1166053350 19:40274241-40274263 CCTAGCCCCCACTGTGTCCCCAG 0: 1
1: 0
2: 8
3: 81
4: 602
Right 1166053360 19:40274262-40274284 AGCTCCACTCAGCACAGGGATGG 0: 1
1: 0
2: 1
3: 17
4: 264
1166053350_1166053369 26 Left 1166053350 19:40274241-40274263 CCTAGCCCCCACTGTGTCCCCAG 0: 1
1: 0
2: 8
3: 81
4: 602
Right 1166053369 19:40274290-40274312 TAACTTTCATTACTTCAGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 143
1166053350_1166053364 22 Left 1166053350 19:40274241-40274263 CCTAGCCCCCACTGTGTCCCCAG 0: 1
1: 0
2: 8
3: 81
4: 602
Right 1166053364 19:40274286-40274308 CCCATAACTTTCATTACTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 150
1166053350_1166053355 -7 Left 1166053350 19:40274241-40274263 CCTAGCCCCCACTGTGTCCCCAG 0: 1
1: 0
2: 8
3: 81
4: 602
Right 1166053355 19:40274257-40274279 TCCCCAGCTCCACTCAGCACAGG 0: 1
1: 2
2: 5
3: 41
4: 349
1166053350_1166053368 25 Left 1166053350 19:40274241-40274263 CCTAGCCCCCACTGTGTCCCCAG 0: 1
1: 0
2: 8
3: 81
4: 602
Right 1166053368 19:40274289-40274311 ATAACTTTCATTACTTCAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166053350 Original CRISPR CTGGGGACACAGTGGGGGCT AGG (reversed) Intronic
900186872 1:1336870-1336892 CCGGGGGGACAGTGGGGCCTTGG - Intronic
900314395 1:2049908-2049930 CTGGGGGCGGAGTGGGGGCTGGG + Intergenic
900410715 1:2511286-2511308 CTGGGGACACAGCGGGGCCCGGG - Intronic
900477035 1:2880758-2880780 GTGGGAACCCAGTGGGGGCCGGG + Intergenic
900478651 1:2887858-2887880 CTAGGGGCACACAGGGGGCTAGG - Intergenic
900490427 1:2946206-2946228 CTGGGGGCACAGTGAGGGTGGGG - Intergenic
900792905 1:4691474-4691496 CTGGGTACACAGTGGGGCTCGGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901305044 1:8226767-8226789 CTGGGGACACAGGGGGGCCCAGG + Intergenic
902251136 1:15154743-15154765 CTGGGGAAACCGTGGGGGAGGGG - Intronic
902379346 1:16045346-16045368 GTGGTGACACAGTGGGTGCCAGG - Intronic
902603549 1:17556122-17556144 CTGGAAACACAGGGGGGCCTGGG + Intronic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
902841819 1:19079333-19079355 CGGGAGAGAAAGTGGGGGCTTGG - Intronic
903300563 1:22375765-22375787 CTGGGAACACAGTGGATGCTCGG + Intergenic
903434207 1:23334207-23334229 CTAGAAAGACAGTGGGGGCTGGG - Intronic
903462596 1:23530129-23530151 CTGGGGACACTGTGGGACTTTGG - Intronic
903891494 1:26573201-26573223 CTGGGGACACAGTGGGCAAGGGG - Intronic
903919023 1:26786696-26786718 CTGGGGACACACTTGTGACTGGG - Intergenic
904452046 1:30619615-30619637 CTGGGAACACAGTGAGAGTTAGG - Intergenic
904587564 1:31588647-31588669 GGGGGGACGCAGTGGAGGCTTGG - Intergenic
904835217 1:33331316-33331338 CTGGGGAAATGGAGGGGGCTGGG + Intronic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
905315037 1:37077022-37077044 CTGATGACCCAGTGGGGCCTGGG - Intergenic
905340504 1:37274425-37274447 CTGGGGACTCACTGTGGCCTGGG - Intergenic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
906484209 1:46221976-46221998 CTGGGGACAGGGTGGGGGAAGGG - Intergenic
906666949 1:47628635-47628657 CTGGGGATGGAGTGGGGGGTGGG + Intergenic
907111008 1:51926265-51926287 CTGGGGACACAGAGGTGAATGGG - Intronic
907314731 1:53560999-53561021 GGGGGCACACAGTAGGGGCTTGG - Intronic
907314740 1:53561026-53561048 CCTGGCACACAGTAGGGGCTCGG - Intronic
907444977 1:54501669-54501691 ATGGGTACACAGTGGGGTCCCGG - Intergenic
907857620 1:58319122-58319144 GTGGGGAGAAAGAGGGGGCTGGG + Intronic
909056228 1:70824540-70824562 CTGGAGACATAGTCGGGGCCAGG - Intergenic
910888417 1:91991090-91991112 TTAGAAACACAGTGGGGGCTGGG - Intronic
911181769 1:94867211-94867233 CTGGGGAAACACTGGTGGCGTGG - Intronic
912800489 1:112716807-112716829 CTGGGGACACAGTTTAGCCTGGG - Intergenic
913680926 1:121186545-121186567 CTGGGGCCACGTCGGGGGCTAGG + Intronic
913962427 1:143350715-143350737 CTCAGGACACAGTGTGGGCAGGG + Intergenic
914032756 1:143974184-143974206 CTGGGGCCACGTCGGGGGCTAGG + Intergenic
914056782 1:144176292-144176314 CTCAGGACACAGTGTGGGCAGGG + Intergenic
914122364 1:144790070-144790092 CTCAGGACACAGTGTGGGCAGGG - Intergenic
914156688 1:145093781-145093803 CTGGGGCCACGTCGGGGGCTAGG - Intronic
914424786 1:147565836-147565858 CTTGGGACATAGTAGGTGCTTGG + Intronic
915229120 1:154432828-154432850 GTGGGGCCTCAGTGGGGGCTGGG - Intronic
915586410 1:156846102-156846124 CTTGGGGCACCGTGGGAGCTAGG + Exonic
915592824 1:156880285-156880307 GAGGGGACACAGTGTGGGCACGG - Intronic
915988376 1:160489240-160489262 CTGGGGACACAGTGTGCTCTGGG - Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
918116927 1:181505895-181505917 CTTGGCACACAGTGGGGCCCCGG - Intronic
919481918 1:198100420-198100442 CTGGAGACAAACTGAGGGCTTGG + Intergenic
919838991 1:201595590-201595612 CTGGGGGCATAGTGGGGCCAGGG + Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920045466 1:203129500-203129522 ATGGGGTCACAGTGAGTGCTGGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920468239 1:206205069-206205091 CTGGGGCCACGTCGGGGGCTAGG + Intronic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
921390450 1:214608858-214608880 CTGGGGCCCCGGTGGGGGCCTGG - Intronic
923633284 1:235669900-235669922 CTGGGAGCAGAGTGGGGGGTGGG + Intronic
924551354 1:245080931-245080953 CTGCTGACACATTGGCGGCTAGG - Intronic
924708784 1:246518210-246518232 ATGGGGACTCAGTGGGTGTTCGG - Intergenic
1062788947 10:289203-289225 CTGGGGACAGGGTGCGGGCAGGG + Intronic
1062835075 10:629976-629998 CGGGGGACACTGTGGGGAATAGG - Intronic
1066312092 10:34207007-34207029 CTGGGCACACAGTGACAGCTAGG - Intronic
1067015822 10:42755649-42755671 CTAGTGCCACAGTGGAGGCTAGG - Intergenic
1067111692 10:43405955-43405977 CTTGGGACCCAGTTGGGACTGGG + Intronic
1067171766 10:43912620-43912642 CTGGGGAAGCAATGAGGGCTGGG - Intergenic
1067513949 10:46920700-46920722 CTGAGGCCACTGTGGGGGCTGGG + Intronic
1067648305 10:48131132-48131154 CTGAGGCCACTGTGGGGGCTGGG - Intergenic
1068607021 10:59016851-59016873 CTGGGAACACAGTGGCTGCTTGG - Intergenic
1069857894 10:71451765-71451787 CTGGGGACACAGTGATGGCCAGG - Intronic
1070344778 10:75531126-75531148 CTAGGGTTACAGTGGAGGCTGGG + Intronic
1070348642 10:75570356-75570378 CTGGGGATACAGTGGTGGACAGG + Intronic
