ID: 1166054043

View in Genome Browser
Species Human (GRCh38)
Location 19:40278009-40278031
Sequence CACCCCCAATACCATGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166054043_1166054046 11 Left 1166054043 19:40278009-40278031 CCAAGGTCATGGTATTGGGGGTG 0: 1
1: 0
2: 7
3: 36
4: 253
Right 1166054046 19:40278043-40278065 CCACACCCCACATCCCAAGCAGG 0: 1
1: 0
2: 1
3: 29
4: 310
1166054043_1166054051 21 Left 1166054043 19:40278009-40278031 CCAAGGTCATGGTATTGGGGGTG 0: 1
1: 0
2: 7
3: 36
4: 253
Right 1166054051 19:40278053-40278075 CATCCCAAGCAGGCATGGAATGG 0: 1
1: 0
2: 1
3: 10
4: 212
1166054043_1166054048 16 Left 1166054043 19:40278009-40278031 CCAAGGTCATGGTATTGGGGGTG 0: 1
1: 0
2: 7
3: 36
4: 253
Right 1166054048 19:40278048-40278070 CCCCACATCCCAAGCAGGCATGG 0: 1
1: 0
2: 2
3: 22
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166054043 Original CRISPR CACCCCCAATACCATGACCT TGG (reversed) Intronic
900114075 1:1021086-1021108 TACCCCCAAAACCATCTCCTGGG + Intronic
900803271 1:4750908-4750930 GACCTCCAATCCCCTGACCTGGG + Intronic
904204963 1:28848269-28848291 AAACCCCAATACCATCACGTTGG + Intronic
904348332 1:29888521-29888543 CACCGCTATTACCAGGACCTGGG + Intergenic
905926605 1:41754435-41754457 CACCTCCATTGCCATTACCTTGG - Intronic
909535738 1:76734113-76734135 AACCCCCAGTACCATCACCTTGG + Intergenic
910954777 1:92690136-92690158 CACCCACAATACCAGCACTTTGG - Intronic
912453061 1:109779238-109779260 CATCCCTAATACCATCGCCTTGG + Intergenic
912509894 1:110182121-110182143 CACTCCCATTGCCATCACCTGGG - Intronic
913085132 1:115429844-115429866 CACCCCTAATACCATTACCTTGG + Intergenic
915739453 1:158107435-158107457 CTCTCCAAATACCATCACCTTGG + Intergenic
920712737 1:208310549-208310571 GACCTCGAATCCCATGACCTAGG + Intergenic
921922655 1:220686510-220686532 CATGCCCAATACCATCAACTTGG + Intergenic
922751468 1:228072046-228072068 CACCCCCTATACTATAGCCTGGG - Intergenic
923358221 1:233181862-233181884 CGCCTCCAATACCATTACATTGG + Intronic
923667204 1:236009129-236009151 CACCCCCAATGCCATCACCTTGG - Intronic
1063602651 10:7496352-7496374 CACCCTCGATCCCATGACATTGG - Intergenic
1063772792 10:9223007-9223029 CACCCACAACACTATGAACTTGG - Intergenic
1063897523 10:10697755-10697777 CCCCCCCAATACCATCACCATGG + Intergenic
1064043735 10:11991883-11991905 CACCCACAATCCCAGCACCTTGG + Intronic
1065851869 10:29797071-29797093 CACCGCTAATACCATGACCTTGG - Intergenic
1065874797 10:29988168-29988190 CACTCCAAATCCCATGACTTTGG + Intergenic
1066298505 10:34076532-34076554 CACCTCCAATACCATGACATTGG - Intergenic
1066338181 10:34501896-34501918 CACATCCTATACCATCACCTTGG - Intronic
1066557364 10:36628990-36629012 TACTCCTAATACCATCACCTTGG - Intergenic
1067740778 10:48894793-48894815 CCCCACCAGTACCTTGACCTGGG + Intronic
