ID: 1166060233

View in Genome Browser
Species Human (GRCh38)
Location 19:40321305-40321327
Sequence GCCGGAGGTACAGGAGGGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166060222_1166060233 2 Left 1166060222 19:40321280-40321302 CCGCCGACGAGGGGGCCGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1166060233 19:40321305-40321327 GCCGGAGGTACAGGAGGGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 230
1166060220_1166060233 5 Left 1166060220 19:40321277-40321299 CCACCGCCGACGAGGGGGCCGCT 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1166060233 19:40321305-40321327 GCCGGAGGTACAGGAGGGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 230
1166060224_1166060233 -1 Left 1166060224 19:40321283-40321305 CCGACGAGGGGGCCGCTGGGAGG 0: 1
1: 0
2: 3
3: 21
4: 152
Right 1166060233 19:40321305-40321327 GCCGGAGGTACAGGAGGGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166060233 Original CRISPR GCCGGAGGTACAGGAGGGTC GGG Exonic
900661571 1:3787065-3787087 GCCGGAGGAAGAGGAGGGAGAGG - Exonic
900900625 1:5513426-5513448 GCTGGAGGTGCAGGATGGTCGGG + Intergenic
901057426 1:6455162-6455184 GCCCGAGGTACAGGATCGCCAGG + Intronic
901063523 1:6484740-6484762 GCAGGAGGGACACCAGGGTCCGG + Intronic
901624721 1:10617484-10617506 GCCGCAGGTACAGTGGGGGCTGG - Intronic
901653128 1:10754525-10754547 GCCTGGGGTCCAGTAGGGTCAGG - Intronic
902584162 1:17427802-17427824 GCTGGAGGGACTGGAGGGACCGG + Intronic
903172547 1:21563085-21563107 GCAGGTGGGAGAGGAGGGTCAGG - Intronic
904756602 1:32771676-32771698 GGCGGAGCTGGAGGAGGGTCTGG - Exonic
905226390 1:36481854-36481876 GCCGCAGTGACAGGAGGGCCAGG - Intronic
905766656 1:40607342-40607364 GCCAGAGGAACAAGATGGTCTGG - Intergenic
906109804 1:43315063-43315085 GCCTGAGGGACAGAAGGGTGTGG - Intronic
907464322 1:54624812-54624834 GCTGAAGGTACAGGAGGGAGAGG + Intronic
908688634 1:66752542-66752564 GCCGGAGGTCTGGGAGGCTCCGG + Exonic
910441822 1:87260811-87260833 GCAGGAGGAATAGGAGGGTGAGG + Intergenic
911561869 1:99416465-99416487 GCTGAAGATACAGGAGAGTCAGG + Intergenic
922785494 1:228280505-228280527 GCAGGAGGGATAGGAGGGTGAGG - Intronic
923058582 1:230449113-230449135 GTCGGAGGCACAGCAGGGTGAGG - Intergenic
1062790203 10:298812-298834 GCCTGAGGAACTGGAGGGTTGGG - Intronic
1062821109 10:535161-535183 GGCTGCGGTAGAGGAGGGTCTGG - Intronic
1062950858 10:1502200-1502222 GCAGCAGGTGCAGGAGGGGCCGG - Intronic
1064097012 10:12431370-12431392 GCCGGGTGCACAGGTGGGTCTGG + Intronic
1064382734 10:14861022-14861044 GCCAGAGGTATAGTAGGGTGAGG + Intronic
1064414494 10:15136609-15136631 TCAGGAGGATCAGGAGGGTCAGG - Intronic
1067144645 10:43686287-43686309 GCTGGAGGAACAGGTGGGTCAGG + Intergenic
1067723281 10:48746116-48746138 GCCGCAGGTAGCGGAGGGGCAGG - Intronic
1067832360 10:49617486-49617508 GCCAGAAGTCCAGGAGAGTCTGG + Intronic
1073353336 10:102835182-102835204 GCTGGAGGGAGAGGAGGGTTGGG - Intronic
1075205941 10:120448603-120448625 ACCAGAGGTACAGGAGGAGCTGG + Intergenic
