ID: 1166054615

View in Genome Browser
Species Human (GRCh38)
Location 19:40280873-40280895
Sequence CTAGCTCCTCCCCCTCTAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166054613_1166054615 -4 Left 1166054613 19:40280854-40280876 CCTGATTTGAATTCGCTGCCTAG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1166054615 19:40280873-40280895 CTAGCTCCTCCCCCTCTAACCGG 0: 1
1: 0
2: 1
3: 37
4: 287
1166054610_1166054615 29 Left 1166054610 19:40280821-40280843 CCGCATGCATCTAAAGAAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 88
Right 1166054615 19:40280873-40280895 CTAGCTCCTCCCCCTCTAACCGG 0: 1
1: 0
2: 1
3: 37
4: 287
1166054611_1166054615 8 Left 1166054611 19:40280842-40280864 CCCAGTCTGTCACCTGATTTGAA 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1166054615 19:40280873-40280895 CTAGCTCCTCCCCCTCTAACCGG 0: 1
1: 0
2: 1
3: 37
4: 287
1166054612_1166054615 7 Left 1166054612 19:40280843-40280865 CCAGTCTGTCACCTGATTTGAAT 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1166054615 19:40280873-40280895 CTAGCTCCTCCCCCTCTAACCGG 0: 1
1: 0
2: 1
3: 37
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166054615 Original CRISPR CTAGCTCCTCCCCCTCTAAC CGG Intronic
901599947 1:10415520-10415542 CTGCCCTCTCCCCCTCTAACAGG + Intronic
901741705 1:11346006-11346028 CCATCTCCTCCCTCCCTAACAGG + Intergenic
906209683 1:44005654-44005676 CTAGCTCCTTAACCTCTAAACGG + Intronic
907942589 1:59103815-59103837 CTAGCCCCCTCCCCTCTGACAGG - Intergenic
908460205 1:64341832-64341854 CTACTTCCTCCCCCTCTAGTTGG + Intergenic
911974713 1:104477396-104477418 CTAGCTCCCCACCCCCCAACAGG + Intergenic
912611276 1:111047460-111047482 CTAGCCCCTCACCCCCTGACAGG + Intergenic
913680492 1:121184857-121184879 CCAGCTCCTCCCCCTCATTCCGG + Exonic
914032326 1:143972508-143972530 CCAGCTCCTCCCCCTCATTCCGG + Intergenic
914157119 1:145095459-145095481 CCAGCTCCTCCCCCTCATTCCGG - Exonic
915075666 1:153306564-153306586 CTTGCTCCTCCCCACCTCACAGG - Intronic
915769844 1:158409281-158409303 CTAGCCCCTCACCCCCAAACAGG + Intergenic
915833564 1:159154398-159154420 CCAGCTCCCCACCCTCTGACAGG + Intergenic
916027768 1:160849449-160849471 CTTGCCCCTCACCCACTAACAGG + Intronic
916830634 1:168487208-168487230 CTAGCTCCCCACCCCCTAACAGG - Intergenic
917374500 1:174334636-174334658 CTTGCTCTTCCCTCTCTACCTGG + Intronic
918919490 1:190690113-190690135 CTAGTCCCTCACCCTCTGACAGG + Intergenic
920467803 1:206203392-206203414 CCAGCTCCTCCCCCTCATTCCGG + Intronic
922802970 1:228372432-228372454 CCTGCTCCTCCTCCTCTGACTGG - Exonic
922878792 1:228963372-228963394 CTAGCCCCTCACCCCCTGACAGG + Intergenic
923060698 1:230470780-230470802 CTAGCCCCTCATCCTCCAACAGG + Intergenic
924064482 1:240208167-240208189 CCCCCTCCTCCCCCTCTACCCGG + Exonic
924558490 1:245137693-245137715 CTTGCTGCTCCCCCTTCAACAGG - Intergenic
1064542538 10:16419651-16419673 CTAGCTCCTTCCACTATGACAGG - Intergenic
1064654765 10:17546141-17546163 CTAGGTCCTCACCCTCTAACAGG - Intergenic
1067913080 10:50366794-50366816 CTAGCCCCCCACCCTCCAACAGG - Intronic
