ID: 1166062670

View in Genome Browser
Species Human (GRCh38)
Location 19:40336371-40336393
Sequence ATCCAGTTCTTTAAGGAAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166062670_1166062673 -9 Left 1166062670 19:40336371-40336393 CCGGCTTCCTTAAAGAACTGGAT 0: 1
1: 0
2: 0
3: 27
4: 168
Right 1166062673 19:40336385-40336407 GAACTGGATCCACTCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 69
1166062670_1166062676 -1 Left 1166062670 19:40336371-40336393 CCGGCTTCCTTAAAGAACTGGAT 0: 1
1: 0
2: 0
3: 27
4: 168
Right 1166062676 19:40336393-40336415 TCCACTCGGAAGTGGCTGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 133
1166062670_1166062678 3 Left 1166062670 19:40336371-40336393 CCGGCTTCCTTAAAGAACTGGAT 0: 1
1: 0
2: 0
3: 27
4: 168
Right 1166062678 19:40336397-40336419 CTCGGAAGTGGCTGTGGGGTTGG 0: 1
1: 0
2: 3
3: 29
4: 256
1166062670_1166062680 9 Left 1166062670 19:40336371-40336393 CCGGCTTCCTTAAAGAACTGGAT 0: 1
1: 0
2: 0
3: 27
4: 168
Right 1166062680 19:40336403-40336425 AGTGGCTGTGGGGTTGGACAGGG 0: 1
1: 0
2: 5
3: 42
4: 375
1166062670_1166062675 -2 Left 1166062670 19:40336371-40336393 CCGGCTTCCTTAAAGAACTGGAT 0: 1
1: 0
2: 0
3: 27
4: 168
Right 1166062675 19:40336392-40336414 ATCCACTCGGAAGTGGCTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 86
1166062670_1166062679 8 Left 1166062670 19:40336371-40336393 CCGGCTTCCTTAAAGAACTGGAT 0: 1
1: 0
2: 0
3: 27
4: 168
Right 1166062679 19:40336402-40336424 AAGTGGCTGTGGGGTTGGACAGG 0: 1
1: 0
2: 3
3: 34
4: 296
1166062670_1166062674 -3 Left 1166062670 19:40336371-40336393 CCGGCTTCCTTAAAGAACTGGAT 0: 1
1: 0
2: 0
3: 27
4: 168
Right 1166062674 19:40336391-40336413 GATCCACTCGGAAGTGGCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166062670 Original CRISPR ATCCAGTTCTTTAAGGAAGC CGG (reversed) Exonic
900552053 1:3261738-3261760 CGCCAGTTCTTTCAGGAGGCAGG - Intronic
902098297 1:13964733-13964755 AGCCAGCTCTTGAAGGAAGGAGG + Intergenic
902782348 1:18712688-18712710 ACCCAGTTCTCTAAGAAAGGAGG - Intronic
903005746 1:20297460-20297482 ATCTAGGCCTTCAAGGAAGCTGG + Intronic
903061079 1:20669208-20669230 TTCCAGTTTTTTAAGTTAGCTGG - Intronic
906417144 1:45629249-45629271 CTCTTGGTCTTTAAGGAAGCAGG - Intronic
907079287 1:51606591-51606613 TTTCAGCTCTTTAAGGAGGCAGG + Intronic
911044060 1:93614387-93614409 ACCCAGAGGTTTAAGGAAGCAGG + Intronic
914462131 1:147894841-147894863 ATCCAGTTTTTTAAGCATCCAGG + Intergenic
917796444 1:178536437-178536459 ATCCAATTCTGTGAGGAAGGAGG - Intronic
920950371 1:210566802-210566824 ACCCAGTTCTTCAGGGATGCTGG + Intronic
922547510 1:226469356-226469378 ATCCAGTTGTTTAAAGAGGCTGG + Intergenic
1063599371 10:7466080-7466102 ATAATGTTCTTTGAGGAAGCAGG - Intergenic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1065927706 10:30450360-30450382 GTCCATCTCTTTATGGAAGCAGG + Exonic
1068859959 10:61838029-61838051 AGCTAGTTCTTTAAGTAAGGGGG + Intergenic
1069288606 10:66748014-66748036 GTCCATTTCTTAAAGAAAGCTGG + Intronic
1071411352 10:85399983-85400005 ATCCAGTTCTTTACTGTGGCAGG - Intergenic
1073304607 10:102493071-102493093 AGCCAGTTCTCTAAGGGAGCAGG + Intronic