1070382462 10:75893231-75893253 CTGAGGGCTCAGTGGGTGCTAGG + Intronic
1070833558 10:79434500-79434522 CTGGGGTCACAGTAAGAGCTTGG - Intronic
1071292887 10:84200443-84200465 GTGAGCACCCAGTGGGGGCTGGG - Intronic
1072411247 10:95203986-95204008 CTGGGGAAACACTGGGAGCCTGG - Intronic
1072871637 10:99126277-99126299 CTGCGGCCACTGTGGGGGATTGG - Intronic
1073321581 10:102619333-102619355 CTGGGGAGCCAGCGGGTGCTGGG - Intronic
1073461251 10:103667184-103667206 CAGGGGAGGCAGTGTGGGCTGGG - Intronic
1073575868 10:104622612-104622634 ATGGGTAGAAAGTGGGGGCTGGG - Intergenic
1074780770 10:116800435-116800457 CTCAGGACACAGTGGGGTCTAGG - Intergenic
1074912269 10:117922099-117922121 CTGGGGACACAGTGGTGCGTCGG - Intergenic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075615131 10:123885201-123885223 CTGGGGACTCAGGGTGGGGTTGG + Intronic
1076312403 10:129517774-129517796 GTGGGGTCACAGTGAGGGTTTGG - Intronic
1076683140 10:132185631-132185653 CTCGGGACACACTGGGCGCTGGG - Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076794129 10:132790581-132790603 GTGGGGCCACAGTGGGTGCCCGG + Intergenic
1076935566 10:133566156-133566178 CTGGGGCCACCGTGGAGGCCCGG + Intronic
1077340983 11:2026234-2026256 GTGGGTACACAGTGGGCACTTGG - Intergenic
1077392903 11:2308231-2308253 CTGGGGAGAGCGTGGGCGCTGGG - Intronic
1077425310 11:2473311-2473333 CTGGGGACTCAGGGAGGGTTGGG + Intronic
1077429207 11:2507683-2507705 CTGGGGAGAGAGTGCGGGCTGGG + Intronic
1077551872 11:3204083-3204105 TGGGGGGCAGAGTGGGGGCTGGG - Intergenic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1079125267 11:17714337-17714359 CTGGGGACAGAGAGGGGACCTGG + Intergenic
1079205673 11:18412477-18412499 CTGGGGTGAAAGTGGTGGCTGGG + Intronic
1079239006 11:18709364-18709386 GTGAGGACACAGAGAGGGCTGGG - Intronic
1081646080 11:44791622-44791644 CTGGGGACACAGGGGGGACCAGG - Intronic
1081668833 11:44932156-44932178 CTGGGGAGACGGCGGGTGCTGGG - Exonic
1081802581 11:45869975-45869997 CTGGGGGCACTGTGGTGACTTGG + Intronic
1081810825 11:45913339-45913361 CAGGTGACTGAGTGGGGGCTGGG + Intronic
1081814130 11:45929176-45929198 CTGGGGTCACAGGAGGGCCTGGG + Intergenic
1081988463 11:47324637-47324659 CTGGGGAAGTACTGGGGGCTTGG - Intronic
1082011677 11:47453895-47453917 CTGCGGACACAGTGGGATCTCGG + Intergenic
1082756043 11:57077701-57077723 CTGGCCACACAGTGGAGTCTTGG - Intergenic
1083278180 11:61609207-61609229 CTGTGGACACAGTGAGGCCCCGG - Intergenic
1083717796 11:64588470-64588492 CTAGGCACACAGTGAGGGGTTGG + Intergenic
1083893504 11:65608549-65608571 CTGGGGGCACAGAGGTGACTTGG + Intronic
1084296195 11:68214352-68214374 CGGGGCACATAGTGGGTGCTGGG - Intergenic
1084399528 11:68935647-68935669 CTGGGGGCGCAGGGTGGGCTGGG + Intronic
1084502103 11:69540870-69540892 CCGGGGTTTCAGTGGGGGCTGGG - Intergenic
1084560834 11:69904760-69904782 CTGGGGACACTGTGGGAATTGGG - Intergenic
1084560918 11:69905030-69905052 CTGGGGACACTGTGGGGATGGGG - Intergenic
1084562010 11:69910538-69910560 ACGGTGACACAGTGAGGGCTGGG + Intergenic
1084657035 11:70525714-70525736 CAGGGGGCAAAGTGGTGGCTTGG - Intronic
1084889516 11:72229874-72229896 CAGGGGACACACTGAAGGCTGGG - Intronic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1085030994 11:73270788-73270810 CCTGGCACAGAGTGGGGGCTTGG + Intronic
1085303796 11:75473851-75473873 CTGGGGAAACCCTGGGGGCAGGG - Intronic
1085311292 11:75518392-75518414 CTTGGGACACTGTGGGAGGTAGG + Intronic
1085348534 11:75783592-75783614 ATGGGCACACAGTAGGTGCTTGG + Intronic
1085449369 11:76622798-76622820 TTGGGCACAGAGTGGGGGATGGG - Intergenic
1086035132 11:82405564-82405586 GTGGGCTCACAGTGGGGCCTGGG - Intergenic
1087006870 11:93479817-93479839 CTTGGCACACGGTGGGTGCTTGG - Intronic
1088693041 11:112344052-112344074 CTGGAGGCACAGTGGGGGTGGGG + Intergenic
1089599539 11:119604991-119605013 CCAGGGAGACACTGGGGGCTGGG + Intergenic
1090226440 11:125074803-125074825 CTGGGGCCCCAGTGGGGCCTTGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090667759 11:128926111-128926133 CTTGGGACACAGAAGGGGCTTGG - Intergenic
1090948140 11:131449473-131449495 CTGGTGGCAGAGTGTGGGCTAGG + Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1202823968 11_KI270721v1_random:81423-81445 GTGGGTACACAGTGGGCACTTGG - Intergenic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1091593629 12:1860254-1860276 CTGGGGGCGAGGTGGGGGCTGGG - Intronic
1091754416 12:3042338-3042360 TTGGTAAGACAGTGGGGGCTGGG - Intergenic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097197124 12:57249207-57249229 ATGGGGAGGCAGTGGGAGCTGGG - Exonic
1100398622 12:94207372-94207394 CTGGGGACAAATTGGGGGTGAGG - Intronic
1101597902 12:106183484-106183506 GTGTGGGCACAGTGGTGGCTGGG + Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1101830247 12:108251319-108251341 CTGGGGACAGAGTGTAGCCTGGG - Intergenic
1102521261 12:113478709-113478731 CTGGGGGAAGAGTGGGGGCCTGG - Intergenic
1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG + Intronic
1103993077 12:124812111-124812133 CTGGGGACCGAGAGGAGGCTTGG + Intronic
1104667198 12:130656059-130656081 CTGGGGACACGGTGGAGGGTGGG + Intronic
1104945111 12:132412227-132412249 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945125 12:132412264-132412286 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945131 12:132412282-132412304 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945165 12:132412408-132412430 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945171 12:132412426-132412448 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945177 12:132412444-132412466 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945189 12:132412480-132412502 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945202 12:132412516-132412538 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945209 12:132412534-132412556 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945227 12:132412589-132412611 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945247 12:132412661-132412683 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945258 12:132412697-132412719 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945264 12:132412715-132412737 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945275 12:132412751-132412773 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945281 12:132412769-132412791 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945293 12:132412805-132412827 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945316 12:132412878-132412900 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945323 12:132412896-132412918 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945335 12:132412932-132412954 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945343 12:132412951-132412973 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945349 12:132412969-132412991 CTGGGGTGTCAGTGGGGCCTAGG + Intergenic
