ID: 1166069703

View in Genome Browser
Species Human (GRCh38)
Location 19:40379845-40379867
Sequence AGCACATGCTCACCCTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166069703_1166069707 -3 Left 1166069703 19:40379845-40379867 CCTGATGAGGGTGAGCATGTGCT 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1166069707 19:40379865-40379887 GCTAGGGTCTTACCAGTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 70
1166069703_1166069706 -4 Left 1166069703 19:40379845-40379867 CCTGATGAGGGTGAGCATGTGCT 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1166069706 19:40379864-40379886 TGCTAGGGTCTTACCAGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166069703 Original CRISPR AGCACATGCTCACCCTCATC AGG (reversed) Intronic
900315742 1:2055527-2055549 AGCACCCGCTCACCCTCAAGTGG + Exonic
900351820 1:2238582-2238604 ACCCCACGCTCACCCTCACCAGG - Intronic
900996119 1:6124541-6124563 AGCACGTGCTGACCCGCATCGGG - Exonic
902082287 1:13829276-13829298 AGCAGACTCTCACCCTCAGCTGG - Intergenic
902522552 1:17028756-17028778 AACACATCCTCACCCATATCCGG + Intronic
902743701 1:18458675-18458697 AACACCTGCTCAGCCTCATGGGG - Intergenic
905311854 1:37054610-37054632 AGCTCATGATTACCCTGATCGGG + Intergenic
905715475 1:40145700-40145722 AGCACATCCTCTCCCTCACCTGG + Intergenic
907307790 1:53523184-53523206 AGCACATCCCCTCCCTCCTCAGG + Intronic
909060286 1:70871306-70871328 AGAACTTGCTCACCATCATGAGG + Intronic
909633101 1:77787302-77787324 AGAAGATGCTCAACATCATCAGG - Intronic
914858708 1:151369933-151369955 AGCACAACCTCACCCTCCTCAGG - Exonic
920052584 1:203172700-203172722 ATGACATTCTGACCCTCATCTGG + Intronic
920385603 1:205568798-205568820 CGCACATGCTCGCCCTCCCCCGG - Intergenic
921954086 1:220963887-220963909 AGCACATGCTGACCCTACTCAGG - Intergenic
922860389 1:228811256-228811278 CTCACATGCTCAGCCTCAGCAGG - Intergenic
923266921 1:232323553-232323575 GTCACACGCTCACCATCATCAGG - Intergenic
924536291 1:244938544-244938566 AAAAAATGCTCACCATCATCAGG - Intergenic
1063296409 10:4811165-4811187 AGGACAGGCTTACGCTCATCAGG + Intronic
1063563795 10:7153617-7153639 AGCTCAGTCTCACCCTCAACTGG - Intergenic
1066298357 10:34075683-34075705 CCCACATGCTGACCCTCACCTGG - Intergenic
1070152506 10:73813524-73813546 TCCCCATGCTGACCCTCATCTGG - Exonic
1073165237 10:101442161-101442183 AGCAGATGTTCACCATCTTCAGG - Intronic
1077141086 11:1025200-1025222 GGCACATGACCATCCTCATCAGG - Exonic
1079238025 11:18703292-18703314 ACCACATCCTCACCCACACCAGG - Exonic
1079332909 11:19548380-19548402 AGCACAGGCTCGCCCTCCTAGGG - Intronic
1079831477 11:25274864-25274886 ACCACATGCTCTCACTCATGTGG - Intergenic
1081065820 11:38537649-38537671 AGCACATGCACAGACTCACCAGG - Intergenic
1081109820 11:39121124-39121146 AGCACTCGTTCACCCACATCTGG - Intergenic
1082831549 11:57622273-57622295 AGCACATGCACACCATCCTCTGG + Intergenic
1083932700 11:65854679-65854701 AGCCCCTGCACACCCTTATCTGG - Exonic
1085197504 11:74681477-74681499 ACCATATGCCCACCCCCATCTGG + Intergenic
1087955511 11:104282010-104282032 AAAAGATGCTCACCATCATCTGG - Intergenic
1089335725 11:117722277-117722299 ACCACATGCTCTCACTCATATGG + Intronic
1090600991 11:128371168-128371190 AGCACATGCTAACGCCCAGCTGG + Intergenic