1076067268 10:127458703-127458725 GCAGGAGGTGAAGGAGGGTCGGG + Intergenic
1076164807 10:128273167-128273189 GCAGGAGCTCCAGGAGAGTCTGG + Intergenic
1076207275 10:128613227-128613249 GACAGAGGCAGAGGAGGGTCAGG - Intergenic
1076813077 10:132899181-132899203 CCAGGAGGGACAGGAAGGTCGGG + Intronic
1077476817 11:2794355-2794377 GTAGGAGGGTCAGGAGGGTCTGG + Intronic
1078631600 11:13009212-13009234 GCTGGAAGTGCAGGAGGCTCAGG - Intergenic
1078672134 11:13374979-13375001 GCCTGAGGAGCAGCAGGGTCTGG - Intronic
1083048124 11:59754863-59754885 TCTGGAGATACAGGACGGTCAGG - Intronic
1083627666 11:64079788-64079810 TCTGGAGGTACAGCTGGGTCTGG + Intronic
1083697158 11:64450448-64450470 CCAGGAGGTACAGGAGAATCTGG - Exonic
1084144101 11:67254893-67254915 GCCGTAGGTAGATCAGGGTCTGG - Exonic
1084564388 11:69920940-69920962 GCCACAGGTGCAGGAGGGTGGGG + Intergenic
1085453182 11:76649842-76649864 GCTGGGGGTACAGAAGGGGCAGG + Intergenic
1088965736 11:114719436-114719458 GCCACAGGCTCAGGAGGGTCGGG + Intergenic
1089680732 11:120117582-120117604 TCAGGAGATACATGAGGGTCTGG + Intronic
1091287560 11:134416232-134416254 GCCAGAGGTGCCTGAGGGTCGGG - Intergenic
1092522661 12:9290162-9290184 GAGGGAGGGAGAGGAGGGTCAGG - Intergenic
1092544624 12:9441735-9441757 GAGGGAGGGAGAGGAGGGTCAGG + Intergenic
1094233448 12:28135825-28135847 AACAGAGGTCCAGGAGGGTCAGG + Intronic
1096193805 12:49636068-49636090 GCAGGAGGTACAGGGGAGTGGGG - Intronic
1096260173 12:50085415-50085437 GCCGGAGCCTCAGGAGGGGCGGG + Exonic
1096656804 12:53097385-53097407 GCTGGAGGGACTGGAGGGTGGGG - Intergenic
1097777750 12:63668282-63668304 GCCGGAGGTAGAGGAGGAGATGG - Exonic
1097818731 12:64105056-64105078 GGCGGAGGTGCAGGAGGATGGGG - Intronic
1098684195 12:73398230-73398252 ACCAGAGGTACAGGAGGAACTGG + Intergenic
1100012214 12:89967231-89967253 GGAGGAGGTAAAGGAGGGTGTGG + Intergenic
1102179865 12:110904472-110904494 GCAGGAAGTACAGGAGGTGCGGG - Intronic
1102459623 12:113092480-113092502 GCCAGAGGAAGAGGAGAGTCAGG + Intronic
1104974724 12:132547463-132547485 GCCGGGGGCAGAGGAGGGGCTGG - Intronic
1108350261 13:49585329-49585351 GCGGGAGGTACAGGAGTAACGGG + Intronic
1109784442 13:67156022-67156044 GCCGGAGATACAGGAGTGCTGGG + Intronic
1110996157 13:82112639-82112661 ACCAGAGGTACAGGAGGAGCTGG + Intergenic
1111282793 13:86049466-86049488 GCTGGAGCTAAAGGAGTGTCTGG + Intergenic
1113800556 13:113084294-113084316 TCCTGGGGTACAGGAGGTTCTGG - Intronic
1116940395 14:50785220-50785242 GCTGGAGATCCAGGAGGCTCTGG - Intronic
1118794924 14:69133552-69133574 GGCGGGGGTACAGGCAGGTCTGG + Intronic
1121336759 14:93082437-93082459 GCACAAGGTACAGGGGGGTCTGG - Intronic
1129174661 15:73831288-73831310 GACTGAGGAACAGGGGGGTCTGG + Intergenic
1129844430 15:78761799-78761821 GCCTGAGGTAGAGGTGGTTCTGG - Intronic
1129884076 15:79026534-79026556 GCCAGACGTACAGGGGGTTCTGG - Intronic
1130381405 15:83375335-83375357 CCAGGAGGTACAGGAGGTCCAGG + Intergenic
1132096160 15:98986641-98986663 GCCAGAAGTACAGGTGGATCTGG + Intronic