1068943453 10:62704484-62704506 CCAGCTCCCCACCCTCTGACAGG - Intergenic
1069943535 10:71971092-71971114 CTGGCTCTCCCCCTTCTAACCGG - Intronic
1070272999 10:74976133-74976155 CTCACTCCTCCTCCTCTAGCTGG + Exonic
1072407325 10:95167782-95167804 CTAGCTCCCCACCCCCCAACAGG - Intergenic
1072900822 10:99404911-99404933 TTAGCTCCTCCCCATCCTACAGG + Intronic
1073147205 10:101288660-101288682 CTAGCTCTGCCCCCTCTCCCTGG - Intergenic
1078336967 11:10472286-10472308 CTAGCCCCTCACCCCCCAACAGG - Intronic
1079458353 11:20656957-20656979 CTGGCTCCTCTCACTCTACCAGG - Exonic
1080092849 11:28368995-28369017 CTAGCTCCCCACCCTCTGACAGG - Intergenic
1080327548 11:31094941-31094963 CTAGCTCCCCACCCACTGACAGG + Intronic
1084481773 11:69425649-69425671 CGAGCTCATCCCTTTCTAACAGG - Intergenic
1087588964 11:100160069-100160091 CTAGCCCCTCACCCACCAACAGG + Intronic
1089327526 11:117667461-117667483 CTAGCCCCTCACTCTCTAATGGG + Intronic
1089676505 11:120093547-120093569 CTAGCTCCTTCCCCAATATCTGG + Intergenic
1089885264 11:121815337-121815359 CTAGTTTCTCCCCACCTAACTGG - Intergenic
1091781997 12:3219702-3219724 CTAGCTCCTCACCCCCCGACAGG - Intronic
1092645311 12:10564634-10564656 CTAGCCCCCCACCCTCTGACAGG + Intergenic
1092685531 12:11040558-11040580 CTAGCTCCCCACCCTCCAAAAGG - Intronic
1093208956 12:16284674-16284696 CTACCTCTTGCCCCTCTGACTGG + Intergenic
1093595766 12:20957079-20957101 CTAGCCCCTCACCCCCCAACAGG - Intergenic
1094730599 12:33170064-33170086 CTAGCCCCTCACCCCCTGACAGG - Intergenic
1095810823 12:46372240-46372262 CTAGCTCCCCTCCCCCTAATGGG + Intronic
1096543468 12:52321605-52321627 CTTGCTCCTGCCCCTCCCACTGG + Intergenic
1099294542 12:80813765-80813787 CTGGCTCCTGCCCCTCTGAGCGG + Intronic
1099661373 12:85567913-85567935 CAAGCTCCTCCACCTCGAACAGG - Intergenic
1099744387 12:86684180-86684202 CTTGCTCCTCACCCCTTAACAGG + Intronic
1100647342 12:96545240-96545262 CTAGCTCCCCACCCCCTGACTGG - Intronic
1100841199 12:98613129-98613151 CTAGTTTCTCTTCCTCTAACTGG + Intergenic
1101588028 12:106101940-106101962 CCAGCTCCTACACCTCTCACTGG - Intronic
1104327816 12:127816821-127816843 CTTGCTCCCCACCCTCCAACAGG - Intergenic
1104415181 12:128592148-128592170 CTAGCAGCTGCCCCTTTAACTGG + Intronic
1109722912 13:66299297-66299319 CTAACTGCTCTCCTTCTAACTGG - Intergenic
1110864016 13:80374739-80374761 CTACCTCCTCCCCCTCTTTCTGG - Intergenic
1111352333 13:87047284-87047306 CTAGCCCCTCACCCTGCAACAGG - Intergenic
1111426697 13:88094036-88094058 CTAGCCCCTCACCCCCTGACAGG - Intergenic
1111796608 13:92928617-92928639 CTAGCCCCCCACCCTCTGACAGG - Intergenic
1111999716 13:95198951-95198973 CTTGCCCCTCACCCTCTGACAGG - Intronic
1112011669 13:95298853-95298875 CTAGCTCCTTCCCTTCCATCAGG + Intronic
1115417210 14:33149932-33149954 CTAGCCCCTCACCCCCTGACAGG + Intronic
1116379423 14:44246670-44246692 CTAGCTCCGCACCCACTGACAGG - Intergenic
1116765700 14:49067762-49067784 CTAGCCCCCCACCCTCCAACAGG - Intergenic
1117009555 14:51456299-51456321 CTAGCCCCTCGCCCCCTGACAGG + Intergenic