1104945386 12:132413080-132413102 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945393 12:132413098-132413120 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945420 12:132413172-132413194 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945427 12:132413190-132413212 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945450 12:132413263-132413285 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945457 12:132413281-132413303 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945469 12:132413317-132413339 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945477 12:132413336-132413358 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945484 12:132413354-132413376 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945521 12:132413465-132413487 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945528 12:132413483-132413505 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945566 12:132413593-132413615 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945584 12:132413647-132413669 CTGGGGTGTCAGTGGGGCCTGGG + Intergenic
1104945591 12:132413665-132413687 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945606 12:132413703-132413725 CTGGGGTGTCAGTGGGGTCTGGG + Intergenic
1104945612 12:132413721-132413743 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104950299 12:132436965-132436987 CAGGGGAGCCAGTGGGGGTTGGG - Intergenic
1104975968 12:132552117-132552139 ATGGGGCCACAGTGGGGCCTGGG + Intronic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106398678 13:29406489-29406511 CTGGGGGTACAGTGGGGGTGAGG - Intronic
1106587918 13:31073220-31073242 GTGGGGACACACTGGGGGTAGGG - Intergenic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1108003335 13:45924301-45924323 TTGGGGACACATTGATGGCTGGG - Intergenic
1108215879 13:48184072-48184094 ATGGGGCCTCACTGGGGGCTAGG - Intergenic
1110704497 13:78589189-78589211 ATGGGGGCATGGTGGGGGCTGGG - Intergenic
1111225594 13:85266740-85266762 CTGTGGACACTGTGGAGGATGGG - Intergenic
1111833680 13:93360898-93360920 CTGGCCACACAGTGGGGTCACGG - Intronic
1112253827 13:97809135-97809157 GGGGGGAGACAGTGGGGGCAGGG + Intergenic
1113437315 13:110303337-110303359 CTGGGGCCTCAGTTGGAGCTGGG + Intronic
1113642866 13:111970750-111970772 CTTGGGACACAGCGAGGCCTTGG + Intergenic
1113780494 13:112974023-112974045 CTGATGAAACAGTGGGGGATGGG - Intronic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1113965067 13:114147955-114147977 CTGGGTTCTCCGTGGGGGCTGGG - Intergenic
1113965193 13:114149021-114149043 CTGGGATCTCCGTGGGGGCTGGG + Intergenic
1114438237 14:22726065-22726087 CTGGAGACACCGTGGGGGAGTGG - Intergenic
1114671038 14:24411226-24411248 TTGGTGACACTGTGGAGGCTGGG - Intronic
1114878351 14:26751843-26751865 GTGGGGCCACAGGGGGGGTTTGG + Intergenic
1115504841 14:34083855-34083877 CTGGGTACACAGTGGACCCTTGG - Intronic
1115531359 14:34331045-34331067 GTGGGGTCACAGTGGGTGGTGGG - Intronic
1117275909 14:54192973-54192995 ATGGGGAAGCAGTGGGTGCTTGG - Intergenic
1117650526 14:57900192-57900214 CTGGGTCCCCAGTGGGGCCTTGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119773440 14:77235460-77235482 CTGGGGAGACTGTGGTGGGTGGG + Intronic
1119773497 14:77235636-77235658 CTGGGGAGACTGTGGTGGGTGGG + Intronic
1119773642 14:77236050-77236072 CTGGGGAGACTGTGGTGGGTGGG + Intronic
1119773678 14:77236157-77236179 CTGGGGAGACTGTGGTGGGTGGG + Intronic
1119881293 14:78101782-78101804 ACGGGGACACAGGGGGGGCTTGG + Intergenic
1121245276 14:92457555-92457577 CTGGCCACATAGTAGGGGCTTGG + Intronic
1121449077 14:93996415-93996437 CTGGGGCCAGGGTCGGGGCTGGG - Intergenic
1121584165 14:95051489-95051511 CTGGGCACACAGTGTAGCCTAGG - Intergenic
1121669208 14:95695158-95695180 CTGGGGACCAGCTGGGGGCTCGG - Intergenic
1121991623 14:98563345-98563367 TTGGGGACACTGTGGGAGCTGGG - Intergenic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1122234237 14:100323041-100323063 CAGGGGACACAGTGAAGGCCTGG + Intergenic
1122271495 14:100570316-100570338 CTGGTGGAGCAGTGGGGGCTGGG + Intronic
1122767551 14:104082439-104082461 CAGGGGCCAGAGTGGGGCCTGGG - Intergenic
1122870703 14:104636991-104637013 CTGCCCACACAGTGGGCGCTGGG + Intergenic
1122920389 14:104877528-104877550 ATGGGGCCAAGGTGGGGGCTGGG + Intronic
1124239912 15:28020260-28020282 AAGGGGACACACTGGGGCCTGGG + Intronic
1124634400 15:31355828-31355850 GTGGGGACAAATGGGGGGCTGGG - Intronic
1125283032 15:38063403-38063425 CTGGGCACAGAGCCGGGGCTTGG - Intergenic
1125749439 15:42018773-42018795 CTGGGGACCTACTGGGGACTGGG + Intronic
1126331470 15:47536414-47536436 TTGGGGACACAATGAAGGCTTGG + Intronic
1126790179 15:52213824-52213846 GTGGGGATGCAGCGGGGGCTGGG + Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127398560 15:58563176-58563198 CTGTGGAGACAGTGGGGCTTTGG - Intronic
1127964246 15:63912064-63912086 CGGGGGACAGGGTGGGGGCTAGG - Intronic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1128701509 15:69807896-69807918 CTGGGCACTCAGTGGCTGCTGGG - Intergenic
1128702443 15:69814114-69814136 CCGGGCACACAGCGGGGGCTGGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129540164 15:76342134-76342156 ATGGGGACACAGGTGGGGCGTGG - Exonic