1076666508 10:132096001-132096023 ATCCAGCTCTCTTGGGAAGCAGG + Intergenic
1077087287 11:760168-760190 ATCGAGCTCTACAAGGAAGCTGG + Exonic
1077553747 11:3215981-3216003 TTCCAGGTCTTTCAGGAAGGAGG + Intergenic
1077630184 11:3806358-3806380 ATCCTGTTCTTTAAGGTCCCAGG - Intronic
1079478794 11:20859193-20859215 GTCCAGTTCTTCACGGAAGCTGG - Intronic
1080401479 11:31940414-31940436 ATCCAGTTCTAGAAGGAATAAGG + Intronic
1080721812 11:34856535-34856557 CTCCAGGCCTTTAAAGAAGCAGG + Intronic
1081332501 11:41821717-41821739 TTCTAGTTCCCTAAGGAAGCAGG + Intergenic
1081796916 11:45826841-45826863 ATCCAGTGCCTCCAGGAAGCTGG + Intergenic
1083981716 11:66176743-66176765 AACTGGTTCTTTAAGAAAGCAGG - Intronic
1086141453 11:83504919-83504941 ATCCAGTTGTTTCAGGATGATGG + Intronic
1086324497 11:85684448-85684470 ATCAAGTTCTTTAACAAAGAAGG - Intergenic
1089937047 11:122375379-122375401 ATCCTTTTCTTCAAGGCAGCAGG - Intergenic
1091354534 11:134925842-134925864 ATCCATTTCTATAAGGAGCCTGG + Intergenic
1094288223 12:28817661-28817683 GTCCAGTTATTTATAGAAGCTGG - Intergenic
1094525738 12:31229500-31229522 TTCTAGTTCTTTAAGGGAACTGG + Intergenic
1095587576 12:43865103-43865125 TTACAGTTCTTAAAGGCAGCGGG - Intronic
1098155934 12:67598387-67598409 AGCCATGTCTTTCAGGAAGCTGG - Intergenic
1098205778 12:68108374-68108396 TTCCAGCTCTTTGAGGAAGGAGG + Intergenic
1098962928 12:76757779-76757801 ATCCAGTTCTTGGAGCATGCTGG + Intergenic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1101739720 12:107491531-107491553 ATCCAGTTCTTGAATGAAAATGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1106072529 13:26426221-26426243 AACCAGTTCTTTATGGATCCAGG - Intergenic
1106835601 13:33631311-33631333 ATCCAGTTCTCAAAATAAGCAGG + Intergenic
1107023386 13:35774874-35774896 ATCCAGGTCTTTAAGGGACCTGG + Intronic
1109171361 13:59101189-59101211 ATCCAGTTATTAAATGAAGATGG + Intergenic
1109200412 13:59424506-59424528 TTCCAGTTGTTTAAGGAAGGAGG + Intergenic
1109226161 13:59698680-59698702 TTCCTATTTTTTAAGGAAGCAGG - Intronic
1109919749 13:69040705-69040727 ATACATTTCTTGAAGGAAACAGG + Intergenic
1110121491 13:71887233-71887255 AGCCATTTCTCTAAGGAATCTGG + Intergenic
1110380845 13:74848742-74848764 ATTCAGTTCTTTGAAGCAGCTGG + Intergenic
1110833285 13:80056025-80056047 TTGCAGAGCTTTAAGGAAGCAGG + Intergenic
1111451403 13:88422984-88423006 ATCAACTTCTTTAAGAAAGGAGG - Intergenic
1114209944 14:20605968-20605990 GTCCAGTTCTTAACAGAAGCAGG - Intronic
1117295780 14:54377901-54377923 ACCCAGTTCTTCCAGGATGCTGG - Intergenic
1117350650 14:54878242-54878264 CTCCAGCTCTCTGAGGAAGCCGG + Intronic
1118094427 14:62520871-62520893 TTTCAGTTCTTTATAGAAGCTGG - Intergenic
1122031186 14:98913881-98913903 AGCCAGTTCTTTGGGGAAGCAGG + Intergenic
1122258642 14:100499484-100499506 TTCCACTTCTGGAAGGAAGCAGG - Intronic
1125533653 15:40429923-40429945 ATCCAGTTGTTGAATGAATCAGG + Intronic
1125770872 15:42164972-42164994 TACCAGTTCTTTTAGGAAGCCGG - Intronic
1125772482 15:42179118-42179140 ATCCAGTTCTTTGGGGAATAAGG - Intronic
1126765722 15:52009095-52009117 ATCCTGTCCTTTGAGGAAGAAGG - Intronic