1117316915 14:54580136-54580158 CCAGCTCTTCCCCTACTAACAGG - Intronic
1121284785 14:92726714-92726736 CTTCCTCCTCCCCATCTACCTGG + Intronic
1121750813 14:96354280-96354302 CTCACTCCTCACCCTCTGACAGG + Intronic
1122128663 14:99592780-99592802 CTGGCTCCTTCCCCACAAACAGG - Intronic
1122782914 14:104151148-104151170 CTTGCTCCTCCTCCTCTTCCTGG + Intronic
1122889961 14:104727668-104727690 CCAGCTCCTACCCCTCAAATGGG + Intronic
1122959031 14:105086122-105086144 CCAGCCCCTCCTCCTCTAACAGG + Intergenic
1123481372 15:20635082-20635104 CTAGCCCCTCACCCCCCAACAGG - Intergenic
1123636641 15:22365283-22365305 CTAGCCCCTCACCCCCCAACAGG + Intergenic
1125097824 15:35874830-35874852 CTATCTCCTCCCCCTCCTTCAGG + Intergenic
1125468849 15:39982693-39982715 CTAGCTCCCCACCCCCTAACAGG + Intronic
1126839547 15:52703685-52703707 CTAGCCCCCCACCCCCTAACAGG - Intronic
1128285317 15:66431843-66431865 CTCTCTCCTCCCCCACTGACAGG + Intronic
1133478497 16:6146958-6146980 TTAGCTCCTCCTCCTCCCACTGG + Intronic
1134000567 16:10779679-10779701 CTAGGTCTTCTCCCTGTAACTGG - Intronic
1134857887 16:17535877-17535899 CTAGCTCCTCCTCCTCCCTCAGG + Intergenic
1135427703 16:22353530-22353552 CTGCCTCCTCCCTCTCTACCAGG + Intronic
1135639201 16:24105530-24105552 CTTGCCCCTCACCCCCTAACAGG + Intronic
1136477567 16:30523030-30523052 CTAGCTCCACACCCTCTCCCAGG + Exonic
1137868205 16:51923363-51923385 CTAGCCCCCCACCCTCTGACAGG + Intergenic
1138095178 16:54205804-54205826 TTAGCTCCAGCCCCTCTGACAGG + Intergenic
1140059482 16:71555498-71555520 CAAGCTGCTCACCCTCCAACTGG - Intronic
1140732543 16:77869805-77869827 TTAGCTGCTCCCCCTCGATCGGG - Intronic
1141704094 16:85655217-85655239 TTGGCTCCTCCCCTTCTCACCGG + Intronic
1142474780 17:182264-182286 TTCTCTCCTCCCCCTCTAGCAGG + Intergenic
1142703031 17:1676014-1676036 CTAGCTCCTCCCTCTGAGACTGG + Exonic
1143583962 17:7842263-7842285 CCAGCTCCGCCCCCTCCATCCGG - Intronic
1143725411 17:8841778-8841800 CTCGCTCCTCTCCCACTACCGGG + Intronic
1144172501 17:12671947-12671969 CTGGCTCCTCCCCCTTGATCTGG - Intronic
1144810149 17:17993806-17993828 CTGGCTCATCCCCCTGTACCTGG - Intronic
1146745763 17:35328053-35328075 CTAGCTCCCCACCCCCTAACAGG + Intergenic
1148770756 17:50064626-50064648 TTGGCTCCTCCACCTCTACCCGG + Intronic
1149061350 17:52426007-52426029 CTTGCTCCCCACCCCCTAACAGG - Intergenic
1152020529 17:77777976-77777998 CCGGCTCCTCCCTCCCTAACTGG + Intergenic
1154135970 18:11778507-11778529 TTAGCTTCTCCTCCTCTCACAGG + Intronic
1154311841 18:13272947-13272969 CTAGCTTCTCTCTCTCTCACAGG - Intronic
1155097922 18:22577733-22577755 CTAGCCCCTCACCCCCTGACAGG + Intergenic
1155350310 18:24899764-24899786 CTAGCCCCCCACCCTCTGACAGG - Intergenic
1157120807 18:44909299-44909321 CTTGCTACTCCACCTCTAGCTGG + Intronic
1157176291 18:45455487-45455509 CTAGCCCCCCACCCTCTGACAGG - Intronic
1157532663 18:48434763-48434785 CTAGCCCCCCACCCCCTAACAGG - Intergenic
1157867096 18:51196930-51196952 CCAGCTCCTCCTCCTCCAGCAGG + Exonic
1159762309 18:72443512-72443534 CTTGCTCCCCACCCTCCAACAGG - Intergenic