1132693153 16:1190655-1190677 GACGGTGGTATAGCAGGGTCTGG - Intronic
1133050275 16:3113481-3113503 CCCGGAGGTACAGATGGGGCTGG + Exonic
1133119643 16:3598187-3598209 GGCCCAGGCACAGGAGGGTCTGG + Intronic
1133745061 16:8680080-8680102 GCTGGAGGTGGGGGAGGGTCGGG - Intronic
1138456625 16:57124865-57124887 GCAGGAGGAACAGGAGGGCCTGG - Intronic
1139630683 16:68230353-68230375 GCCGGAGGGCCTGGCGGGTCTGG - Intronic
1142138481 16:88462143-88462165 GACGGAGGCACAGGAGGCTGAGG - Intronic
1142621695 17:1169487-1169509 TCCAGAGCTACAGAAGGGTCTGG + Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1143099916 17:4499253-4499275 GCCGGGGGTGCCGGGGGGTCCGG - Exonic
1143272040 17:5683051-5683073 GCCAGAGGGACAGGAGGGAGAGG - Intergenic
1146611317 17:34307460-34307482 GCCAGAGGTGCAGGATGCTCTGG - Intergenic
1147466807 17:40616814-40616836 GCCAGAAGGACAGGAGGGGCTGG - Intergenic
1148013312 17:44503257-44503279 GCCGGAGATGAAGGAGGTTCTGG + Intronic
1148793587 17:50186894-50186916 CCAGGAGGTCCAGGAGGGCCGGG + Exonic
1151239006 17:72743377-72743399 GCCTGAGGTACAGGATGGGCCGG - Intronic
1151475938 17:74344395-74344417 GCCTGAGGGGCAGGAGGGGCGGG + Intronic
1151598655 17:75093351-75093373 GCAGGAAGGACAGGAGGGACAGG - Intronic
1151732101 17:75917695-75917717 GCAGGAGGGGCAGGAGGGCCAGG + Intronic
1152222203 17:79075034-79075056 GCAGGAGGAGCAGGAGGATCAGG + Exonic
1152381182 17:79943014-79943036 TCCGGAGGCACAGGAAGGACGGG + Intronic
1155370783 18:25098022-25098044 GCAGGAGGTCCAGGTGGGTAGGG + Intronic
1160152162 18:76403574-76403596 GTAGGAGGTACGTGAGGGTCAGG - Intronic
1160317998 18:77866042-77866064 GCCTGTGGTACAGGACGCTCTGG + Intergenic
1160688707 19:450162-450184 GCCGGCGCTACAGGAGGGGGGGG + Intronic
1161280184 19:3441683-3441705 GCCGGGGGCACAGGAAGGGCCGG + Intronic
1161309769 19:3587045-3587067 GCCTGGGGTGGAGGAGGGTCGGG + Intronic
1161398785 19:4058674-4058696 GGCTGGGGGACAGGAGGGTCTGG - Intronic
1161536891 19:4824982-4825004 GGAGGAGGGAGAGGAGGGTCGGG + Intronic
1162550292 19:11354930-11354952 GTCGGGGCTAGAGGAGGGTCTGG - Exonic
1162908004 19:13834750-13834772 GCCGGAATTACAGGTGGCTCAGG - Intergenic
1163855604 19:19699329-19699351 GCTGGAGGTACCGGAGCGCCAGG - Intergenic
1163871710 19:19827057-19827079 GCTGGAGGTACCGGAGCGCCAGG + Intergenic
1165951601 19:39476591-39476613 GGAGGAGGTACAGGAAGGTGGGG - Exonic
1166060233 19:40321305-40321327 GCCGGAGGTACAGGAGGGTCGGG + Exonic
1166867496 19:45848936-45848958 GCCTGAGGTCCAGGAGGGAAGGG + Intronic
1167643135 19:50692984-50693006 TACGGAGGTGCAGGAGGGTGTGG - Intronic
1167774313 19:51544839-51544861 GTAGGGGGTAGAGGAGGGTCAGG - Intergenic
1168096718 19:54120029-54120051 ACCGGAGCCACAGGAGGGACTGG + Intronic
925030499 2:647189-647211 GCAGGGGGTACAGGAGGGCAGGG - Intergenic
925673282 2:6334264-6334286 GCAGGAGGTGAAGGAGGGGCAGG + Intergenic
925725334 2:6865834-6865856 GCCGGAGGCCCAGGCGGGGCAGG + Intronic
927670236 2:25062841-25062863 GCCGGAGGCCTAGGAGAGTCAGG - Intronic
927695507 2:25236956-25236978 GCTGGAGCTGCAGGAGTGTCTGG - Exonic