1091693817 12:2614681-2614703 AGCAAATGCTGATGCTCATCTGG - Intronic
1099959001 12:89379012-89379034 AGCATATGCTCATTCTCCTCAGG - Intergenic
1102581249 12:113889486-113889508 GACACATGGTCTCCCTCATCTGG + Intronic
1103234261 12:119359193-119359215 AAAACATGCTCAACCTCATTAGG - Intronic
1103821458 12:123702206-123702228 AGCAGATGCGCACACTCATTGGG - Intronic
1104494287 12:129222181-129222203 ACCACATGCCCAGCCTCATGTGG - Intronic
1104908424 12:132227967-132227989 AGCCCCTGCTCAACCTCAGCAGG - Intronic
1105278080 13:18947821-18947843 AGCACAAGCTCACTCCCTTCTGG + Intergenic
1105469175 13:20676387-20676409 TGCACATGCTTGCCCTTATCAGG - Intronic
1105530218 13:21212350-21212372 AGCACAGCCTCACCCTCTTTAGG + Intergenic
1107670005 13:42735448-42735470 AGCAAATGGTCAGCCTCATGTGG + Intergenic
1112573283 13:100613305-100613327 ATCACATGCTCTCACTCATGGGG - Intronic
1113308144 13:109100718-109100740 AGCACATGATCACATTCAACAGG - Intronic
1113984539 13:114303327-114303349 AGCAAATGCTCCCCCACCTCAGG - Intronic
1114064963 14:19053086-19053108 AGCCCCTGCACACCCTGATCTGG - Intergenic
1114097298 14:19346916-19346938 AGCCCCTGCACACCCTGATCTGG + Intergenic
1118146749 14:63145439-63145461 AGCACATGTTCTCACTCATGTGG - Intergenic
1122374512 14:101249056-101249078 AGCACATCCTCTGCCTCTTCTGG + Intergenic
1122419639 14:101567257-101567279 TGCACCTGCCCACCCCCATCGGG - Intergenic
1123917868 15:25050521-25050543 AGCACATGCTCTTCCTCATGGGG - Intergenic
1123918751 15:25056008-25056030 AGCACATGCTCCTCCTCATGGGG - Intergenic
1124515948 15:30367585-30367607 AGGACAGGCACACCCTGATCAGG + Intronic
1124726972 15:32163146-32163168 AGGACAGGCACACCCTGATCAGG - Intronic
1128898493 15:71397615-71397637 AGCAAATGCTCACCCTCTCAAGG - Intronic
1129780215 15:78264878-78264900 CGCACCTTCTCGCCCTCATCCGG - Exonic
1131209575 15:90482252-90482274 AGCTCATCCTCACCAGCATCAGG - Exonic
1134218619 16:12335870-12335892 ACCACATGCTCAAGCTCATGTGG + Intronic
1138973096 16:62170428-62170450 AGCACAGGCTCACTTTCAACGGG + Intergenic
1147246836 17:39127261-39127283 GGCAGTTGCTCACCCTCCTCAGG - Intronic
1148653525 17:49266658-49266680 AGCAAATGTTCAGACTCATCAGG - Intergenic
1151335897 17:73439574-73439596 AGGACATGCTCTCCCTCTCCAGG + Intronic
1151900055 17:77006331-77006353 AGAACAACCTCACCTTCATCAGG - Intergenic
1155605555 18:27601726-27601748 AGCAGATGCTCTCCCTAATGTGG + Intergenic
1157612686 18:48968306-48968328 AGCTCATGGTCACCCTCCTTTGG + Intergenic
1157926900 18:51776711-51776733 AGCACATGCTCAGCCTCCGAAGG + Intergenic
1160459143 18:79024570-79024592 AGCAAATACTCACCTTCATTAGG - Intergenic
1160473953 18:79166289-79166311 AGCACATGCTCACAGTCTCCTGG - Intronic
1164190030 19:22905881-22905903 AGCACATGTTCACTATCACCTGG + Intergenic
1164524032 19:29000496-29000518 ATCACATCCTCGCCCTCTTCAGG + Intergenic
1166069703 19:40379845-40379867 AGCACATGCTCACCCTCATCAGG - Intronic
1167508290 19:49882565-49882587 AGCACCTGCTCACCCTTATTGGG + Intronic
1168168867 19:54573519-54573541 AGCCTCTGCTCACCCTCATCTGG + Intronic
925265245 2:2562381-2562403 ATCACATACTCTCCCTCATGTGG - Intergenic
931674073 2:64676151-64676173 AGCACAGGCTCTCCCTCAGGTGG - Intronic