1160891396 19:1380571-1380593 CTGGGTCCTTCCCCTCTCACTGG + Intergenic
1161957950 19:7506692-7506714 CAAGCTCCTCCCCCTTTCTCTGG + Intronic
1162730528 19:12715787-12715809 CTAGCACCTCCCCCTCCCACTGG + Intronic
1163145021 19:15374065-15374087 TTGGCTCCTCCCCCTGTGACAGG - Exonic
1163938604 19:20473208-20473230 CCAGCCCCTCCCCCTCTCTCGGG - Intergenic
1165923056 19:39310706-39310728 CAAGCTCCACCCCCTCTGACAGG + Intronic
1166054615 19:40280873-40280895 CTAGCTCCTCCCCCTCTAACCGG + Intronic
1166331953 19:42083458-42083480 CTAGCCCCTCACCCTCTGACAGG + Intergenic
1167060671 19:47143773-47143795 CTAGCTCCACCACATCTAGCTGG + Intronic
1167125144 19:47544404-47544426 GTGGCTCCTCCCCACCTAACTGG + Exonic
1168404397 19:56103227-56103249 CTGTCTCATCCCCTTCTAACAGG - Exonic
925698678 2:6611013-6611035 CTAGCCCCCCACCCTCCAACAGG + Intergenic
925835027 2:7936085-7936107 CTAGCACCTCCCTCTCAAAGGGG + Intergenic
925849034 2:8062432-8062454 CCAGCTCTTCCCTCTCTCACAGG + Intergenic
926431708 2:12793685-12793707 CTAGCCCCCCACCCCCTAACAGG - Intergenic
927657240 2:24959608-24959630 CTAGCTCCTGACCTTCAAACTGG + Intronic
928399700 2:30969030-30969052 CTGGCTCCTTCCCCTCTGCCTGG - Intronic
929273021 2:39994920-39994942 CTATCTCCTACTTCTCTAACGGG - Intergenic
932067488 2:68581239-68581261 CTAGCTTCTCCTTCTCTGACTGG - Intronic
934108694 2:88721208-88721230 CTAGCCCCTCACCCCCTGACAGG - Intronic
935601496 2:104926947-104926969 CTAGCCCCTCACCCCCTGACAGG - Intergenic
936736965 2:115456804-115456826 CTAGCTCCTCACCCACTGACAGG - Intronic
936999411 2:118451455-118451477 CTAGCTCCCCACCCCCTGACAGG + Intergenic
937735432 2:125282126-125282148 CTAGCTCCCCACCCCCCAACAGG - Intergenic
940403482 2:153273122-153273144 CTAGCCCCTCACCCCCTGACAGG - Intergenic
941076944 2:161016281-161016303 CTAGCTCCTCATCCCCCAACAGG - Intergenic
941518176 2:166505748-166505770 CTTGCTCCCCACCCTCTGACAGG + Intergenic
941690058 2:168491771-168491793 CTAGCCCCTCACCCCCCAACAGG + Intronic
941760985 2:169243284-169243306 CTAGCTCCCCACCCCCCAACAGG + Intronic
942988802 2:182174892-182174914 CTAGCTCCCCACCCTCTGACAGG + Intronic
943106558 2:183550973-183550995 CTATCCCCTCACCCTCTGACAGG - Intergenic
945371684 2:209026130-209026152 CTAGCTCCCCACCCCCTGACAGG - Intergenic
945627871 2:212234130-212234152 CTAGCCCCTCAACCTCTGACAGG + Intronic
947331449 2:229033523-229033545 CTAGCCCCCCACCCTCCAACAGG - Intronic
948770750 2:240250302-240250324 CTAGCTCTCCCGCCTCTACCAGG + Intergenic
1168863389 20:1062750-1062772 CTGGCTTCTCCCCATCTACCTGG + Intergenic
1170731613 20:18980878-18980900 CTTGCCCCTCACCCTCTGACAGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171571853 20:26259875-26259897 CTTGCTCCACACCCTCCAACAGG + Intergenic
1172109217 20:32535807-32535829 CCAGCCCCTCTCCTTCTAACTGG - Intronic
1172513177 20:35514645-35514667 CCAGCTTCTCCTCCTTTAACGGG - Exonic
1174961949 20:55167577-55167599 CTATCTCCTCCTCCTCTCTCTGG - Intergenic
1176703553 21:10090011-10090033 CTAGCCCCTCACCCTCTGACAGG - Intergenic