928928455 2:36600602-36600624 GCAGGAGGGAAAGGAGGATCTGG - Intronic
929872966 2:45773842-45773864 GCCGTAGGTACAGGAGCCCCAGG - Intronic
932758325 2:74423799-74423821 GCTGGAGACCCAGGAGGGTCAGG + Intronic
938252587 2:129827422-129827444 GCGGGAGGTGCGGGAGGGGCAGG + Intergenic
938615016 2:132988657-132988679 GCCAGAGAAACAGGAGGGACTGG - Intronic
943525313 2:189008948-189008970 CCAGGAGGTCCAGGAGGGCCTGG - Exonic
944033573 2:195266292-195266314 ACCAGAGGTACAGGAGGAGCTGG - Intergenic
944534118 2:200693369-200693391 CCTGGAGTTACAGGAGGGTCAGG + Intergenic
947526147 2:230877917-230877939 GCCTGAGCCACAGGAGGGCCAGG - Intronic
948609610 2:239158567-239158589 GCAGCAGGTGCAGGAGGGGCTGG + Intronic
948628143 2:239283356-239283378 GCCTGAGGTACAGGAGCTGCGGG + Intronic
1169035650 20:2449586-2449608 GCCTGAGGTTAAGGAGGGTGTGG + Intergenic
1169382386 20:5119527-5119549 ACCGGAGGTGCAGGCGGGCCGGG + Intronic
1169671229 20:8105471-8105493 GTGGGAGGTACAGGAGGGAAAGG - Intergenic
1170207209 20:13811269-13811291 ACTGGAGGGACAGGAGGGTATGG + Intronic
1170838441 20:19904647-19904669 GCCGGAAGGGCAGGAGGGGCAGG + Intronic
1172484066 20:35287978-35288000 GGCAGAGGGACAGGGGGGTCAGG + Intronic
1172519838 20:35559433-35559455 GCGGGAGGCGCAGGAGGCTCAGG - Intergenic
1178845657 21:36172146-36172168 ACCAGAGATACAGCAGGGTCAGG + Intronic
1179130903 21:38636386-38636408 GCAGGAGGGCAAGGAGGGTCCGG + Intronic
1179999878 21:44990787-44990809 GCCCGAGCTGCAGGAGGGCCAGG - Intergenic
1180082550 21:45493470-45493492 GCAGGAGGTCCAGCAGAGTCAGG - Intronic
1181252832 22:21544872-21544894 GCCGCAGGTACAGTAGGATAAGG + Intergenic
1182294174 22:29303471-29303493 GCTGGAGGGACAGGAGGTTTGGG - Intergenic
1182832653 22:33316152-33316174 GCAGGAAGTACAGGTGGGTGCGG + Exonic
1183039819 22:35169217-35169239 ACCAGAGGTACAGGAGGAGCTGG + Intergenic
1184980990 22:48096136-48096158 TGGGGAGGTACAGGAGGGTTGGG + Intergenic
1185265467 22:49900311-49900333 GGAGGAGGTACAGGAGGGAGTGG + Exonic
1185377424 22:50488749-50488771 ACAGGAGGGACAGGAGGGACAGG - Intronic
1185377437 22:50488785-50488807 ACGGGAGGGACAGGAGGGACGGG - Intronic
951643986 3:24866975-24866997 GGTGGGGTTACAGGAGGGTCTGG + Intergenic
953312154 3:41890767-41890789 ACGGGAGGGACAGGAGGGACAGG + Intronic
953312158 3:41890776-41890798 ACAGGAGGGACAGGAGGGACGGG + Intronic
954446480 3:50549625-50549647 GCCGGAGGTTAGGGAGGGTGAGG - Intergenic
954707160 3:52487211-52487233 GCCGGAGGTCCAGGTGGTGCCGG + Exonic
954797572 3:53169277-53169299 GCCTGAAGTTCAGGAGGGTCTGG + Intronic
956209199 3:66786018-66786040 GCCAGAGGTCCAGGAGGTTATGG - Intergenic
960155220 3:114291817-114291839 GCAGGAGGCTCTGGAGGGTCTGG + Intronic
961592560 3:127991600-127991622 GCCAGAGGTACAGCAGGCTTCGG - Intergenic
963584038 3:147161743-147161765 CCCTGAGGTACAGGAGGTTAAGG - Intergenic
966809924 3:183834567-183834589 GCCAGGGGTAGAGGAGGGGCAGG + Intronic
967969496 3:194988519-194988541 GACACAGGTACAGGAGAGTCAGG - Intergenic
968092700 3:195908805-195908827 GCCCGGGGTGCAGGAGGGACAGG - Intronic