1127079137 15:55358502-55358524 ATACACTGCTTTAAGGAAGCAGG - Intronic
1127687957 15:61366903-61366925 ACAAATTTCTTTAAGGAAGCTGG - Intergenic
1129493269 15:75950579-75950601 ATCCAGTTCTTGGAGGATGCTGG - Intronic
1129796693 15:78383062-78383084 ATCCAGTTCTTGGAGGATGCTGG + Intergenic
1130238411 15:82161858-82161880 AGCCAGTCCTTCAAAGAAGCTGG + Intronic
1136123901 16:28162415-28162437 ATCAAGTTCTCTATGGAAGAGGG + Intronic
1138531602 16:57637497-57637519 ATCCTGTGCTTAAAGGGAGCTGG - Intronic
1138778947 16:59759047-59759069 ATGCAATTCTTTTAGCAAGCTGG + Intergenic
1139236319 16:65343351-65343373 ATTCAGTTCTTGCAGGTAGCAGG + Intergenic
1139312421 16:66038952-66038974 ATGCAGTTCTGTAAGGAAAACGG - Intergenic
1140628276 16:76821125-76821147 ATCCAGTTATTTAAGGATATGGG + Intergenic
1146756620 17:35437879-35437901 TTTCAGATCTTTAATGAAGCAGG + Exonic
1146760159 17:35469960-35469982 ATCCAGTTGGTTAAGGAAAGAGG - Intronic
1148323363 17:46770467-46770489 ATCCAGGTCTGTAAGGAGGGAGG + Intronic
1153906508 18:9666348-9666370 ATACAGTTCATTAGGGAGGCAGG - Intergenic
1156424125 18:36990167-36990189 GTCCAGTTCTTTAAGAAAAATGG + Intronic
1158398524 18:57098759-57098781 AAGCAGTTCTTTAGAGAAGCTGG - Intergenic
1158687760 18:59630063-59630085 ATCCAGCTGTATAAGGAAACAGG + Intronic
1159934695 18:74354247-74354269 ATCCAGTTCTTCTAAGAAGCAGG + Exonic
1160667332 19:337568-337590 ATCAAGATCGGTAAGGAAGCCGG + Intronic
1162142105 19:8591306-8591328 AGCCAGGTCTTTAAGGAGGAGGG + Intronic
1164995391 19:32717508-32717530 ATGCAGTTCTATAAGAAAACTGG - Intergenic
1166062670 19:40336371-40336393 ATCCAGTTCTTTAAGGAAGCCGG - Exonic
925590404 2:5503482-5503504 ATGAAGTTCTTCAAGGAAGAAGG - Intergenic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
927445546 2:23157867-23157889 ATCCAGCCCTTTGAGGAATCTGG - Intergenic
929807724 2:45161970-45161992 ATTCAGTTCTTTATAGAACCTGG - Intergenic
930402273 2:50905335-50905357 ATGCAGCTATTTAAGGAACCTGG + Intronic
932681902 2:73833326-73833348 CTACAGATCTTTAAGGAAACAGG - Intronic
932872247 2:75413588-75413610 ATGCAGTTCTTTAAAGCAGTGGG - Intergenic
934166191 2:89296415-89296437 ATCCAGTTCTTCACAGAAGCTGG - Intergenic
934201084 2:89886041-89886063 ATCCAATTCTTCACAGAAGCTGG + Intergenic
934931352 2:98427661-98427683 AACCAGTTCAGTAAGGATGCAGG - Intergenic
935607370 2:104984514-104984536 AGCCAGTACTTTAAGGATGTTGG - Intergenic
935954949 2:108366564-108366586 ATCCCCTTCTCTAAGGAAGCTGG + Intergenic
936799310 2:116247844-116247866 ATTTATTTCTTTAATGAAGCTGG - Intergenic
937006726 2:118523328-118523350 ACAGAGTTCTTTAAAGAAGCTGG - Intergenic
937478513 2:122236408-122236430 TTCCAGGTCATTCAGGAAGCAGG + Intergenic
937826476 2:126372922-126372944 ATCCAGTTCTGCACTGAAGCTGG + Intergenic
939768966 2:146290519-146290541 GTCCAGTTCTTTCAAGAAGCAGG + Intergenic
941457132 2:165722238-165722260 ATCCAGTTTAATAAGGAAGAGGG - Intergenic
943361633 2:186925720-186925742 AGCCAGTTATATTAGGAAGCTGG + Intergenic
945377577 2:209097098-209097120 ATCCAGTTCTTCCAGGAGGCTGG + Intergenic
946894559 2:224310096-224310118 ATCCATTTCTTGAAGGAAGATGG - Intergenic
947477783 2:230466676-230466698 AAGCAGTTCTTCAGGGAAGCAGG + Intronic