1176903108 21:14467420-14467442 CTTGCTCCTCCTCCTCTTCCTGG - Intergenic
1177183617 21:17769901-17769923 CTAGCTCCCCACCCTCTGACAGG + Intergenic
1177193873 21:17881929-17881951 CTAGCTCCTGACCCCCTAACAGG - Intergenic
1177762063 21:25413332-25413354 CTAGCCCCTCACCCCCTGACAGG - Intergenic
1178761685 21:35409138-35409160 CTAGCCCCTCACCCACCAACAGG + Intronic
1182040523 22:27235625-27235647 CTAGCCCCTCACCCCCTGACAGG - Intergenic
1184181703 22:42832611-42832633 CTAGCTCCTCCCAGTCCCACTGG - Intronic
950969977 3:17176643-17176665 CTAGCCCCTCACCCTCCAACAGG - Intronic
951358621 3:21699331-21699353 CTAGCCCCTCACCCCCTGACAGG - Intronic
952194167 3:31055568-31055590 CTAGCCCCCCACCCTCTGACAGG + Intergenic
954292405 3:49656532-49656554 CCAGCTCCTGCCCCACTAGCTGG + Exonic
957766697 3:84634465-84634487 CTAGCTCCTCACCTGCCAACAGG + Intergenic
959206322 3:103311684-103311706 CTAGCCCCCCACCCTCTGACAGG + Intergenic
959676308 3:109039831-109039853 CAAGCCCCTCCCCTTCTAGCTGG + Intronic
962174514 3:133138914-133138936 CTAGCTCCCCACCCCCCAACAGG + Intronic
964156851 3:153596096-153596118 CTAGCTCCCCACCCCCTGACAGG + Intergenic
964379290 3:156081537-156081559 CTAGCCCCCCACCCGCTAACAGG - Intronic
965221887 3:165936422-165936444 CTAGGTCCCCACCCTCTGACAGG - Intergenic
965727835 3:171737931-171737953 CTACCTCCTCTCCCTCAAAGTGG + Exonic
966929667 3:184667916-184667938 CTTGTTCCTTCCCCTCTGACTGG - Intronic
967241705 3:187445873-187445895 CCAGCTGCTCCACCTCTGACAGG + Intergenic
967285162 3:187862145-187862167 CTAGCCCCTCACCCCCTGACAGG - Intergenic
969365670 4:6692894-6692916 CCAGCTCCTCCTCCTCTGAGAGG + Intergenic
970809905 4:20080186-20080208 CTAGTCCCTCACCCTCTGACAGG + Intergenic
971187061 4:24388812-24388834 CTAGCCCCCCACCCTCCAACAGG - Intergenic
971771915 4:30908092-30908114 CTAGCCCCTCACCCCCGAACCGG - Intronic
971800073 4:31277871-31277893 CTAGCTCCCCACCCTCTGACAGG - Intergenic
971980908 4:33748500-33748522 CTGGCTCCTTCCCCTCTTACAGG + Intergenic
972111074 4:35560255-35560277 CTCGCTCCTCCCACTCAACCTGG - Intergenic
972333390 4:38083674-38083696 CTAGCTACTCAACCTCAAACAGG - Intronic
972446528 4:39149547-39149569 CTTGCTCCCCACCCCCTAACAGG - Intergenic
972735010 4:41831969-41831991 CTATATGCTCCCACTCTAACAGG - Intergenic
973058107 4:45685990-45686012 CTAGCTCCCCACCCTGCAACAGG - Intergenic
973062682 4:45748487-45748509 CTAGCTCCCCACCCCCTAACAGG + Intergenic
973173839 4:47179113-47179135 CTAGCCCCTCACCCCCTGACAGG + Intronic
973264753 4:48200144-48200166 CTAACTTCTCCCCCTCTTTCAGG - Intronic
973577095 4:52301295-52301317 CTATCTCCTCACCCTACAACAGG + Intergenic
974730536 4:65858903-65858925 CTAGCCCCCCACCCTCTAACAGG - Intergenic
975528010 4:75372662-75372684 CTAGCTCCCCACCCCCTGACAGG - Intergenic
976005134 4:80420814-80420836 CTAGCTCCAACCCCTTTAATAGG + Intronic
976983260 4:91259589-91259611 CTAGCCCCCCACCCTCCAACAGG + Intronic
977052750 4:92150053-92150075 CTAGCCCCTCACCCCCCAACAGG - Intergenic
977632161 4:99255165-99255187 CTAGCTCCCCACCCCCTGACAGG + Intergenic