1129598190 15:76981286-76981308 TTGGGGAGGCAGTGGGGGCGGGG - Intergenic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1130486072 15:84399108-84399130 CTAGGGACATGGTGGGGTCTGGG + Intergenic
1132558545 16:583339-583361 CTGGGTACACAGGGTGGGCATGG - Exonic
1132672270 16:1106718-1106740 GCGGGGCCACAGTGGGGGCATGG - Intergenic
1132701582 16:1224499-1224521 CTGGGGTCCCAATGGGGGCCCGG - Intronic
1132727632 16:1345697-1345719 CTGGGGAGGCAGGGGAGGCTGGG - Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133002993 16:2860465-2860487 CTGGGGAAACAGTGTGGGCAGGG + Intergenic
1133231077 16:4366913-4366935 CTGGCAACACAGTGGGGACGGGG - Intronic
1133233736 16:4378325-4378347 CTGCGGCCACAGTGGTGGCCAGG + Intronic
1134307421 16:13045751-13045773 TGGGGGACACAGTGGGGGCAGGG - Intronic
1134821660 16:17251926-17251948 GTGGGGACAGGGAGGGGGCTGGG + Intronic
1135193288 16:20372955-20372977 CTGGGGCCACTGTGTGTGCTTGG - Intronic
1136087742 16:27897642-27897664 TGGGGGCCACAGTGCGGGCTAGG - Intronic
1136509103 16:30724851-30724873 CTGGGGACTGTGTGGAGGCTGGG - Exonic
1137724547 16:50648147-50648169 CTGGGTTCACAGTGGGGCCCAGG - Intergenic
1137769292 16:51003355-51003377 CTGGGGGCAAAGGCGGGGCTCGG - Intergenic
1138337810 16:56266951-56266973 ATGTGGACACGGTGGCGGCTGGG - Intronic
1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG + Intronic
1138458089 16:57132762-57132784 CAGGTCACACAGTGGGGCCTGGG - Intronic
1138560177 16:57796532-57796554 CGGGGGACTCAGAGGGGCCTGGG + Intronic
1139375493 16:66494026-66494048 CTGGGGGTATAGTGGGTGCTGGG - Intronic
1140043311 16:71423942-71423964 CTGGGGAGACAGAGAAGGCTTGG + Intergenic
1140333121 16:74076780-74076802 CTGGGGAAGGAGTGGGGGCTAGG - Intergenic
1141534592 16:84670304-84670326 CTGGGCACCCAGTGCAGGCTCGG - Intergenic
1141666437 16:85468032-85468054 CCAGGGACACAGTGAGGGATGGG - Intergenic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142144345 16:88486617-88486639 CTGGGTGCACAGTGGGTACTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144357 16:88486675-88486697 CTAGGTACACAGTGGGTGCTGGG + Intronic
1142144366 16:88486710-88486732 CTGGGGGCACAGTGGATGCTGGG + Intronic
1142144381 16:88486785-88486807 CTGGGTGCACAGTGGATGCTGGG + Intronic
1142144388 16:88486825-88486847 CTGGGTGCACAGTGGATGCTGGG + Intronic
1142189850 16:88712779-88712801 CTGGGGGTCCAGCGGGGGCTGGG - Exonic
1142201450 16:88762920-88762942 CTGGGTATAAGGTGGGGGCTCGG - Intronic
1142403774 16:89874359-89874381 CTGGGGCCACCGTGGGGGTGGGG + Intronic
1142492101 17:285986-286008 CGGGGTGCACAGTGGGGCCTGGG - Intronic
1142605598 17:1079439-1079461 CCAGGCTCACAGTGGGGGCTGGG - Intronic
1142641933 17:1289371-1289393 ATGGGGAACCAGTGGGGGATGGG - Intronic
1142803250 17:2358113-2358135 GTGGGGTCACAGTGGGGACCTGG + Intronic
1143013898 17:3881553-3881575 CTGGGGACACAGGGAGGGAAAGG + Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143498811 17:7327213-7327235 CTGGGGACACCATGAAGGCTGGG + Exonic
1144848841 17:18233956-18233978 CCGGGCACACAGTGGGTGCTGGG - Intronic
1145263762 17:21369642-21369664 CCGGGGGCCCAGTGTGGGCTGGG - Intergenic
1146532440 17:33620877-33620899 CTGGAGAGGCTGTGGGGGCTGGG - Intronic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1147614905 17:41822042-41822064 CTGGGGTCCTGGTGGGGGCTGGG - Intronic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1147900162 17:43778659-43778681 CGGGAGCCACAGCGGGGGCTTGG - Intronic
1147979966 17:44268241-44268263 CTGGGCACCCAGTGGGAGCGGGG - Intergenic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148235776 17:45968052-45968074 CTGGGGCCTCAGTGGGGGACAGG - Intronic
1148644430 17:49211025-49211047 GAAGGGGCACAGTGGGGGCTTGG - Intronic
1148778916 17:50110860-50110882 GTCTGGGCACAGTGGGGGCTGGG - Exonic
1149517751 17:57293212-57293234 CTGGGGCCACAGGGGAGGCTGGG + Intronic
1149695093 17:58610406-58610428 GAGGGGACACAGTGGGGTTTGGG - Intronic
1150338018 17:64344119-64344141 CCAGGCCCACAGTGGGGGCTGGG + Intronic
1151177636 17:72301807-72301829 CTGGGGTCAGGGTGGGGGCAGGG + Intergenic
1151253248 17:72854299-72854321 CTGGGGATGAAGTGGGGGGTGGG + Intronic
1151370481 17:73643984-73644006 GTGGGGACAGGGAGGGGGCTGGG - Intronic
1151437201 17:74105139-74105161 CTGGGGACACAGTAAGGAATGGG + Intergenic
1151477638 17:74352975-74352997 CAGGGCACAGGGTGGGGGCTGGG - Intronic
1151955369 17:77377569-77377591 CTCGGGCGACAGTGGGGGCTCGG - Intronic
1152073152 17:78143985-78144007 CTGGGGACACAGTATGGGGGAGG + Intergenic
1152131662 17:78480839-78480861 TTGGGAGCACAGTGGGGGCAGGG - Intronic
1152244247 17:79177022-79177044 CAGGGGGCATAGTGGGGACTAGG - Intronic
1152355774 17:79806529-79806551 CTTGGGACAGAGTGGGGGTGGGG - Intergenic
1152361574 17:79835468-79835490 CTGCGGACCTGGTGGGGGCTGGG - Intronic
1152456049 17:80416772-80416794 CTGGGCACAGAGTGGGGGAAGGG - Intronic
1152552747 17:81038042-81038064 CTGGGGGCACTGCGTGGGCTGGG + Intronic
1152677394 17:81648558-81648580 CTGGGGTGGGAGTGGGGGCTCGG - Exonic
1152715710 17:81899577-81899599 CAGGGGACACAGGGTGGGCTAGG + Intronic
1152772957 17:82181335-82181357 CAGGGCACGCAGTGGGGTCTGGG + Intronic
1152892744 17:82891753-82891775 TGGGGGACACAGAGGGGGCTGGG + Intronic
1152913657 17:83020573-83020595 CTGGGGACACGATGGGGCCTTGG + Intronic
1152945710 17:83196384-83196406 TTGGAGACACAGAGGAGGCTGGG + Intergenic
1154134748 18:11766469-11766491 CTGGGGACTCTGGGGGTGCTGGG - Intronic
1157097224 18:44696973-44696995 CAGGGGCGGCAGTGGGGGCTGGG - Intronic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1160534650 18:79585601-79585623 GCGGGGACACAGTGGGAGCATGG - Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160542850 18:79634590-79634612 TTGGGGGCACAGTGGGGGCGAGG - Intergenic
1160677534 19:399418-399440 GTGGGGACACAGTGGCTGGTGGG + Intergenic
1160710935 19:550685-550707 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1160711000 19:550897-550919 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1160808949 19:1004715-1004737 CTGGGCACCCTGTGGGGGCGGGG - Exonic
1161057057 19:2195942-2195964 CTGAGGAGACAGTGAGGGGTGGG - Intronic
1161148665 19:2695161-2695183 GTGGGTACACAGAGGGCGCTAGG - Intronic
1161228910 19:3162770-3162792 CTGGGGAAACAGTGTGGGAAGGG - Intronic
1161286004 19:3468561-3468583 CAGGGCATACAGTGGGGGGTGGG + Intronic
1161798896 19:6404394-6404416 CTGGGGTCCCAGATGGGGCTAGG - Intergenic
1161977675 19:7615442-7615464 CTGCGGACACAAGCGGGGCTGGG - Exonic
1162024862 19:7888252-7888274 CTGGGGAAACTGAGGGAGCTGGG - Intergenic
1162575693 19:11497559-11497581 CTGGGCACACAGTGAGTGCTGGG + Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1163034063 19:14561472-14561494 CTGGGGGCTCAGGGAGGGCTGGG + Intronic
1163184016 19:15623780-15623802 CTGGGGCTACAGTGGGGACAGGG + Intronic
1163520821 19:17790620-17790642 CTGGGGACACAAATGAGGCTGGG + Intergenic
1163638913 19:18450666-18450688 CGAGGCGCACAGTGGGGGCTGGG + Exonic
1163678348 19:18666621-18666643 CTGGGGTCTCAATGGAGGCTGGG + Intronic
1164817471 19:31216258-31216280 CTTGAGACATGGTGGGGGCTGGG - Intergenic
1165436151 19:35796678-35796700 CTCGGGACACAGTCGGTGTTCGG + Intergenic
1165444438 19:35849188-35849210 ATGGGGGGACAGTGGGGTCTGGG - Intronic
1165490839 19:36121776-36121798 TTGGGGGCACAGTGGAGCCTCGG + Intronic
1165734849 19:38169734-38169756 CTGGGGACACAGCGGTGACTGGG + Intronic
1165786474 19:38464748-38464770 CTGGGGATGGACTGGGGGCTGGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166061870 19:40330899-40330921 CTGGAGACAATGTGGTGGCTGGG + Intronic
1166147076 19:40845234-40845256 CTGGGGACACAGAGAGGGGCTGG + Intronic
1166277132 19:41761832-41761854 CAGGGGACATAGCGGGGGTTTGG + Intronic
1166447552 19:42871481-42871503 CTGTGAACACAGTGGGGATTTGG - Intronic
1166741062 19:45115088-45115110 CTGGGGACACAGCAGTGGCAAGG + Intronic
1166749459 19:45158116-45158138 CTAGGGGCACAGTGGGGAGTGGG - Intronic
1166856934 19:45786876-45786898 CAGGGGAGACAGTGTGGGGTTGG + Intronic
1166931791 19:46305436-46305458 CTGGGGATACAGTGGTGACCAGG + Intronic
1166991107 19:46693279-46693301 CTGGGGACCCAGTGGTGGCCAGG - Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1167436193 19:49480275-49480297 CTGGGGAGAAAGAGGAGGCTGGG - Intronic
1167462876 19:49635613-49635635 CTGGGGGCACTGGGAGGGCTCGG + Exonic
1167473752 19:49688883-49688905 CTGGGGACACTGAGTGGGTTGGG + Exonic
1167799073 19:51728646-51728668 CTGGGGAACCAGTGAGGGCAAGG + Intergenic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168288827 19:55347308-55347330 CTGGGGTCCCAGCAGGGGCTGGG - Exonic
1168317080 19:55489105-55489127 CCGGGGACCCAGTGGGGGTGAGG - Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
1202696266 1_KI270712v1_random:128977-128999 CTCAGGACACAGTGTGGGCAGGG + Intergenic
925360603 2:3277998-3278020 CTGGGAGCACAGGGTGGGCTGGG - Intronic
925361831 2:3285275-3285297 CTGGGGTCAGAATGGGGGCCAGG + Intronic
925852335 2:8094661-8094683 CAGGGTAGACAGTGTGGGCTTGG - Intergenic
925964351 2:9049957-9049979 ATGGGGACACAGTGTGGCTTTGG + Intergenic
927215251 2:20664943-20664965 CTGGGAACACACTGGTGGTTGGG + Intergenic
927613667 2:24566940-24566962 CTGGGTCCACAGTGGTGGATGGG + Intronic
927647288 2:24886153-24886175 CTGGGAACACAGTGGGGACTGGG - Intronic
928396071 2:30944243-30944265 CTGGGGACCAACTGAGGGCTTGG - Intronic
929879213 2:45821769-45821791 CTGGGGACAGAGGGAAGGCTTGG + Intronic
929885024 2:45870846-45870868 CTGGGCACATAGTGAGCGCTTGG + Intronic
929900030 2:45992849-45992871 CTGGGGACACACTGGGGTTCAGG - Intronic
930574317 2:53127440-53127462 CTGGGGCCACTGTGAGGGATCGG + Intergenic
931219678 2:60277807-60277829 GTGAGGACAGAGTGGGGTCTTGG + Intergenic
932702167 2:73999633-73999655 CTGGGAGCACAGTAGGGTCTGGG + Intronic
932805565 2:74779953-74779975 CTGGGGATACAGTGGAGGGCGGG + Intergenic
933671071 2:85007669-85007691 CTGAGGACACAGTGGTACCTGGG - Intronic
934277429 2:91586002-91586024 CTCAGGACACAGTGTGGGCAGGG + Intergenic
934916064 2:98302073-98302095 CTGGGGCCACACTGGGGTCCTGG - Intronic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
935667436 2:105525112-105525134 CTGGGGAGTTGGTGGGGGCTGGG + Intergenic
936021873 2:109001350-109001372 GTGGGGTCACAGTAGGGGCAGGG + Intergenic
936182000 2:110275106-110275128 CTGGGACCACAGTGGGGGCCTGG + Intergenic
936230569 2:110696567-110696589 CTGGGACCACAGTGGGGGCCTGG - Intergenic
937288459 2:120767673-120767695 CAGGCGAGGCAGTGGGGGCTGGG - Intronic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938341539 2:130539602-130539624 CTGGAGACACAGTGGAGCATGGG + Exonic
938348291 2:130581107-130581129 CTGGAGACACAGTGGAGCATGGG - Intronic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
941262116 2:163310621-163310643 CTGGGGGCAGCGTGGGGGGTTGG - Intergenic
941911578 2:170770319-170770341 CTTGGGTCACAGTAGGGGGTGGG - Intergenic
945922149 2:215765983-215766005 CTGAGGGCCCAGTGGGAGCTAGG + Intergenic
946008193 2:216543308-216543330 CTGGGGCCTCAGTGTTGGCTGGG - Intronic
946155050 2:217801768-217801790 GTGGGGCCACTGTGGGGACTGGG + Exonic
946457732 2:219841641-219841663 CTAGGCACACAGTGGGTGATGGG + Intergenic
947690035 2:232126810-232126832 TTGGGGACACAGTGCTGGGTAGG - Intronic
947792440 2:232876055-232876077 CTGGCGCGACGGTGGGGGCTGGG - Exonic
947871324 2:233440484-233440506 CTGGGAACCCGGTGGGGGCAGGG + Intronic
948310870 2:236985676-236985698 CTGGGGAAGGAGTGGGGGCTGGG - Intergenic
948454760 2:238099835-238099857 CTGGGGACACAGTGGCTCCACGG - Intergenic
948455826 2:238104227-238104249 CTGGGGTCACAGTGGCGGCGTGG - Intronic
948595443 2:239076614-239076636 CTGGGGACTCCGTGGGAACTGGG + Intronic
948797348 2:240411847-240411869 ATGGGGACTGAATGGGGGCTGGG - Intergenic
1170149461 20:13214431-13214453 CTGGGGCAACAGTGGTGACTAGG + Intergenic
1171796322 20:29569287-29569309 CAGGGTAGACAGTGGGGTCTTGG + Intergenic
1172597245 20:36157825-36157847 CCGAGGCCACAGTGGGGACTGGG + Intronic
1173516085 20:43666732-43666754 CTAGGGACCCAGTAGTGGCTTGG + Intergenic
1174190152 20:48734818-48734840 CTGGGGCAAGAGTGGAGGCTGGG - Intronic
1174463530 20:50699722-50699744 CTGTGCCCAGAGTGGGGGCTTGG - Intergenic
1175165150 20:57038322-57038344 CTTGGCACACAGTAGGAGCTCGG - Intergenic
1175744853 20:61449065-61449087 CTGGGGAAGCAGTTGGGGATGGG + Intronic