932138386 2:69252196-69252218 AGCAAATGCTCACTCTCAACAGG + Intergenic
937857307 2:126681996-126682018 TGCACACCCTCACCCTCCTCAGG + Intronic
938210651 2:129463638-129463660 AGCACCTGGTCACCCCCACCAGG - Intergenic
938482224 2:131672089-131672111 AGCGCCTGCACACCCTGATCTGG - Intergenic
939592513 2:144082917-144082939 GGCACATGATCACACTCCTCAGG + Intronic
944452036 2:199852912-199852934 AATACATGCTTACCCTCCTCAGG - Intergenic
947352125 2:229257193-229257215 ATCACATGCTCACCCTGCTCAGG - Intronic
1172035394 20:32007164-32007186 TGCACATGCTGACCATGATCTGG - Intergenic
1173150072 20:40559694-40559716 TCCACATGCTCACCAGCATCTGG + Intergenic
1174902183 20:54511840-54511862 AGTACATTCTCTCCCTCATTGGG - Intronic
1175487578 20:59356462-59356484 GGCACATGCCCGCCCACATCTGG - Intergenic
1175723250 20:61300307-61300329 AGAACATGCTGCCCCTCATGTGG - Intronic
1177945257 21:27460593-27460615 AGCACTTGCTCATACTAATCAGG + Intergenic
1178919608 21:36729846-36729868 ACCACATCATCACCCGCATCAGG - Intronic
1180483452 22:15775706-15775728 AGCCCCTGCACACCCTGATCTGG - Intergenic
1180669392 22:17541674-17541696 CACACGTGCTCACCCGCATCAGG - Intronic
1181897003 22:26118942-26118964 AAAAGATGCTCAACCTCATCAGG + Intergenic
1183464552 22:37973166-37973188 AGGGCCTGCTCACCCTCCTCGGG - Exonic
1184565179 22:45287499-45287521 TGCCCCTGCTCTCCCTCATCAGG - Intronic
1184646882 22:45900693-45900715 CCCACATGCTCACCAGCATCTGG - Intergenic
1185056162 22:48579368-48579390 AGGACACGCTGACCCTCCTCTGG + Intronic
1185122681 22:48981927-48981949 TGCACCTGCTCACTCTCAGCGGG + Intergenic
953457789 3:43056349-43056371 AGCACAACCTCACACTCTTCAGG + Exonic
953582146 3:44166970-44166992 GGCCCATCCTCATCCTCATCGGG - Intergenic
953711114 3:45272038-45272060 AGCAAATGTTCAGCCTCTTCTGG - Intergenic
953892518 3:46763603-46763625 ATCACATTCTCACCTTCCTCAGG - Intronic
958029140 3:88086356-88086378 TGTACATGCTCACATTCATCTGG - Exonic
958415491 3:93868499-93868521 ACCACATCCTCAACCTCACCTGG + Intergenic
958931936 3:100216554-100216576 AGCCCAGGGTCACCCTCATTAGG + Intergenic
959378401 3:105612887-105612909 AGAACATGCTCAGCCTCCACAGG + Intergenic
960726785 3:120678241-120678263 ACCCCATGCTCACCATCAACGGG + Intronic
965875156 3:173308297-173308319 ATCTCATGCTCACATTCATCAGG - Intergenic
966981618 3:185141254-185141276 ACCACATGCTCACCAGCATTTGG - Intronic
967854119 3:194103757-194103779 GGCACGTGCTCACCCGCTTCTGG - Intergenic
968658754 4:1790023-1790045 TGCACATGCGGACCCTCAACAGG + Intergenic
973071913 4:45871125-45871147 ATCACTTTCTCAGCCTCATCTGG - Intergenic
973091890 4:46147448-46147470 ACCACATCCTGACCCTCATTGGG - Intergenic
977876980 4:102161887-102161909 AGCTCTTGCTGTCCCTCATCAGG - Intergenic
979354676 4:119689204-119689226 ATCACATGCTCAACCACACCTGG - Intergenic
981676118 4:147344999-147345021 AGCACATGCTAGCCCTCTTGAGG + Intergenic
982368505 4:154607005-154607027 ATCACATGCTGACCCTCCTCAGG + Intronic
983734051 4:171035339-171035361 TGCACATGCTCATCCCCATCTGG - Intergenic
987404683 5:17512633-17512655 AGCAGATGCTTAACCTAATCAGG + Intergenic
987412292 5:17626356-17626378 AGCAGATGCTTAACCTAATCAGG + Intergenic
992131209 5:73694670-73694692 AAAACATGCACACCCTCCTCAGG - Intronic