979678931 4:123438313-123438335 CTAACTCCTGCCACTCTAAGAGG - Intergenic
979817592 4:125129213-125129235 CTAGTCCCTCACCCTCTGACAGG + Intergenic
980375772 4:131946367-131946389 CTAGCCCCTCACCCTCTGACAGG - Intergenic
980633388 4:135468130-135468152 CTAGCTCCCCACCCCCTGACAGG + Intergenic
981540990 4:145846149-145846171 CCAGATCCTCCCCATCTTACTGG + Intronic
981750453 4:148088707-148088729 CTAGCCCCCCACCCTCCAACAGG - Intronic
985321901 4:188722134-188722156 CTAGCCCTCCACCCTCTAACAGG + Intergenic
985824464 5:2182052-2182074 CTGGCCCATCCCCCTCCAACTGG - Intergenic
986005436 5:3663823-3663845 CTAGCTCCCCACCCCCTAACAGG + Intergenic
987287692 5:16474932-16474954 CTTGCTGCACACCCTCTAACTGG + Exonic
988355748 5:30171789-30171811 CTAGCTCCCTGCCCTCCAACAGG - Intergenic
988443478 5:31258480-31258502 CTAGCCCCTCACCCACAAACAGG - Intronic
988618768 5:32801081-32801103 CTAGCTCCCCACCCCCCAACAGG - Intergenic
988772010 5:34441786-34441808 CTAGCCCCCCACCCCCTAACAGG + Intergenic
989364469 5:40640256-40640278 CTGGCTCCTCACCCCCTGACAGG - Intergenic
989818133 5:45761705-45761727 CTAGCCCCTCACCCCCCAACAGG + Intergenic
993077932 5:83258031-83258053 CTTGCTCCTCACCCACTGACAGG - Intronic
993316313 5:86410885-86410907 CTAGCTCCCCCGCCCCCAACAGG + Intergenic
993346733 5:86793570-86793592 CTAGCCCCTCACGCCCTAACAGG + Intergenic
993772349 5:91945093-91945115 CTAGCCCCCCACCCTCTGACAGG - Intergenic
993930520 5:93933645-93933667 CTAGCCCCCCACCCCCTAACGGG - Intronic
994034550 5:95184000-95184022 CTAGCCCCTCACCCCCCAACAGG - Intronic
995017958 5:107333320-107333342 CTAGCTCCCCACCCCCTGACAGG + Intergenic
995386359 5:111594047-111594069 CTAGCTCCTCACCCCCTCACAGG - Intergenic
995398152 5:111711351-111711373 CTAGCTCCCCACCCCCTGACCGG + Intronic
995941576 5:117592317-117592339 CTAGCTCCTCACCCCCCAACAGG + Intergenic
996882902 5:128321442-128321464 CTAGCCCCTCACCCTCCGACAGG + Intronic
997100888 5:130968294-130968316 CTAGCTCCCCACCCCCCAACAGG + Intergenic
999587807 5:153110337-153110359 CTAGCTGCTCTGCCTATAACAGG - Intergenic
999641143 5:153674478-153674500 CTCCCTCCTCCCCCTCTCACAGG + Exonic
1000123071 5:158216439-158216461 CTTGCCCCTCTCCCTGTAACAGG + Intergenic
1000202744 5:159027757-159027779 CTGGTTCCTACCCCTCTAGCCGG + Intronic
1000361662 5:160453283-160453305 GTAGCTCCTCCACCTCTCAAGGG + Intergenic
1003835155 6:10063365-10063387 CTATCTTTTCCCCCTCAAACTGG - Intronic
1004171606 6:13299691-13299713 CCAGCTCCTTCCCCTCCACCTGG - Intronic
1005777739 6:29155176-29155198 ACAGCTCCCCACCCTCTAACAGG + Intergenic
1006222972 6:32510116-32510138 CTAGCTCCCCACCCCCCAACAGG - Intergenic
1006277105 6:33013819-33013841 CCAGCTCCTCCCACTCCAGCAGG + Intergenic
1006850051 6:37091943-37091965 CTAGCTGCTTCCCCTCTCAAAGG - Intergenic
1007578442 6:42940751-42940773 CCAGCCTCTCCCCCTCTACCAGG + Intergenic
1009751525 6:67883613-67883635 CTAGCTCCTCCACCTCCTCCTGG - Intergenic
1009958950 6:70495785-70495807 CTAGCCCCTCACCCCCTGACAGG + Intronic
1010937135 6:81875576-81875598 CTAGCTCCTCACCCTGCAACAGG - Intergenic