1175895355 20:62333535-62333557 CAGGGGCCAGAGTGAGGGCTGGG - Intronic
1175907302 20:62387176-62387198 CTGGGGCGGGAGTGGGGGCTTGG + Intronic
1176369071 21:6051808-6051830 CGGGGCAGAGAGTGGGGGCTGGG - Intergenic
1178753866 21:35329066-35329088 CTGGGAATACAGTGGTGGATGGG + Intronic
1179710086 21:43208219-43208241 CTGGGGTCAGAGAAGGGGCTGGG + Intergenic
1179723032 21:43326012-43326034 CTAGGGGCACCGTGGTGGCTTGG - Intergenic
1179754448 21:43486733-43486755 CGGGGCAGAGAGTGGGGGCTGGG + Intergenic
1179955407 21:44735487-44735509 CTGGGTAAACACTGGGAGCTGGG - Intergenic
1180018626 21:45104453-45104475 GTGGAGACACAGTGGGGGTCAGG + Intronic
1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG + Intronic
1180857534 22:19057902-19057924 CAGGGGAGAGAGTGGGGCCTAGG - Intronic
1181028800 22:20140273-20140295 ATGGGGACAGGGTGGGGGCTGGG + Intronic
1181138573 22:20786916-20786938 CCGTGGTCACAGTGGTGGCTTGG - Exonic
1181173041 22:21020944-21020966 ATGTCGACACAGAGGGGGCTTGG + Intronic
1181321445 22:22010020-22010042 CTCAGGACACAGTGATGGCTAGG - Intergenic
1181355824 22:22295252-22295274 CTGGGGACACCATGGGGGACAGG - Intergenic
1181431368 22:22883638-22883660 CTGGGGACACAGTGTTGAGTGGG + Intronic
1181510414 22:23386438-23386460 CTGGGGAGACAGTGGAGCCTGGG - Intergenic
1182475738 22:30575355-30575377 CTGGCCACCCAGTGGGGCCTGGG + Intergenic
1183098341 22:35568061-35568083 CTGAGGGCTCAGTGGGGGCGGGG - Intergenic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1183481338 22:38067181-38067203 CTGGGGAATCAGTGGGGACAGGG - Intronic
1183951285 22:41354481-41354503 CTGGGGACACGGTGGGGAGTAGG + Intronic
1183956114 22:41381693-41381715 CAGGGGACACAGGGGCGGCGGGG + Intronic
1184233630 22:43171559-43171581 ATGTGGACACAGAGGGGGATGGG - Intronic
1184240913 22:43210871-43210893 CTGGGAACACGGGAGGGGCTGGG - Intronic
1184265524 22:43343837-43343859 CTGGGGACCGAGTGCGGGCGAGG + Intergenic
1184280882 22:43436762-43436784 CCTGGCACACAGCGGGGGCTTGG - Intronic
1184370039 22:44076358-44076380 CTGGGGCCACTGTGGGGACCGGG - Intronic
1184411921 22:44330957-44330979 CTGCGGACCCAGAGGGGCCTGGG - Intergenic
1184455937 22:44609439-44609461 CTGGGGACACAGAGATGCCTGGG + Intergenic
1184459758 22:44630417-44630439 CTGGGGACGCAGTGAGGCGTGGG + Intergenic
1185336304 22:50272141-50272163 CTGGGGACAGTGTGGGGTCGTGG + Intergenic
949977640 3:9475665-9475687 CTGTGGACACAGGGTGGGCGGGG - Exonic
950012571 3:9733419-9733441 CTGGGGATACAGAGGTGGATAGG + Intronic
950126965 3:10515586-10515608 CTGGGACCTCAGTTGGGGCTGGG - Intronic
950409435 3:12825653-12825675 CTGGGGACCCAGGGGAAGCTGGG + Intronic
950792080 3:15480113-15480135 CTGGGGTTGCAGTGGGGGCCTGG - Intronic
950957261 3:17067555-17067577 CTGAGGACACAGTGGAGACGAGG - Intronic
951566991 3:24020465-24020487 CTGTGGAGCCAGTGGGGGCCAGG - Intergenic
952386944 3:32848754-32848776 CTGTGGACCCAGTGGAGTCTGGG + Intronic
952859948 3:37804629-37804651 CTGGGGACACAGTGGAAACAAGG - Intronic
952919791 3:38276547-38276569 CTGGGGACAACTTGAGGGCTTGG - Intronic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
953384888 3:42500965-42500987 CTGGGGGCACAGAGGTGGATGGG - Intronic
953719391 3:45342050-45342072 CTGGTGGCACACTGGTGGCTGGG + Intergenic
954287279 3:49627912-49627934 CTGGGGATCCTGTGTGGGCTGGG + Intronic
954894429 3:53963711-53963733 CTGAGGCCACAGTGGGGTTTGGG + Intergenic
954965252 3:54604751-54604773 CTGGGGATCAAGTGGGGGCTGGG - Intronic
954965426 3:54606340-54606362 CTGGGGAGCAAGTCGGGGCTGGG + Intronic
956681521 3:71785562-71785584 CTGTGGACACATAGGGGGCGGGG + Intergenic
957188423 3:76973900-76973922 ATGGGGACACAGGTGGGGATGGG + Intronic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
958464622 3:94442721-94442743 CTGGGGACACAGTCTGGCCATGG + Intergenic
959859712 3:111203599-111203621 CTGGGGAGAGAGTGGCAGCTGGG + Intronic
960153124 3:114271373-114271395 CTGTGGGCACTGTGGGGGATAGG + Intergenic
961081836 3:124033992-124034014 CTGGGGAGGGCGTGGGGGCTGGG + Intergenic
961361781 3:126372715-126372737 CTCAGGACACTGTGGGGGCCAGG + Intergenic
961492525 3:127265351-127265373 TTGGGGCCACAGGGGAGGCTGGG + Intergenic
961506642 3:127374741-127374763 CTGGGGACACAGCAGGTCCTGGG - Intergenic
961651848 3:128420838-128420860 GAGGGGGCACAGTGGGGCCTGGG - Intergenic
961683273 3:128613051-128613073 CTGGGGATACAGTCGGGAGTGGG - Intergenic
961749895 3:129088677-129088699 CGGGGGGCACAGTGGCGGCGGGG + Exonic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
961934528 3:130569334-130569356 ATGGGAAGACAGTGGGGACTAGG - Intronic
962366622 3:134790561-134790583 CTAGGGACCCAGTGATGGCTGGG - Intronic
962673751 3:137736307-137736329 CTGAGGCCACTGTGGGGGATGGG + Intergenic
964050143 3:152381972-152381994 CTGGGGACATAGTAGGTGTTTGG + Intronic
964443687 3:156738501-156738523 CAGGGGACACAGTGAGCCCTAGG - Intergenic
965061051 3:163786440-163786462 CTGGGGCCACGGTGGAGGATTGG + Intergenic
966862812 3:184239874-184239896 CTGGAGACACTGTGGGGACCTGG + Exonic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968426375 4:526275-526297 CTGGGGCCACACGGGGGCCTGGG - Intronic
968511101 4:996315-996337 CTGGGGAGACCCAGGGGGCTGGG + Intronic
968520393 4:1032400-1032422 CTGGGGGCACAGTGGCTGCTGGG + Intergenic
968530809 4:1090494-1090516 CTGGGGCAACACTGGGGCCTTGG - Intronic
968734469 4:2288267-2288289 CTGGGGCCACAGGGGGGCTTAGG - Intronic
968735050 4:2290867-2290889 CTGGGGACACAGTGAAGCCCAGG + Intronic
968759323 4:2433878-2433900 CTGGGGACTCCGAGGGAGCTGGG + Intronic
969033318 4:4230359-4230381 CTCAGGACACAGTGTGGGCAGGG - Intergenic
969324191 4:6431520-6431542 TTGGGGACACAGACGTGGCTGGG - Intronic
969392421 4:6900682-6900704 TTGGAAACACAGCGGGGGCTGGG - Intergenic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
970353811 4:15232780-15232802 CTTAGTACACAGTGGGTGCTAGG - Intergenic
974876904 4:67712868-67712890 CTGGGGAGACCCAGGGGGCTGGG + Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978290820 4:107137688-107137710 CTATGGTCACAGTGGGGGCTTGG + Intronic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
983323683 4:166227054-166227076 CTGTGGAACCAGTGGGAGCTGGG + Intergenic