1067741017 10:48896291-48896313 CCCCACCAGTACCTTGACCTGGG + Intronic
1067782046 10:49214881-49214903 ACCTCCCAATACCATTACCTTGG + Intergenic
1069715643 10:70519530-70519552 ACCTCCTAATACCATGACCTTGG + Intronic
1071343185 10:84666823-84666845 GACCCCCAAATCCATGGCCTGGG - Intergenic
1071419590 10:85478649-85478671 CCTCCCTAATACCATGAGCTTGG - Intergenic
1072110081 10:92310720-92310742 CACCACCAATCCCTTGAACTTGG - Intronic
1072773535 10:98165789-98165811 CACCTCCAACACCATCACATTGG - Intronic
1073874186 10:107902342-107902364 CCCCCCCAATACAATCACGTTGG - Intergenic
1074120187 10:110488226-110488248 CACCCCCAATTCCATCCCTTTGG - Intergenic
1075571286 10:123548163-123548185 CAGCCCCAACAACATCACCTGGG + Intergenic
1075614740 10:123882956-123882978 CAACCATAATACCATGGCCTGGG + Intronic
1076658553 10:132040101-132040123 CCCCCCCAATACCATTACATTGG - Intergenic
1079691842 11:23427742-23427764 CACCTGCAATACCAGGACATTGG - Intergenic
1081479183 11:43468672-43468694 CACCTCCAATCCCATCACCTTGG + Intronic
1081809077 11:45905288-45905310 CACGCCCAATCCCAGGCCCTGGG + Intronic
1084551253 11:69843476-69843498 CACCACCCACTCCATGACCTGGG - Intergenic
1084665084 11:70571930-70571952 CACCCCCAACACCATGCCATTGG - Intronic
1084692114 11:70733688-70733710 CACCCCCCTCTCCATGACCTAGG - Intronic
1085390630 11:76180335-76180357 CACCCCCAATTCCCTTTCCTTGG - Intergenic
1087087023 11:94230186-94230208 CACCTCCAATATCATGCCATTGG + Intergenic
1088458850 11:110061620-110061642 CACTCCTAATGCAATGACCTAGG - Intergenic
1089054706 11:115576323-115576345 GACTCCCAAGACCATGGCCTGGG + Intergenic
1091118428 11:133036956-133036978 GAGCTCCAAGACCATGACCTTGG + Intronic
1091753456 12:3036990-3037012 CACACCCAAAACCACGGCCTCGG - Intronic
1092350725 12:7753627-7753649 CACCTCCAATACTATCACCTTGG + Intergenic
1094254292 12:28403602-28403624 CCCTCCTAATACCATGAACTTGG + Intronic
1098233052 12:68392285-68392307 CACCCCCAATACGGTCACCTTGG + Intergenic
1100426234 12:94489557-94489579 CACCCCCACTACCCTGTCCCAGG + Intergenic
1100610073 12:96184596-96184618 CTCTCCCAATACCATCACCTTGG - Intergenic
1100913010 12:99387238-99387260 CACTCCTAATCCCATCACCTTGG - Intronic
1101067528 12:101038348-101038370 CACAGCCCATACCATGAGCTGGG - Intronic
1102302495 12:111780860-111780882 CACCTGCAATCCCAGGACCTTGG + Intronic
1103579448 12:121903406-121903428 CACCCCTAATACCATCACATTGG + Intronic
1104310567 12:127651028-127651050 ATCCCCAAATACCATCACCTTGG + Intergenic
1107299570 13:38950732-38950754 AACTCCTAATACCATCACCTTGG - Intergenic
1107623042 13:42253198-42253220 CCCTGCCAATACCATTACCTTGG - Intronic
1107697328 13:43012962-43012984 CATTCCCAATACCATTACATTGG + Intergenic
1109995321 13:70116128-70116150 CACCCCCATCACCATGAACATGG - Intergenic