948447257 2:238042630-238042652 ATCCAGAGGTCTAAGGAAGCTGG - Exonic
1172083324 20:32358948-32358970 GTCCCGTTCTTAAAGGAAGATGG - Intronic
1179005806 21:37513046-37513068 ATGCAGTACTGTAAGGAAGAGGG + Intronic
1180225497 21:46389562-46389584 AACCAGATCTTTGAGGAAGTGGG + Intronic
1180253848 21:46608589-46608611 ATCCATATCGTTAGGGAAGCAGG - Intergenic
1182856486 22:33522003-33522025 AGCTAGTTGTTTAAAGAAGCTGG - Intronic
1183477296 22:38042629-38042651 AGACAGTTCTTTGGGGAAGCTGG + Intergenic
949143223 3:661854-661876 ATCCATTACTTTAATGAGGCTGG - Intergenic
952710271 3:36424603-36424625 ATCTATTTCTTCAAGGAAGCTGG - Intronic
954433766 3:50485098-50485120 AGCCACTTCTTCCAGGAAGCAGG + Intronic
954997793 3:54897417-54897439 ATTCAGTTCTTTTTGGAGGCAGG - Intronic
960218549 3:115074395-115074417 AGCCAGTTTAGTAAGGAAGCAGG + Intronic
968700103 4:2051662-2051684 ATCCAGATCTTTAAGTATCCAGG - Intergenic
970530601 4:16978492-16978514 TTCCAGATCTTTTAGGAAGCAGG + Intergenic
971294897 4:25379324-25379346 ATCCAGATCTTTAAGGAATGAGG + Intronic
972406529 4:38751683-38751705 ACCCAGTTCTTCCAGGATGCTGG + Intergenic
973078244 4:45957981-45958003 GCCCAGTTCTTTAAAGATGCAGG + Intergenic
980402684 4:132313293-132313315 ATCCAGTGCTGTAGAGAAGCTGG - Intergenic
980913672 4:139015617-139015639 ATCCTGTTTTAAAAGGAAGCGGG - Intergenic
981691746 4:147516335-147516357 ATCGAGTTGTTTGAGGAAGTGGG - Intronic
982867379 4:160532111-160532133 ATCAAACTCTTTAAGGAAGTTGG + Intergenic
985242380 4:187944221-187944243 ATCCAGTTCTTGAAGGATTAAGG - Intergenic
985488874 5:167479-167501 ATCGAGTTATTTAAGGAGGTTGG + Intronic
986457063 5:7930279-7930301 ATCCACTTCTTAGAGGAAACTGG - Intergenic
986594553 5:9407782-9407804 ATCCAGAGCTTAAAGGAATCTGG - Intronic
987995417 5:25270851-25270873 ATCCAGTTGTTAAAAGAATCAGG + Intergenic
988022315 5:25636887-25636909 AACCAGTTCTTCAAGGATGAAGG + Intergenic
989427785 5:41316269-41316291 ATCCTTTTCTTCAAGGCAGCAGG - Intronic
992669398 5:79043735-79043757 TTCAAGTTCTTTAAGGGAGATGG - Intronic
993940882 5:94057684-94057706 TTCCAGTTGTTTAAGGAAAGTGG - Intronic
994750348 5:103729752-103729774 ATGTAGTTCTTCAAGGAAGCAGG - Intergenic
996463989 5:123778921-123778943 ATCCAGTTCTTTCAGGATACTGG - Intergenic
996648547 5:125845626-125845648 ACCCAATTCTTTCAGGATGCCGG + Intergenic
997099407 5:130952539-130952561 AGCAAGTTTATTAAGGAAGCAGG + Intergenic
999096039 5:148979027-148979049 AACCACTTCTTTCAGGGAGCTGG - Intronic
999283652 5:150381170-150381192 TTCCATTTCTTAAGGGAAGCTGG + Intronic
1001391437 5:171382711-171382733 AGCCATTTCTTTAAGGACTCTGG - Intergenic
1001902511 5:175443901-175443923 CTCCAGCTCTTCAAGGAAGTGGG - Exonic
1003203830 6:3989388-3989410 ACCTAGTTCTTAAAGGAAGAAGG - Intergenic
1004914986 6:20323136-20323158 ATCCATTTCTTTAAGCCATCCGG + Intergenic
1005712592 6:28516106-28516128 ATGCAGCTCCTTAAGGCAGCAGG + Intronic
1009835548 6:68996587-68996609 ATACAGTGCTTTCAGGAATCAGG - Intronic
1012042999 6:94234139-94234161 ACCCAGTTCTTTCTGGACGCTGG + Intergenic
1024492086 7:49997037-49997059 ATTGAGTTCTTCAAGGATGCTGG + Intronic