968495103 4:910942-910964 GCCTGAGGCTCAGCAGGGTCAGG + Intronic
968913525 4:3487296-3487318 GCTGGACTTACTGGAGGGTCTGG + Intronic
968949827 4:3684683-3684705 GCCGGACGACCTGGAGGGTCCGG - Intergenic
968969860 4:3788170-3788192 GCTGGAGGGGCAGGAGGGGCAGG - Intergenic
975373020 4:73610095-73610117 GCAGGAGCTACAGGAGGAGCAGG - Intronic
976246389 4:83010468-83010490 GCTGGAGGTAGAGGAGGATGGGG - Exonic
976927410 4:90516580-90516602 GCAGAAGGTAAAGCAGGGTCAGG - Intronic
978315450 4:107430789-107430811 GCTGGAGGTACAGGAGGGAAAGG - Intergenic
978329598 4:107598345-107598367 GGCCGAGGGTCAGGAGGGTCTGG - Intronic
979176409 4:117669228-117669250 ACCAGAGGTACAGGAGGAACTGG - Intergenic
981733244 4:147922014-147922036 GCAGGAGGTGCAGGAGGGGCAGG - Intronic
981733248 4:147922023-147922045 GTCGGAGGTGCAGGAGGTGCAGG - Intronic
981875648 4:149541198-149541220 GTCTGAGGAACAGGAGGCTCAGG + Intergenic
982169477 4:152646779-152646801 GCAGGAGCTACAGGAGCCTCTGG + Intronic
984681014 4:182608995-182609017 GCTGGAGGGACTGGAGGGTATGG + Intronic
984835404 4:184015258-184015280 GGTGGAGGAAGAGGAGGGTCAGG - Intronic
984878938 4:184393484-184393506 GTCGCAGGTGCAGGAGGGGCTGG + Intronic
985670119 5:1202624-1202646 GCGGAAGGTCCAGGAGGGCCGGG + Intronic
997129601 5:131263894-131263916 GCCGGAGGTACGGCGGGGGCGGG + Intronic
997326625 5:133026734-133026756 GCTGGAGGGGCTGGAGGGTCGGG + Intergenic
999700858 5:154226827-154226849 GCAGGAGGGACAGGAGGGAGAGG - Intronic
1001551091 5:172602851-172602873 GAGGGAAGTACAGGAGGGTGAGG - Intergenic
1007186354 6:39975581-39975603 GCCTTAGGTACAGATGGGTCTGG - Intergenic
1007394349 6:41569190-41569212 GCAGGAAGTACAGTAGGCTCTGG + Intronic
1007587788 6:43002491-43002513 GCCTGAGGCAGAGGAGTGTCTGG + Intronic
1008028242 6:46663294-46663316 GCCAGAGGCAAAGGAGGGTTTGG + Intronic
1012904504 6:105048595-105048617 ACCAGAGGTACAGGAGGAGCTGG - Intronic
1013868116 6:114723303-114723325 ACCAGAGGTACAGGAGGAGCTGG - Intergenic
1013874060 6:114802488-114802510 ACCAGAGGTACAGGAGGAGCTGG - Intergenic
1016996695 6:149966052-149966074 GTCGGAAGAACAGGCGGGTCTGG - Intronic
1019135439 6:169904867-169904889 GCTGGAGCTGCAGGAGGGGCAGG + Intergenic
1019289025 7:240956-240978 GGCTGAGGTAGAGGAGGGGCAGG + Intronic
1019300614 7:301703-301725 CCGGGAGGTACAGGAGCTTCGGG - Intergenic
1020103273 7:5407414-5407436 GCTGGAGGTGTAGGAGGGGCAGG - Intronic
1023031012 7:36090360-36090382 GCAGGAGGTAAAGGAGGAGCAGG - Intergenic
1024630519 7:51243325-51243347 ACCGGAGGTACAGAGGGGTGAGG - Intronic
1027173313 7:75888099-75888121 CCCGGGGGTGCAGGAGGGCCAGG - Exonic
1028755375 7:94427642-94427664 CCTGGAGGTCCAGGAGGGCCAGG - Exonic
1029425110 7:100489854-100489876 GCTGGAGGGGCAGGAAGGTCTGG + Intronic
1029561036 7:101303082-101303104 TCTGGAGGTCCACGAGGGTCAGG - Intergenic
1034285557 7:149881157-149881179 CCTGGAGGGACAGGAGGGTGGGG + Intergenic
1034407314 7:150913696-150913718 CCCTGAGCTTCAGGAGGGTCTGG + Intergenic