1110244870 13:73311331-73311353 CACCCCTAATACCATCACACTGG - Intergenic
1112102390 13:96203435-96203457 CACCTCCAAATCCATGACATTGG + Intronic
1113278152 13:108757962-108757984 CTCTCCTAATACCATCACCTTGG - Intronic
1116060107 14:39912775-39912797 CAACCCCACCACCATGAGCTGGG - Intergenic
1118201892 14:63682277-63682299 CACCTCCAATACCAGCACTTTGG + Intergenic
1119161789 14:72458862-72458884 ACCTCCCAATACCATCACCTTGG + Intronic
1119421157 14:74508799-74508821 CACCCCCAGTAGGGTGACCTGGG + Intronic
1119663116 14:76465533-76465555 CACCCCCGATACCATCATCCTGG - Intronic
1121018038 14:90560278-90560300 CACCCACAATGACATCACCTCGG - Intronic
1124174494 15:27409994-27410016 CATCCCCAATATCAGGACCAAGG - Intronic
1125380069 15:39078036-39078058 CACTCCTAATACCATCACCTTGG + Intergenic
1127019391 15:54729063-54729085 CACCTCTAATACTATCACCTTGG - Intergenic
1127981244 15:64037001-64037023 CATCCCCACAACCATGAGCTAGG + Intronic
1128533446 15:68471038-68471060 CACCACCAATGCCATCACTTAGG + Intergenic
1129380821 15:75165002-75165024 CACCCCACATACCTTGACCTAGG + Intergenic
1131255583 15:90859819-90859841 CAGCCCCAAAACGATGACCCGGG - Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132115926 15:99136638-99136660 CACCCCCAATACCATCCCTTTGG + Exonic
1132153079 15:99475955-99475977 CACCCCAGATAGCATTACCTAGG + Intergenic
1132367507 15:101268178-101268200 CCCCCCCAATACCATCACCTTGG - Intergenic
1133717347 16:8462604-8462626 CACCTCCGATACGATCACCTTGG + Intergenic
1133739208 16:8639222-8639244 GACACCCAAGACCATGACATTGG + Intronic
1133741406 16:8654402-8654424 TTCCCCCAATTCCATGCCCTGGG - Intergenic
1135063088 16:19287406-19287428 CCCTCCCAATACCATCACATTGG + Intronic
1135121978 16:19773981-19774003 CCCCCGCAATACCATGACTTTGG - Intronic
1135927981 16:26711893-26711915 ACCTCCCAATACCATCACCTTGG + Intergenic
1137344080 16:47638064-47638086 CCCTGCCAATACCATCACCTTGG + Intronic
1137399578 16:48142319-48142341 CTCCCCCAATAACATGTCCGTGG - Intronic
1138215751 16:55203897-55203919 CACTCCCTAAACCATCACCTTGG - Intergenic
1138477389 16:57279895-57279917 CACCCCCAATCCCAGGAGGTGGG + Intronic
1139136684 16:64212958-64212980 CACCCCCAATAGCAGGAGTTAGG - Intergenic
1139149695 16:64366695-64366717 CACAACTAATACCATGACCAAGG + Intergenic
1141113828 16:81291668-81291690 CTCCCCCGATCCCATGACCTGGG - Intergenic
1144050993 17:11497068-11497090 GACCCCCAGAACCATGTCCTGGG + Intronic
1144303390 17:13944840-13944862 TCCCCCTAATACCATCACCTTGG - Intergenic
1147117338 17:38311301-38311323 CACAGCCTATACCATCACCTTGG - Intronic
1148412344 17:47478285-47478307 CACAGCCTATACCATCACCTTGG + Intergenic
1148749196 17:49935040-49935062 CAGCCCCATTCCCAGGACCTTGG - Intergenic
1149881862 17:60300010-60300032 ATCCCCTAATACCATCACCTTGG + Intronic
1150358640 17:64509414-64509436 CACCTCTAATCCCATTACCTTGG + Intronic
1150835165 17:68557361-68557383 CATCTCCAATACCATCACCTTGG - Intronic
1151355849 17:73558055-73558077 CATCCCCAACACCATGGGCTGGG + Intronic
1152051315 17:77980843-77980865 CACCCCCCATACCTTGTTCTAGG - Intergenic
1152655974 17:81519410-81519432 CACCCCCAGGACCACGAGCTCGG + Intronic
1153585292 18:6614641-6614663 CAGCAAGAATACCATGACCTGGG + Intergenic
1153890309 18:9507991-9508013 CCCTCCTAATACCATCACCTTGG + Intronic
1155090445 18:22504122-22504144 CCCACCCAATACCCTGGCCTGGG - Intergenic
1156231895 18:35161391-35161413 CACCCCTAAAATCATGCCCTAGG - Intergenic
1158702867 18:59764556-59764578 ACCCTCCAATACCATCACCTTGG + Intergenic
1160322399 18:77908237-77908259 CACCCCCAGAACCTTCACCTGGG + Intergenic
1160596447 18:79978464-79978486 CACCTCCAATCCCAACACCTAGG + Intronic
1163295140 19:16406858-16406880 CACACCTAATACCATCATCTTGG - Intronic
1164565843 19:29325275-29325297 ACCCCCTAATACCATTACCTGGG - Intergenic
1164790277 19:30971733-30971755 CCCCCCAAATAGCATGAGCTGGG + Intergenic
1165996230 19:39846061-39846083 CACCCCCAATGCCAGGCCCACGG + Intronic
1166054043 19:40278009-40278031 CACCCCCAATACCATGACCTTGG - Intronic
1167427467 19:49436853-49436875 CACCCCCAAGACCAGGATCCAGG + Intronic
1168572161 19:57480286-57480308 CACCTCCAATTTCATGCCCTTGG + Intergenic
925775615 2:7332559-7332581 CACCCCCTAATCCATCACCTTGG + Intergenic
926428128 2:12758542-12758564 CACCTCCTATACCATCACTTAGG - Intergenic
928055925 2:28054499-28054521 AACTCCTAATACCATCACCTTGG - Intronic
928326685 2:30324835-30324857 CCCTCCTAATACCATCACCTTGG - Intergenic
928428706 2:31200370-31200392 CACCACCACTACCCTCACCTGGG - Intronic
928433230 2:31237240-31237262 CACCCATAATCCCATGACTTAGG + Intronic
928458893 2:31451046-31451068 AGCCCCCAATTCCAGGACCTAGG + Intergenic
929677811 2:43955205-43955227 CACCTGCAATACCAGCACCTTGG + Intronic
930741571 2:54837198-54837220 CACCTTCAGTACCATGTCCTGGG + Intronic
932321184 2:70823091-70823113 CACCCCCACCATCATGAACTGGG - Intergenic
933196145 2:79392190-79392212 CACCAGCAATCCCATCACCTTGG - Intronic
934944703 2:98531118-98531140 CACCCCTAATACCATCACATTGG + Intronic
935607388 2:104984601-104984623 CACCTCCTATACCGTCACCTAGG - Intergenic
935730539 2:106061672-106061694 CACCTCTAATACCATTACTTTGG + Intergenic
936262429 2:110973352-110973374 CACCTCCTATACCATCATCTTGG - Intronic
936287483 2:111191941-111191963 CACCTCCAATACCATCACCTGGG - Intergenic
937642562 2:124230159-124230181 CACCCCCCATACCACTTCCTTGG + Intronic
938556870 2:132432379-132432401 CACACCTAATACCATCACATTGG + Intronic
939014513 2:136886407-136886429 CACCTCCACTGCCATGGCCTTGG - Intronic
942070416 2:172311090-172311112 CATCCACATTACCATCACCTTGG - Intergenic
943039435 2:182786840-182786862 CATTCCTAATACCATTACCTTGG - Exonic
944211515 2:197211071-197211093 CCACCCCTATGCCATGACCTAGG + Intronic
944329240 2:198445660-198445682 ACCTCCCAATACCATCACCTTGG - Intronic
946364045 2:219237494-219237516 CACCACCATTACCAATACCTTGG + Exonic
946386387 2:219386880-219386902 CACCCCCAGTACCTTGCTCTCGG + Exonic
946932175 2:224681315-224681337 CACCCCTAATACCATCACTTTGG - Intergenic
947436445 2:230076875-230076897 CCTCCCTAATACCATCACCTTGG + Intergenic
948364690 2:237447058-237447080 CACCTCCTATACCATCGCCTTGG + Intergenic
948517546 2:238513440-238513462 CACCCCTAACACCATTACTTTGG - Intergenic
948668461 2:239551287-239551309 CACCTCCTACACCATCACCTTGG - Intergenic
1169331419 20:4719416-4719438 CACCTCCATTACCATTACCTCGG + Intergenic
1174383223 20:50171007-50171029 CACCCCCCACACCATGAGCAGGG - Intergenic
1174657879 20:52186850-52186872 CACCACCAGAACCATCACCTCGG - Exonic
1175546363 20:59780582-59780604 CCCCCCGAATACCATCACATTGG + Intronic
1176373536 21:6076439-6076461 CACTGCCCACACCATGACCTTGG + Intergenic
1177001705 21:15621170-15621192 ACCCCCTAATACCATCACCTGGG + Intergenic
1178566566 21:33691874-33691896 CTTTCCAAATACCATGACCTTGG + Intronic
1179284884 21:39968670-39968692 CACCTCCAATACCATCATCTTGG + Intergenic
1179749941 21:43461804-43461826 CACTGCCCACACCATGACCTTGG - Intergenic
1180831971 22:18911113-18911135 CACCCCCTATACCCTGAGCCTGG - Intronic
1182124906 22:27809321-27809343 CACCCCCAATGCCAAGACCCAGG + Intergenic
1183007546 22:34916093-34916115 AACCCCTAATATCATCACCTTGG - Intergenic
1184090414 22:42290241-42290263 GACCCCCAGTACCCTGCCCTAGG + Intronic
1184441975 22:44522705-44522727 CACCCCCAATGCCGGGACCCAGG + Intergenic
1184848414 22:47103150-47103172 CACCCCCAAATCCACCACCTTGG - Intronic
1184956438 22:47889987-47890009 ATCTCCAAATACCATGACCTGGG + Intergenic
1185398102 22:50602792-50602814 CGCCCCCAAGAACAAGACCTGGG - Intronic
1203282049 22_KI270734v1_random:136384-136406 CACCCCCTATACCCTGAGCCTGG - Intergenic
949406114 3:3716512-3716534 CACCTCCAATACCATCACACTGG + Intronic
950006325 3:9693781-9693803 CCCCACCAATACCAAGTCCTTGG - Intronic
953400294 3:42608443-42608465 CACCTACAATACCTTGCCCTAGG - Intronic
954252556 3:49379360-49379382 CACCCCCAAGTCCCTGCCCTAGG - Intronic
954269908 3:49499729-49499751 CACCACCAATACCATCCCCCAGG - Intronic
955328007 3:58024468-58024490 CACCCCTAATTCCTGGACCTGGG + Intronic
956934000 3:74079069-74079091 ACCCCCTAATACCATCACCTTGG - Intergenic
958018107 3:87966280-87966302 CCCTCCTAATACCATAACCTTGG + Intergenic
959161583 3:102731104-102731126 CACCTCCAATACCACCACATTGG + Intergenic
959435894 3:106314706-106314728 AGCCCCCCATTCCATGACCTAGG - Intergenic
960314909 3:116164825-116164847 CTCCCCCAACACCATGTACTTGG - Intronic
960326206 3:116299156-116299178 CACCCACAAGACCTTGAACTGGG + Intronic
960635108 3:119777203-119777225 CACCTCCAAAACCATCACCTTGG + Intergenic
960683683 3:120275179-120275201 CACCTCCAAGACCATTGCCTTGG - Intronic
961641803 3:128369436-128369458 CAACCCCAATAACCTGTCCTTGG + Intronic
962958207 3:140285915-140285937 GTCATCCAATACCATGACCTGGG + Intronic
965016158 3:163159969-163159991 TACCTCCAATACCATCACATTGG - Intergenic
966003853 3:174983715-174983737 GACTCCTAATACCATTACCTTGG + Intronic
967410955 3:189166100-189166122 GACCCTCAATAACATGGCCTTGG + Intronic
968618144 4:1591585-1591607 CACTCACAATAACATGAACTAGG - Intergenic
969431578 4:7158026-7158048 CACTCCTAAAACCATCACCTTGG - Intergenic
971159618 4:24120638-24120660 ACCTCCCAATACCATCACCTTGG - Intergenic
971447266 4:26764371-26764393 CACCCCCAATTCCATACCATGGG - Intergenic
972842239 4:42944987-42945009 CACCTCCTTTACCATGACCTTGG - Intronic
972853327 4:43075696-43075718 CACCTCCAATATCATCACATTGG + Intergenic
973297681 4:48543539-48543561 CACCCCCAAGATCTTAACCTGGG - Intronic
973795011 4:54416255-54416277 CACTCCTAATACCATCACATTGG + Intergenic
974719524 4:65719548-65719570 CCCTCCCAATACCATCAACTTGG + Intergenic
976844189 4:89468667-89468689 ACTCCCAAATACCATGACCTTGG - Intergenic
977779307 4:100961775-100961797 CACTCCTAATACCATCACCTTGG - Intergenic
977876576 4:102157041-102157063 CACCTCCTATATCATCACCTTGG - Intergenic
978103863 4:104877084-104877106 CACTCCAAATACCATGACATTGG - Intergenic
978155993 4:105489747-105489769 AACTCCTAATACCATCACCTTGG - Intergenic
978866796 4:113522913-113522935 CACACCAAATACCATCACATTGG - Intronic
981676807 4:147351945-147351967 CACCTTCTATACCATCACCTTGG + Intergenic
981686512 4:147460601-147460623 GACTCCTAATACCATCACCTTGG - Intergenic
982121796 4:152150254-152150276 ATCTCCCAATACCATCACCTCGG + Intergenic
982219346 4:153111574-153111596 CACTCCTAATACCACCACCTTGG - Intergenic
983798469 4:171896716-171896738 ACCTCCTAATACCATGACCTGGG + Intronic
984433220 4:179675534-179675556 GTCTCCCAATACCATGCCCTTGG - Intergenic
984621378 4:181956230-181956252 AGCTCCCAATACCATCACCTTGG + Intergenic
984875726 4:184365790-184365812 CACCACCAATAGCATAACCTAGG + Intergenic
986249668 5:6044687-6044709 CACCCCAAACACCATCACATTGG - Intergenic
986670646 5:10140049-10140071 ACCCCCAAATACCATCACCTTGG - Intergenic
986674732 5:10173758-10173780 CACCTGCAACACCCTGACCTGGG - Intergenic
987255526 5:16146553-16146575 CTCCTCCAATTCTATGACCTTGG + Intronic
988716682 5:33835687-33835709 TACCCCTAATACCATTACCTTGG + Intronic
989113201 5:37927191-37927213 CACCCCCATAACCTTGACATTGG - Intergenic
990319788 5:54618434-54618456 GAACCCAAAGACCATGACCTGGG - Intergenic
991098277 5:62762610-62762632 CAAGACAAATACCATGACCTTGG - Intergenic