983533198 4:168832268-168832290 CTCGGGACAGGGTGGGGGCGGGG + Intronic
983917389 4:173307447-173307469 CTAGGGACAGAGTGGTGCCTAGG + Intronic
984292100 4:177808400-177808422 ATGGGGACAGAATGGGGGATGGG + Intronic
984639444 4:182145066-182145088 CTGGGCGCCCAGTGGGGGCGGGG + Intronic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985002553 4:185500333-185500355 ATCAGGCCACAGTGGGGGCTGGG + Intergenic
985505672 5:278860-278882 CTGGGGACACGGGAGGGGCTGGG + Intronic
985505679 5:278878-278900 CTGGGGACATGGGAGGGGCTAGG + Intronic
985519752 5:368194-368216 CAGAGGACTCAGTGAGGGCTCGG + Intronic
985664827 5:1176684-1176706 CTGGGGCCAGAGCCGGGGCTGGG - Intergenic
985717385 5:1470291-1470313 CTGGGGGCTGAGTGGGGTCTGGG - Intronic
985767492 5:1787617-1787639 CCGGGGACCCAGTGGAGGCAAGG - Intergenic
985927448 5:3029236-3029258 CTGGGGGCTCAGGGGAGGCTCGG - Intergenic
985972928 5:3392274-3392296 CTGGGGAGACCGGGGAGGCTGGG + Intergenic
987717866 5:21594858-21594880 CTGGGGACACAGGGGTGCCAAGG + Intergenic
987888381 5:23842073-23842095 TTGGGGACACAGGTGGTGCTTGG + Intergenic
993110154 5:83646761-83646783 CTGGGAACCCAGTGAGTGCTGGG + Intronic
994745809 5:103676922-103676944 CTGGAGGGAGAGTGGGGGCTTGG + Intergenic
995027379 5:107439428-107439450 TTAGGGATACAGTGGGGGATAGG + Intronic
996117578 5:119634782-119634804 CTGGGGAGACAGTACTGGCTCGG - Intronic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996417699 5:123227971-123227993 CTGGGGACCCAGTGGGAGTGGGG - Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996888161 5:128384268-128384290 CTGGGGACAGGATGGGGGCTGGG + Intronic
997349945 5:133223517-133223539 GTGGGGACACAGTGGGGACTGGG + Intronic
997415406 5:133724105-133724127 CAGGGGGCACAGTGGAGGTTGGG + Intergenic
997700639 5:135896236-135896258 CTGGGGAGACAGAGCGGGTTGGG + Intergenic
997891616 5:137682036-137682058 CTGGGGGTACAGTTGGGTCTCGG + Intronic
998108154 5:139481595-139481617 CTGGTGACCCTTTGGGGGCTAGG - Exonic
998415886 5:141945818-141945840 GAGGGGACACAGTGAGGGCCAGG + Intronic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
999253759 5:150197918-150197940 CTGGGCACACAGTGGGTCCTGGG + Intronic
999321818 5:150619863-150619885 CTGGGGTCACACAGGGGGCTGGG + Intronic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1000288404 5:159847336-159847358 CTGGCGCCAGAGTGGGAGCTGGG - Intergenic
1001773866 5:174314425-174314447 CTGGGGCCACAGTGGGGAACGGG + Intergenic
1001799922 5:174534244-174534266 CTGGGGCCTCACTGAGGGCTGGG + Intergenic
1001980669 5:176035402-176035424 CTGGGGGCAGAGTGGTGGTTTGG - Intergenic
1002099357 5:176849755-176849777 GTGGAGGCAGAGTGGGGGCTGGG + Intronic
1002132972 5:177092604-177092626 CTGGGGTCACAGCAGGGCCTGGG - Intronic
1002236793 5:177808663-177808685 CTGGGGGCAGAGTGGTGGTTTGG + Intergenic
1004883093 6:20028006-20028028 CTGGGTACAGGGTGGGGACTTGG - Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1006833828 6:36985295-36985317 GTGGGGACAAAGTGGGCGCCAGG - Intronic
1006948334 6:37800560-37800582 ATGTGGACACTGAGGGGGCTGGG - Intergenic
1007223739 6:40298634-40298656 CTGGGGACTCAGGGAGGGCAAGG + Intergenic
1007401690 6:41606143-41606165 CTGGGGACCAAGCTGGGGCTTGG + Intergenic
1007408366 6:41647601-41647623 CTGAGGACAAGGTGGGGGATCGG - Intronic
1007520757 6:42450783-42450805 CTGCGGGCTCTGTGGGGGCTGGG - Intronic
1007566707 6:42857115-42857137 CTGGTGTCACAGTGTGGGCTTGG - Exonic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1009844202 6:69115432-69115454 CTGGGGCCAGACTGGGGGATCGG + Intronic
1010449698 6:75988823-75988845 CTGGGGACACAGTGGCTTCCTGG - Intronic
1011168627 6:84479468-84479490 CTGTGGATGCTGTGGGGGCTGGG - Intergenic
1011687247 6:89833322-89833344 CTGGGGATACAGTGAGAGCTGGG + Intronic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1015930502 6:138354714-138354736 CTGGGAACACGGTGGGAGCCTGG - Intergenic
1017739981 6:157398081-157398103 CTGGGGAGCCGGGGGGGGCTGGG - Intronic
1017794515 6:157831574-157831596 CTGGGGACTGTGTGGGGGCAGGG - Intronic
1017983441 6:159422364-159422386 CGGGGCTGACAGTGGGGGCTGGG + Intergenic
1018156455 6:160989961-160989983 CTGAAGACAAAGTGGGGGCACGG + Intergenic
1018353542 6:162988273-162988295 CTAGGGACACAGAGTGGGATTGG + Intronic
1018790347 6:167143421-167143443 CTGGGGACTCTGTGGGGCATGGG + Intergenic
1018868637 6:167764585-167764607 CTGGGGAACCAGAGTGGGCTTGG + Intergenic
1018980987 6:168601628-168601650 CAGGGGCCTCACTGGGGGCTGGG - Intronic
1019026362 6:168967454-168967476 CTGGGGCCACAGTGGGGAAGTGG - Intergenic
1019074137 6:169373450-169373472 CTGGGGACCCAGGGGGAGCGTGG + Intergenic
1019106500 6:169671857-169671879 CTGGAGACACAGTGGTGAATAGG - Intronic
1019219616 6:170463517-170463539 CTGGGGAGGCTGTGGAGGCTGGG + Intergenic
1019325925 7:438264-438286 GCGGGGACACAGAGGGAGCTTGG - Intergenic
1019372846 7:672059-672081 CTGGGAACACAGTGGGGGTAGGG - Intronic
1019563917 7:1670482-1670504 CTGGGGGCGCAGCAGGGGCTGGG - Intergenic
1019803436 7:3105254-3105276 CTGGGGCCAGAGAAGGGGCTTGG - Intergenic
1020101985 7:5399095-5399117 AGGGGGGCACTGTGGGGGCTTGG - Intronic
1021188879 7:17597428-17597450 CTGAGGACACAGTGGTGACCTGG + Intergenic
1021611710 7:22464310-22464332 CAGGGGACAGAGTGGGGGAGAGG - Intronic
1022123396 7:27332310-27332332 CTGGGTACAGAGTGGGAACTGGG - Intergenic
1022158958 7:27689804-27689826 CTGAGGACAAGCTGGGGGCTGGG - Intergenic
1022474116 7:30699351-30699373 ATGGGGACAGAGTGGGCTCTGGG - Intronic
1022592576 7:31679823-31679845 TTGGCGACACAGTGGGGATTAGG + Intergenic
1022607449 7:31829621-31829643 GTGGGGTCACAATGGGAGCTGGG + Intronic
1022742614 7:33137444-33137466 CTGCGGAGCCAGTGGGGGCTGGG - Intronic
1023156279 7:37255868-37255890 CTGGTGAGAGAGTGGGGCCTGGG - Intronic
1023483729 7:40662261-40662283 CTGGTGACACAGTGCAGGCTAGG - Intronic
1023558948 7:41452428-41452450 ATGTGGACACACTGGGGCCTCGG - Intergenic
1023840805 7:44096521-44096543 AGGGGCACACTGTGGGGGCTGGG - Intergenic