1034907750 7:154965549-154965571 GGAGGAGGGACAGGAGGGGCTGG - Intronic
1035167846 7:157002387-157002409 GCCGGAGCTCCAGGAGGGGCTGG + Intronic
1037787717 8:21912432-21912454 GCTGGAGCTGCAGGAGGGCCCGG - Exonic
1042022343 8:64380722-64380744 GCGGGAGGCACTGGAGGGCCAGG + Intergenic
1043982530 8:86658291-86658313 CCCGGAGGAACTGGAGAGTCGGG - Intronic
1048986893 8:139739529-139739551 GCTGGAGGGACAGGATGGCCAGG - Intronic
1049554232 8:143274241-143274263 CCCGGAGGGACAGAAAGGTCTGG + Intronic
1049674099 8:143882217-143882239 GCTGGAGGTACAGGTGGTCCTGG - Intergenic
1050073735 9:1842437-1842459 TCCTGAGGTACTGGAGGGTTAGG + Intergenic
1050783661 9:9371191-9371213 ACCAGAGGTACAGGAGGAGCTGG - Intronic
1051315098 9:15820749-15820771 ACCAGAGGTACAGGAGGAGCTGG + Intronic
1053073649 9:35115543-35115565 GGAGGAGGTACATGAGGGGCAGG - Intronic
1053509169 9:38672661-38672683 GCCGGAGGAGCAGCAGGGCCTGG - Intergenic
1058619131 9:106864268-106864290 GCTGGAGGTTCAGAAGCGTCTGG + Intronic
1061858844 9:133457525-133457547 GCAGGAGGTACAGGCAGGTGGGG + Intronic
1062340675 9:136092685-136092707 GCCGGAGGAGCAGCAGAGTCAGG + Intronic
1062669106 9:137695860-137695882 GCTGGAGGCACATGAGGGACTGG + Intronic
1203780008 EBV:96004-96026 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780012 EBV:96013-96035 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780032 EBV:96067-96089 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780062 EBV:96148-96170 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780092 EBV:96229-96251 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780107 EBV:96271-96293 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780111 EBV:96280-96302 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780130 EBV:96331-96353 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780154 EBV:96400-96422 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780163 EBV:96424-96446 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780172 EBV:96448-96470 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780201 EBV:96526-96548 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780210 EBV:96550-96572 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203780219 EBV:96574-96596 GCAGGAGGGGCAGGAGGGGCAGG + Intergenic
1203564378 Un_KI270744v1:79560-79582 AGCGCAGGTACAGAAGGGTCTGG - Intergenic
1185527178 X:789158-789180 GCAGGAGGGACTGGGGGGTCTGG - Intergenic
1193953111 X:87824821-87824843 ACCAGAGGTACAGGAGGAACTGG + Intergenic
1195174910 X:102305849-102305871 GCCGGGGGTGCGGGAGGGTGGGG + Intergenic
1195174923 X:102305875-102305897 GCGGGAGGTGCGGGAGGGTGGGG + Intergenic
1195183942 X:102381218-102381240 GCGGGAGGTGCGGGAGGGTGGGG - Intronic
1195183955 X:102381244-102381266 GCCGGGGGTGCGGGAGGGTGGGG - Intronic
1199468659 X:148169237-148169259 CCCAGAGGTACAGGAGGAGCTGG + Intergenic
1199741534 X:150740582-150740604 GCCTGAGTTACAGGAGCATCAGG - Intronic
1200120837 X:153789823-153789845 GCCTGAGGCACGGCAGGGTCAGG + Exonic