993309150 5:86307140-86307162 CACTCCTAATACTATCACCTTGG + Intergenic
994112738 5:96025423-96025445 CACCCCCAATACCATCACATGGG + Intergenic
994429539 5:99639976-99639998 CATCCCCAACACTATGACCTTGG + Intergenic
995089664 5:108159416-108159438 ATCTCCCAATACCATCACCTTGG - Intronic
996226608 5:121007096-121007118 ACCCCCTAATACCATCACCTTGG + Intergenic
996676584 5:126182174-126182196 CAACTCCAATGCCATCACCTTGG + Intergenic
1001601018 5:172928400-172928422 CAACCCCCATAGCAAGACCTGGG - Intronic
1002476604 5:179469843-179469865 CACCCCCGATACCATCACGTTGG + Intergenic
1004342365 6:14818856-14818878 CACCCCCAGCACCCTGCCCTGGG + Intergenic
1006039334 6:31241003-31241025 CACTGCCAACACCATGATCTTGG - Intergenic
1008564118 6:52750749-52750771 CACCCCCATTAACATGACCCAGG + Intronic
1008568428 6:52792025-52792047 CACCACCATTAACATGACCCAGG + Intronic
1012986038 6:105877361-105877383 AACTCCTAATACCATCACCTTGG + Intergenic
1013787522 6:113798076-113798098 CACCTCTAATCCCAGGACCTGGG - Intergenic
1014406070 6:121052725-121052747 CACCACCACCACCATGACCATGG - Intergenic
1017087301 6:150725293-150725315 CCCTCCTAATACCATCACCTTGG + Intronic
1021948741 7:25753791-25753813 CACACCCAAGACCATGTCCTTGG - Intergenic
1023141490 7:37106655-37106677 CACACCCAATGCCCTGTCCTTGG - Intronic
1023504394 7:40885137-40885159 CAACACCAATACCATAACCTCGG - Intergenic
1024480843 7:49860912-49860934 ACCTCCCAATACCTTGACCTTGG + Intronic
1026315879 7:69226795-69226817 CACTTCTAATACCATCACCTTGG + Intergenic
1027569669 7:79848110-79848132 CCCCTCTAATACCATCACCTTGG + Intergenic
1027808178 7:82856830-82856852 ACCCCCCAATACCATAACATTGG - Intronic
1028587038 7:92462659-92462681 CTCCCCTAATACCATTGCCTTGG - Intergenic
1029453577 7:100656019-100656041 CACCCCCAGTCCCAGGACCTCGG - Intronic
1030206287 7:106955269-106955291 AACTCCTAATACCATTACCTTGG - Intergenic
1032357652 7:131225380-131225402 CACTCCTAAAACCATGACTTTGG + Intronic
1034419342 7:150980778-150980800 CAACCCTAATACCAAGAGCTGGG + Intergenic
1034868997 7:154666326-154666348 CCCCCCCAATACAATGAAGTAGG - Intronic
1034882023 7:154770039-154770061 CCCTCCTAATACCATCACCTTGG - Intronic
1034916950 7:155047965-155047987 ACCCCCCAGTACCATCACCTTGG - Intergenic
1036484563 8:9167549-9167571 AACTCCTAATACCATCACCTTGG + Intronic
1037930040 8:22873833-22873855 CACCCCCAAGATCAAGATCTGGG - Intronic
1037976676 8:23219003-23219025 AGCCACCAATACCATGACCTGGG + Intronic
1038801134 8:30750209-30750231 CACCTACAATCCCAGGACCTTGG + Intronic
1040656432 8:49515757-49515779 CACCCCTAATCCCAGCACCTTGG + Intergenic
1041267754 8:56081698-56081720 CACCCACAATGACATGACTTTGG + Intergenic
1042365978 8:67936747-67936769 AACCCTTATTACCATGACCTTGG + Intergenic
1043083864 8:75802323-75802345 CACCCCAAATCCCATCAACTAGG - Intergenic