992421258 5:76607667-76607689 AGCAGATGTTCAACATCATCAGG + Intronic
995447612 5:112263176-112263198 GGCTGATGCTCACCCTCATCAGG - Intronic
998176624 5:139905311-139905333 AGCAAAGGCTCTCCCTCTTCTGG + Intronic
998207176 5:140166179-140166201 AGGACAAGCACACTCTCATCTGG + Intergenic
1003401284 6:5793217-5793239 AGCACAGCCTCACCCTCTTTAGG - Intergenic
1005447965 6:25944919-25944941 AGCAGATTTTCAGCCTCATCTGG + Intergenic
1005890956 6:30137258-30137280 AGAACCTGCACACCCTCTTCTGG - Exonic
1007053517 6:38858102-38858124 AGCCCATGATCACCATCAACTGG - Intronic
1007664331 6:43505571-43505593 AGCAAAAGCTCACTCTCTTCGGG - Exonic
1007926712 6:45655587-45655609 AGCACATGCCCTCCCTCACATGG + Intronic
1009765600 6:68070593-68070615 TCCACATGCTCACCAGCATCTGG - Intergenic
1009898532 6:69782801-69782823 AGCACTTGCTGACCCTTGTCAGG + Intronic
1010125388 6:72425914-72425936 AGAATATGCTCACCCTCATCAGG - Intergenic
1010561247 6:77353364-77353386 AGCTGATGCTCACCCACAGCAGG - Intergenic
1012770470 6:103426791-103426813 ACCACATGCTCACTTTCACCAGG - Intergenic
1016053905 6:139558365-139558387 GGCTCATGCTCAGCCTCCTCAGG + Intergenic
1016887090 6:148968666-148968688 ATAAGATGCTCTCCCTCATCTGG - Intronic
1019432495 7:1005726-1005748 AGCCCAAGCCCACCCTCCTCAGG - Intronic
1021299760 7:18958026-18958048 AGCACCTGCATACCCTCAGCTGG - Intronic
1022380078 7:29851420-29851442 ATCAAATCCTGACCCTCATCTGG + Intronic
1026064334 7:67056920-67056942 TGCACATTCTCACCATCATGTGG + Intronic
1030231296 7:107210525-107210547 AGGACAGGCTCCTCCTCATCAGG - Exonic
1030255132 7:107501767-107501789 AGCACAACATCACCCCCATCTGG + Intronic
1030458464 7:109801980-109802002 AGTGCATGCACAGCCTCATCAGG - Intergenic
1034536381 7:151728338-151728360 ACCAAGTGCTCACTCTCATCTGG + Intronic
1035039533 7:155917422-155917444 AGCATTTGCTCGCCCTGATCTGG + Intergenic
1037624450 8:20595049-20595071 GCCACATGCACACCCTCAACTGG - Intergenic
1038364604 8:26918417-26918439 AGCACACGCTCCCACCCATCAGG + Intergenic
1039292532 8:36111864-36111886 AAGACATGCTCACCCACATGGGG - Intergenic
1039449805 8:37663328-37663350 CGAACATGCTCAGCCTCCTCAGG - Intergenic
1051486579 9:17615004-17615026 AGGACATGCTCACTCTAGTCAGG - Intronic
1057212435 9:93207404-93207426 GACAGATGCTCACCCTCCTCAGG - Intronic
1057945534 9:99324798-99324820 TGCACATGCTGCTCCTCATCTGG - Intergenic
1059387542 9:113976500-113976522 AGAACATGCTCACCCTTGGCTGG + Intronic
1059448759 9:114356862-114356884 AGCACCGGCTCTCCCACATCAGG - Exonic
1060247334 9:121957657-121957679 AGCCCATGCCCTCCCTCCTCCGG + Intronic
1061641299 9:131958691-131958713 AGCAGCTGCTGAACCTCATCTGG - Intronic
1062400834 9:136371933-136371955 AGCACCTGCTCCTCATCATCGGG + Exonic
1062673707 9:137726908-137726930 AGAAGATGCTTACCCTCATCAGG - Intronic
1189486573 X:41437600-41437622 CACAAATGCTCACCCTGATCAGG + Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1196913145 X:120504928-120504950 GGATCATGCTCACCCACATCAGG - Intergenic
1197001932 X:121450271-121450293 GGCACATGCACAGCCTCATGAGG + Intergenic
1197721368 X:129747030-129747052 ATCACATGGTAACCCTCTTCTGG + Intronic
1197834397 X:130679125-130679147 AGCTCAAGCACACCCTCCTCTGG - Intronic
1198115646 X:133542433-133542455 AGCAAATGCTCACCCTCTGAGGG + Intronic