1023859976 7:44212749-44212771 CTGGGGCCACTGTTGGGGGTGGG + Exonic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1026828404 7:73597394-73597416 CTGGGGACAGACTGTGGGGTGGG + Exonic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1029124295 7:98286201-98286223 GTGGGGACACAGGGAGGGCGAGG + Intronic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1029488231 7:100856177-100856199 TTTGGGTCACAGTTGGGGCTGGG + Intronic
1029706226 7:102277796-102277818 GTGGGGCCACAGTGGGGGAAGGG + Intronic
1029747706 7:102525586-102525608 ATGGAGCCACAGTGGGGGCATGG + Intergenic
1029765657 7:102624676-102624698 ATGGAGCCACAGTGGGGGCATGG + Intronic
1031766677 7:125786824-125786846 GTGAGGACACAGTGGGGGGATGG - Intergenic
1033163167 7:139015265-139015287 CTGGTGACAGAGCAGGGGCTGGG + Intergenic
1033227188 7:139571408-139571430 CTGGGGACAGAGTGGGGCAGGGG + Exonic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034446806 7:151117868-151117890 CTGGGAAAAGAGTAGGGGCTTGG - Intronic
1036768039 8:11561227-11561249 CGGGGGACACAGTGTGGGCTCGG + Intronic
1037507044 8:19540952-19540974 CTGGGGACAGGGTAGGGGCTTGG - Intronic
1037542408 8:19885327-19885349 CTGGGGGCAGGGTGGGGACTTGG - Intergenic
1037603630 8:20419632-20419654 CAGGGGAAACAATGGTGGCTTGG - Intergenic
1038334078 8:26632396-26632418 CTGGGAAGAGAGTGGGGACTTGG + Intronic
1039430240 8:37520050-37520072 CTGGAGATACAGTGATGGCTGGG - Intergenic
1039442966 8:37608082-37608104 CTTGTGACACTGTGGGGGGTGGG + Intergenic
1039566560 8:38556115-38556137 CACGGGACACAGTGTGGGCATGG + Intergenic
1039702756 8:39978813-39978835 ATGGGGACAAACTGTGGGCTCGG + Intronic
1039911272 8:41828816-41828838 CTGGGGAGAGAGTTGGGCCTGGG + Intronic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1040538079 8:48327027-48327049 CTGGGGACACAGAGGTTGCCTGG - Intergenic
1041305073 8:56449108-56449130 CTTGGGGCACAGTGGTTGCTTGG + Intergenic
1041414961 8:57597812-57597834 CTGGGGGCACTGTGGGAGCCAGG - Intergenic
1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG + Intergenic
1047350284 8:124067073-124067095 CTGGAGAGACAGTGGGGAGTAGG + Intronic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048996030 8:139794197-139794219 CTGGGACCACAGTGGGAGCCAGG - Intronic
1049157152 8:141074074-141074096 CTGGGGACACAGAGGTGGATGGG + Intergenic
1049214569 8:141401872-141401894 CTGGGGCCACAGCGGGGGAGGGG - Intronic
1049243698 8:141550901-141550923 CTGGGGTCTCTCTGGGGGCTGGG + Intergenic
1049330055 8:142045670-142045692 CTGGGGTCCCACTGGGGCCTGGG + Intergenic
1049349889 8:142158903-142158925 GTAGGAAGACAGTGGGGGCTGGG + Intergenic
1049534005 8:143169646-143169668 CTGGGCACACAGTGAGGGTCAGG + Intergenic
1049917701 9:334462-334484 CTGGGGGCACAGTGAGGTGTGGG + Intronic
1050321595 9:4458296-4458318 CTGGGGACACAGTAGTGACAAGG + Intergenic
1051894547 9:21974498-21974520 CTGGCGACGCCCTGGGGGCTTGG - Intronic
1052807602 9:33026034-33026056 CTGGGCACACAGTGGTGGGGGGG - Intronic
1053140424 9:35679358-35679380 GTGTGGACACAGTGGGTGCGGGG + Intronic
1053311666 9:37024638-37024660 CTGGCAGCACAGTGGGGGCTGGG - Intronic
1056549061 9:87636259-87636281 CAGGGGACACAGCAGGGCCTGGG - Intronic
1057115054 9:92513145-92513167 GTGGGGACACTTTGGGTGCTGGG - Intronic
1057206365 9:93175372-93175394 CTGGGCACTCAGTGTGTGCTAGG - Intergenic
1057221235 9:93259083-93259105 CTGGGGACGCAGGGGGGAGTGGG - Exonic
1057276981 9:93681205-93681227 CCTGGCACTCAGTGGGGGCTGGG - Intergenic
1058342885 9:103920241-103920263 CTGGGGCCACTGTGGGTGATGGG - Intergenic
1059408741 9:114118722-114118744 CTGGGGACACTGGAGGTGCTGGG + Intergenic
1059444778 9:114331406-114331428 CTGGGCACGCAGCAGGGGCTGGG + Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060387215 9:123242001-123242023 CTAGGGACACAGTGGGTGTGTGG - Intronic
1060918191 9:127403518-127403540 CTGAGGACACAGGGGGTGCTGGG + Intronic
1061061054 9:128250755-128250777 CTGGGGGCACGGCGGGGGCTCGG - Exonic
1061304435 9:129724278-129724300 CTGGGGCACCAGTGGGGGCTGGG + Intergenic
1061322600 9:129840402-129840424 CTGGAGGCTCAGTGGGTGCTGGG + Intronic
1061373383 9:130210438-130210460 ATGGGGCCAGAGTGGGGACTCGG + Intronic
1061572421 9:131485968-131485990 CAGGGGACTCAGTGGGGACGAGG - Intronic
1061877901 9:133554145-133554167 CTGGGAACAGGGCGGGGGCTGGG - Intronic
1061878628 9:133557354-133557376 ATGTGGACAGAGTGGGGCCTCGG + Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062076871 9:134594443-134594465 CTGGGGGCAGAGTGGGGCCCTGG - Intergenic
1062077983 9:134602541-134602563 CTGGGGACAGGGTGGGGGTGGGG - Intergenic
1062153686 9:135034187-135034209 CAGGGGACGGAGTGGCGGCTGGG - Intergenic
1062355715 9:136161073-136161095 ATGGGGACACAGTCTGGGCCAGG + Intergenic
1062452503 9:136621531-136621553 CTGGGGACAACGTGGGCCCTGGG - Intergenic
1062590956 9:137274463-137274485 CTGGGGACCCAGGTGAGGCTGGG + Intergenic
1062598109 9:137308121-137308143 CTGGGCTCTCAATGGGGGCTCGG - Intronic
1062622258 9:137428418-137428440 CTGGGGGCACAGTGGAGGGTGGG - Intronic
1062694282 9:137865211-137865233 CTGGACACAGAGAGGGGGCTGGG + Intronic
1185487947 X:497511-497533 CGGCGGACACAGGGTGGGCTCGG + Intergenic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1189224214 X:39398910-39398932 CTGGGGAGAGAGTGGGGGGTGGG + Intergenic
1192290745 X:69792118-69792140 TTGGGGACTCAGTGGGGGAATGG - Intronic
1192543763 X:71996159-71996181 CTGGGGGCAAGGTGGGGGCCTGG + Intergenic
1193775978 X:85642093-85642115 CTGGGGGCATTGAGGGGGCTGGG - Intergenic
1194765457 X:97842916-97842938 CTGGGGACAGAGTGGATGTTAGG - Intergenic
1195252690 X:103063933-103063955 GTGGGGAAGCAGTGGCGGCTGGG - Intronic
1195613461 X:106894694-106894716 CTGGGGACACCTTGAGGCCTGGG - Intronic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1197718346 X:129726638-129726660 CTGAGGTCACAGTGGCAGCTAGG - Intergenic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1199606673 X:149584305-149584327 CTGGGGTGACAGTAGGGGCAGGG + Intronic
1199632450 X:149785063-149785085 CTGGGGTGACAGTAGGGGCAGGG - Intronic
1200185198 X:154178066-154178088 CTGGGGTGACTGTGGAGGCTGGG + Intergenic
1200190851 X:154215204-154215226 CTGGGGTGACTGTGGAGGCTGGG + Intergenic
1200196602 X:154253006-154253028 CTGGGGTGACTGTGGAGGCTGGG + Intergenic
1200202257 X:154290124-154290146 CTGGGGTGACTGTGGAGGCTGGG + Intronic