1043291343 8:78605500-78605522 AACCCCCAATACCATGCCTATGG + Intergenic
1043313752 8:78894806-78894828 CACCCCCAACACCATCACACTGG + Intergenic
1043992698 8:86775617-86775639 CACCTCAAATACCATCACATTGG - Intergenic
1045316848 8:101050904-101050926 CACTTGCAATTCCATGACCTTGG - Intergenic
1045991472 8:108313923-108313945 CACTCCCAATACCATTACTGTGG + Intronic
1046271515 8:111903462-111903484 CTCCCCCAATACCCTGGCCCTGG + Intergenic
1046494622 8:114997397-114997419 CACCCCCAATATTTTGACATAGG - Intergenic
1046679589 8:117153706-117153728 CACACCCCTTATCATGACCTTGG - Intronic
1048434134 8:134400095-134400117 CACCTCTAATACCATCACATTGG - Intergenic
1048870107 8:138790350-138790372 ACCTCCCAATACCATCACCTTGG + Intronic
1049006728 8:139860464-139860486 CACCCCCAATGCCAGGATCTAGG + Intronic
1049334968 8:142079450-142079472 CACCCCCAGGACCCAGACCTCGG + Intergenic
1049349927 8:142159047-142159069 CACGCCCCTTGCCATGACCTGGG + Intergenic
1049350267 8:142160607-142160629 CACGCCCCTTGCCATGACCTGGG - Intergenic
1051589871 9:18766808-18766830 CACCCCTAATACTATCACCTTGG + Intronic
1051684376 9:19642085-19642107 CTCTCCCTATACCCTGACCTGGG - Intronic
1053272243 9:36758467-36758489 CACTCCAAATACCATCACCCTGG - Intergenic
1055564031 9:77549944-77549966 CACCCCCAAGACGATGGACTGGG - Intronic
1058570067 9:106332075-106332097 CACTGCCAACACCCTGACCTTGG - Intergenic
1059779818 9:117514695-117514717 CACCCCCAACACCAAGCCCAAGG + Intergenic
1059999022 9:119941711-119941733 CCCACCTAATACCATCACCTTGG - Intergenic
1061494187 9:130962364-130962386 CACCCCCATTGACATGACCTTGG - Intergenic
1188287129 X:28341399-28341421 AACCCTTAATACCATTACCTTGG - Intergenic
1189673731 X:43439917-43439939 CCCCCCCAAAATCATGAGCTAGG + Intergenic
1190309887 X:49109737-49109759 CACCCCTAATGCCATCACATGGG + Intergenic
1190385068 X:49877641-49877663 CACCCCCTCATCCATGACCTCGG + Intergenic
1192171471 X:68858003-68858025 ACCCCCTAATACCATCACCTTGG + Intergenic
1193553935 X:82931258-82931280 GAACCCCAATCCCATGAGCTAGG + Intergenic
1193662227 X:84271470-84271492 CTCCCCCAATACCACTACATTGG - Intergenic
1193940125 X:87672558-87672580 CACCCCCAACACGATGATATTGG - Intergenic
1194601138 X:95923174-95923196 CACCTCCTATACCATCACTTGGG + Intergenic
1196970515 X:121103062-121103084 CAGTGCCAATGCCATGACCTAGG + Intergenic
1199250598 X:145658003-145658025 AACTCCTAATACCATCACCTTGG - Intergenic
1200017043 X:153173807-153173829 CATACCTAATACCATCACCTTGG - Intergenic
1200225380 X:154414036-154414058 CACCTCCTACCCCATGACCTTGG - Intronic
1200329036 X:155274930-155274952 CACACCCAATGCTAAGACCTTGG - Intergenic
1200377194 X:155795400-155795422 CTTCCCCAATACCTTGCCCTAGG + Intergenic
1200841506 Y:7786101-7786123 CTCCCACAATACCATAATCTTGG + Intergenic