1010959817 6:82133098-82133120 CTTGCCCCCCACCCTCTAACAGG - Intergenic
1012970605 6:105726055-105726077 CTAGCTCCCCACCCCCTGACAGG - Intergenic
1015291689 6:131544878-131544900 CTAGCTCCCCACCTTCCAACAGG - Intergenic
1017196814 6:151710720-151710742 CTAGCCCCCCACCCTCTGACAGG + Intronic
1019007232 6:168809135-168809157 CTAGCTCCCCACCCTGTGACAGG - Intergenic
1019166928 6:170103259-170103281 CTCGCTCCTCCACCTCCATCAGG + Intergenic
1021937283 7:25643782-25643804 CTAGCTCCACCCTTTCCAACTGG + Intergenic
1023156058 7:37253570-37253592 CTAGCCTCTCACCCTCTGACAGG - Intronic
1023626677 7:42121721-42121743 CCACCTCCTCCCCCTCCATCAGG + Intronic
1023742671 7:43294502-43294524 CTAGCTCCTCCCGGTCTCACTGG + Intronic
1024949910 7:54849845-54849867 CTAGCTCCCCACCCCCTGACAGG + Intergenic
1025228270 7:57181918-57181940 CCTCCTCCTCCCCCTTTAACAGG + Intergenic
1025776204 7:64562882-64562904 CCAGCCCCTCCCCCTCTCTCGGG + Intronic
1025777859 7:64574871-64574893 CCAGCCCCTCCCCCTCTCTCGGG - Intergenic
1025788509 7:64666308-64666330 CCAGCCCCTCCCCCTCTCTCGGG - Intronic
1027511665 7:79089836-79089858 CTAGCCCCTCACCTTCTGACAGG - Intronic
1027613211 7:80388733-80388755 CTAGCTCCTCTCTCTCTCCCAGG + Intronic
1027803619 7:82786738-82786760 CTAGCTCCCCACCCCCCAACAGG + Intronic
1028150273 7:87364313-87364335 CTGGCTCCTCCTCCTCTGATTGG - Intronic
1030146741 7:106364486-106364508 CTAGCCCCTCACCCCCTGACAGG - Intergenic
1030858090 7:114587225-114587247 CTTGCTCCCCACCCCCTAACAGG + Intronic
1031019224 7:116608900-116608922 CTAACTCCTCACCCCCTGACAGG - Intergenic
1032408726 7:131676864-131676886 CTAGCCCCTCACCCACCAACAGG + Intergenic
1033430600 7:141285935-141285957 CTAGCTCCCCATCCTCTGACAGG - Intronic
1033629234 7:143140672-143140694 CGTGCTCCTCCTCCTCTAAGGGG - Intergenic
1034485132 7:151355859-151355881 TTTGCTCCTCTTCCTCTAACTGG - Exonic
1035356141 7:158276974-158276996 CGGGCTCCGTCCCCTCTAACAGG + Intronic
1035695962 8:1596020-1596042 CTAGCTCCCCACCCCCCAACAGG + Intronic
1037764721 8:21765508-21765530 CTAGCTCTTCCTCCTCTACTTGG + Intronic
1040895679 8:52366107-52366129 CTACCTCCTCCCCCTCACAGCGG - Intronic
1041404942 8:57487947-57487969 CTTGCTCCCCACCCTCTGACAGG - Intergenic
1042190296 8:66178895-66178917 CCAGGTCCACCCCCTCCAACTGG - Intergenic
1042640833 8:70932468-70932490 CTACCTCCTTCTCTTCTAACAGG - Intergenic
1043753330 8:83969149-83969171 CTAGCTCCCCACCCCCTGACAGG - Intergenic
1044763479 8:95547511-95547533 CCAGCCCCTCACCCCCTAACAGG - Intergenic
1048122814 8:131600626-131600648 CTAGCTCCCCACCCTCCAACAGG + Intergenic
1048592550 8:135834184-135834206 CCAGCTCCTCTCCCTCCATCAGG - Intergenic
1048729929 8:137427121-137427143 CTAGCTCCCCACCCCCTGACAGG + Intergenic
1050129610 9:2397873-2397895 TTAGCCCCTCACCCTCTGACAGG + Intergenic
1050176269 9:2872432-2872454 TTTGCTCCTCCCCATCTAGCTGG + Intergenic
1050451265 9:5783794-5783816 CTAGCCCCCCACCCTCTGACAGG - Intronic
1050492947 9:6208527-6208549 CTAGTCCCTCACCCTCTGACAGG - Intergenic
1051338575 9:16090409-16090431 CTAGCCCCCCACCCCCTAACAGG - Intergenic
1052158787 9:25229152-25229174 CTAGCTCCCCACCCTCTGACAGG + Intergenic
1052221025 9:26022623-26022645 CTAGCTCCCCACCCCCAAACAGG + Intergenic
1052329969 9:27257533-27257555 CTAGCTCCCCACCCACCAACAGG - Intergenic
1053640816 9:40077032-40077054 CTAGCCCCTCACCCTCTGACAGG - Intergenic
1053765320 9:41388440-41388462 CTAGCCCCTCACCCTCTGACAGG + Intergenic
1054321503 9:63673015-63673037 CTAGCCCCTCACCCTCTGACAGG - Intergenic
1054543936 9:66299600-66299622 CTAGCCCCTTACCCTCTGACAGG + Intergenic
1054932160 9:70646561-70646583 CTAGCCCCTCACCCCCTAACAGG - Intronic
1057142224 9:92734585-92734607 CTCCCTCCTCCCCCTCCCACAGG + Intronic
1059562955 9:115352930-115352952 CTAGCTCCCCACCCCCCAACAGG + Intronic
1060556842 9:124512398-124512420 CTCGCTCTTCCCCCTCTGCCTGG + Intergenic
1061947899 9:133919129-133919151 CTAGCTCCGCCCTCTCCATCAGG + Intronic
1202788588 9_KI270719v1_random:60106-60128 CTAGCCCCTCACCCTCTGACAGG - Intergenic
1185511855 X:669726-669748 CTAGCCCCTCACCCCCCAACAGG - Intergenic
1185661194 X:1730278-1730300 CTAGCCCCTCACCCCCTGACAGG - Intergenic
1185674755 X:1840202-1840224 CTAGCCCCTCACCCCCTGACAGG + Intergenic
1185683449 X:1907844-1907866 CTAGCCCCTCACCCCCTGACAGG - Intergenic
1186061727 X:5715478-5715500 CTAGCCCCACACCCTCTGACAGG - Intergenic
1186788162 X:12972473-12972495 CTAGCTCCTCACACTCTTCCTGG + Intergenic
1187896719 X:23988724-23988746 CCAGCTCTTCCCCGCCTAACAGG + Exonic
1188257548 X:27981040-27981062 CTGTCTCCTCTCCCACTAACGGG + Exonic
1188667158 X:32838394-32838416 CTAGCCCCCCACCCTCTGACAGG + Intronic
1188778865 X:34254941-34254963 CTAGCCCCCCACCCCCTAACAGG - Intergenic
1189090470 X:38077136-38077158 CTAGTTCCACCTCTTCTAACTGG + Intronic
1190460657 X:50670257-50670279 CTAGCCCCCCACCCTCTGACAGG + Intronic
1191164720 X:57376383-57376405 CTAGCCCTTCACCCTCTGACAGG + Intronic
1191728696 X:64310648-64310670 CTAGCCCCTCACCCCCCAACAGG + Intronic
1191986929 X:66992085-66992107 CTAGCCCCTCACCCTCTAAGAGG + Intergenic
1192857696 X:75031388-75031410 CTAGCCCCCCACCCTCTGACAGG + Intergenic
1193003797 X:76592651-76592673 CTAGCCCCCCACCCTCCAACAGG + Intergenic
1193250038 X:79280210-79280232 CTAGCTCCCCACCCACCAACAGG - Intergenic
1193326715 X:80186654-80186676 CTAGCTCCCCACCCTCTCACAGG + Intergenic
1193862537 X:86687885-86687907 CTAGCCCCCCACCCTCTGACAGG - Intronic
1194316485 X:92383473-92383495 CTAGCCCCACACCCTCCAACAGG + Intronic
1194514789 X:94839348-94839370 CTAGCTCCCCACCCCCTGACAGG + Intergenic
1194633936 X:96320978-96321000 CTAGCCCCCCACCCTCCAACAGG + Intergenic
1195456204 X:105072787-105072809 CTAGCTCCTCACTCCCCAACAGG + Intronic
1196238980 X:113318006-113318028 CTAGCCCCTCACCCCCTGACAGG - Intergenic
1196587760 X:117449408-117449430 CTAGCTCCCCACACTCCAACAGG - Intergenic
1197902108 X:131384356-131384378 TTGGCTCCTCCCCCTGTATCTGG + Intronic
1198001709 X:132445943-132445965 TTAGCTCCCCACCCTCCAACAGG + Intronic
1198072837 X:133166432-133166454 CTAGCCCCTCACCCCCTAACAGG - Intergenic
1200624661 Y:5496793-5496815 CTAGCCCCACACCCTCCAACAGG + Intronic