1027603275 7:80266787-80266809 ATACACATCTTGAAGGAAGCTGG - Intergenic
1028141616 7:87281007-87281029 ATCAAGTACTTGAAAGAAGCAGG + Intergenic
1030999181 7:116395204-116395226 ATCCAGTTCTTCTAGCAATCTGG - Intronic
1031029008 7:116714411-116714433 AGCCAGTTCTTAATGGAAGCTGG - Intronic
1031691533 7:124794065-124794087 ATCCAGTGCTTTGAGGAGGATGG - Intergenic
1034107348 7:148501756-148501778 AACCAGTTCTGTGAGGAGGCTGG + Intergenic
1034373267 7:150620067-150620089 ATCTAATTTTTTAAGGAAGTTGG + Intergenic
1036592191 8:10179239-10179261 ACCCAGTTTTTTGAAGAAGCTGG + Intronic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1038103625 8:24408700-24408722 ATCCACTTTTTTAAGAAAACTGG + Intergenic
1038764273 8:30413033-30413055 TTCCAGTTTTTTAAGCAGGCTGG + Intronic
1039719946 8:40152506-40152528 TTCTAGTCCTTTAAGAAAGCAGG - Intergenic
1040708856 8:50163059-50163081 AGCCAGTTGCTTATGGAAGCAGG - Intronic
1040732095 8:50460355-50460377 TTCCAGTTCTTTAAGGACTCTGG + Intronic
1041117362 8:54553209-54553231 ATTCAGTTTTTAAAGAAAGCTGG + Intergenic
1042808568 8:72798805-72798827 CACCAGTTCTTAAAGGAATCGGG - Intronic
1043940138 8:86187901-86187923 TTCCAGTTCTAAAAGGAAGTTGG - Intergenic
1044180434 8:89186801-89186823 AACCATTTCTTTGAGGGAGCGGG + Intergenic
1045015991 8:98002394-98002416 ATCCAGCTATTTAGGGACGCAGG - Intronic
1045938109 8:107706410-107706432 ATCCAATTCTTTCAGGACACTGG - Intergenic
1046198196 8:110890369-110890391 GTCCAGTTCTGCATGGAAGCTGG + Intergenic
1048757759 8:137756835-137756857 ATCCTTTCCTTTAAGGCAGCAGG - Intergenic
1048943489 8:139423463-139423485 ACCCAGTTGTTGAAGGAGGCAGG - Intergenic
1050173596 9:2847485-2847507 ACCCAGTTATTTAAGGAATGGGG + Intergenic
1055008599 9:71537631-71537653 ATCCACTTATTTAAGGCAGGAGG - Intergenic
1055485163 9:76749377-76749399 TTGCAGTTGGTTAAGGAAGCAGG - Intronic
1055747857 9:79470550-79470572 ATCCATCTCTCTAAGGAAGAGGG + Intergenic
1058932872 9:109739292-109739314 AACCAGTACTCTAAGGAAGATGG + Intronic
1059298124 9:113290645-113290667 ATCCAGTTCTCTGTGGAAGCAGG - Intronic
1059340951 9:113597268-113597290 AGCCAGTTCTTTAAGGAACTTGG - Exonic
1059800353 9:117744155-117744177 ATCCAGTGCTTTAAAGAAATTGG - Intergenic
1059870217 9:118564595-118564617 ATATAGTTCTTTCAGGAAGTGGG - Intergenic
1186055145 X:5642227-5642249 AGCCAGTTTTATAAGGAGGCTGG - Intergenic
1188805678 X:34585957-34585979 ACCCAATTATTTAAGGAACCAGG - Intergenic
1188985269 X:36763339-36763361 ATCCAGTTCTAAGAGGATGCAGG - Intergenic
1192286420 X:69742896-69742918 TTCCAGTTGTTTAAGGAAGAAGG + Intronic
1193875834 X:86861763-86861785 ATGCAGCTCTTTAAGGATGCTGG - Intergenic
1194099379 X:89684029-89684051 ATCAAGTTCTTTCAGCAAGATGG + Intergenic
1194187871 X:90795460-90795482 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1194656015 X:96574521-96574543 ATCCAGCTCTTTAATGAAAATGG + Intergenic
1194866226 X:99071377-99071399 ATCCAGTGCTTGAAATAAGCAGG - Intergenic
1196122669 X:112067331-112067353 ATCCAGTAGTGTCAGGAAGCAGG + Intronic
1200452386 Y:3345408-3345430 ATCAAGTTCTTTCAGCAAGATGG + Intergenic
1200534459 Y:4377409-4377431 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic