ID: 1166059139

View in Genome Browser
Species Human (GRCh38)
Location 19:40314094-40314116
Sequence TCAGGCTCTAGAGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166059139_1166059145 18 Left 1166059139 19:40314094-40314116 CCTGCAGCATCTCTAGAGCCTGA No data
Right 1166059145 19:40314135-40314157 AACAAAAACAAGGCTGGGTGCGG 0: 3
1: 25
2: 294
3: 1884
4: 7521
1166059139_1166059146 21 Left 1166059139 19:40314094-40314116 CCTGCAGCATCTCTAGAGCCTGA No data
Right 1166059146 19:40314138-40314160 AAAAACAAGGCTGGGTGCGGTGG 0: 6
1: 159
2: 1314
3: 5886
4: 19152
1166059139_1166059143 12 Left 1166059139 19:40314094-40314116 CCTGCAGCATCTCTAGAGCCTGA No data
Right 1166059143 19:40314129-40314151 AGTAAAAACAAAAACAAGGCTGG No data
1166059139_1166059142 8 Left 1166059139 19:40314094-40314116 CCTGCAGCATCTCTAGAGCCTGA No data
Right 1166059142 19:40314125-40314147 ACACAGTAAAAACAAAAACAAGG No data
1166059139_1166059144 13 Left 1166059139 19:40314094-40314116 CCTGCAGCATCTCTAGAGCCTGA No data
Right 1166059144 19:40314130-40314152 GTAAAAACAAAAACAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166059139 Original CRISPR TCAGGCTCTAGAGATGCTGC AGG (reversed) Intergenic
No off target data available for this crispr