ID: 1166070151

View in Genome Browser
Species Human (GRCh38)
Location 19:40382349-40382371
Sequence TAGTCCACGCACTTTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166070151_1166070157 0 Left 1166070151 19:40382349-40382371 CCCCCACCAAAGTGCGTGGACTA 0: 1
1: 0
2: 0
3: 18
4: 148
Right 1166070157 19:40382372-40382394 CAGGCATAAGCCACTGCACCTGG 0: 424
1: 8076
2: 30249
3: 77081
4: 136649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166070151 Original CRISPR TAGTCCACGCACTTTGGTGG GGG (reversed) Intronic
901085712 1:6611055-6611077 TAATCCCAGCACTTTGGGGGAGG + Intronic
901324384 1:8358184-8358206 TGGGGCACGCACCTTGGTGGAGG + Exonic
901338241 1:8470505-8470527 TAATCCCAGCACTTTGGAGGTGG - Intronic
901369827 1:8787572-8787594 TAATCCCAGCACTTTGGGGGAGG + Intronic
901569390 1:10147234-10147256 TAATCCCAGCACTTTGGGGGAGG + Intronic
902355241 1:15893779-15893801 TAATCCCAGCACTTTGGGGGAGG + Intronic
903096836 1:20984418-20984440 TAATCCCAGCACTTTGGGGGAGG - Intronic
904664182 1:32107480-32107502 TAATCCCAGCACTTTGGGGGCGG + Intergenic
905698511 1:39994090-39994112 TAATCCCAGCACTTTGGAGGGGG - Intergenic
907636479 1:56140040-56140062 TTGTCTAGGCAGTTTGGTGGTGG - Intergenic
908550766 1:65206651-65206673 TAGTCCAGCTACTTGGGTGGGGG + Intronic
908571149 1:65411712-65411734 TAATCCCAGCACTTTGGGGGGGG + Intronic
908770179 1:67588992-67589014 TAATCCCAGCACTTCGGTGGGGG + Intergenic
914752029 1:150541252-150541274 TAATCCCAGCACTTTGGGGGCGG + Intergenic
914752162 1:150542154-150542176 TAATCCCAGCACTTTGGGGGCGG + Intergenic
916771604 1:167914226-167914248 TAGGCCACTCAGGTTGGTGGGGG - Intergenic
916949946 1:169769588-169769610 GAGTCCACTCTCTGTGGTGGTGG - Intronic
922522938 1:226273061-226273083 TAATCCCAGCACTTTGGGGGAGG - Intronic
922814896 1:228441586-228441608 AAGCCCAGGCACTTTGGGGGAGG + Intergenic
922943680 1:229491821-229491843 TAATCCAAGCACTTTGGGAGAGG + Intronic
923375573 1:233358671-233358693 TAGTCCCAGCACTTTGTTGGGGG + Intronic
923716954 1:236433300-236433322 TAATCCCAGCACTTTGGGGGGGG + Intronic
1062957127 10:1547736-1547758 AAGTCTACGCACTGTGTTGGGGG + Intronic
1063502503 10:6567976-6567998 TAATCCCAGCACTTTGGTGGTGG + Intronic
1068989879 10:63139265-63139287 TAATCCAGGCACTTTGGTTTGGG - Intronic
1070780520 10:79135069-79135091 TAATCCTAGCACTTTGGAGGCGG - Intronic
1072230218 10:93408293-93408315 TAATCCCAGCACTTTGTTGGCGG + Intronic
1073344401 10:102771573-102771595 TAATCCCAGCACTTTGGTTGAGG + Intronic
1078531824 11:12142485-12142507 TAATCCATGCCCTTTGCTGGAGG - Intronic
1078825200 11:14923204-14923226 TAGCCCAAGTACTTTGGTTGAGG + Intronic
1079217956 11:18531415-18531437 GAGTACACACACTTTGGTGATGG - Exonic
1080462301 11:32465867-32465889 TAATCCCAGCACTTTGGAGGAGG - Intergenic
1087532386 11:99400658-99400680 TAGTACACCCACTTTGGAGAAGG - Intronic
1088249795 11:107852613-107852635 TAATCCCAGCACTTTGGAGGGGG + Intronic
1088371273 11:109090862-109090884 TAGCTCACTCACTTGGGTGGTGG + Intergenic
1090783116 11:130024944-130024966 TAATCCCAGCACTTTGGGGGGGG - Intergenic
1091275159 11:134344895-134344917 GAGTCCCCGCGCTTTGGGGGTGG + Intronic
1092987509 12:13860576-13860598 TAATCCCAGCACTTTGGAGGCGG - Intronic
1096398642 12:51287076-51287098 TAATCCTAGCACTTTGTTGGGGG - Intronic
1097092115 12:56514797-56514819 TAGTCCTCGCTATTTGTTGGGGG + Intergenic
1100190921 12:92190817-92190839 TAATCCCAGCACTTTGGGGGAGG + Intergenic
1100933039 12:99632459-99632481 TAGTTCTGGCATTTTGGTGGTGG - Intronic
1101420184 12:104544460-104544482 TAATCCCAGCACTTTGGCGGGGG + Intronic
1101930671 12:109011169-109011191 TAATCCCAGCACTTTGGTGGGGG - Intronic
1105763691 13:23537187-23537209 TAATCCCAGCACTTTGGGGGAGG + Intergenic
1106161188 13:27202751-27202773 AAGTCCATGAACTTTGGTGCTGG - Intergenic
1106272150 13:28165375-28165397 TAATCCCAGCACTTTGGGGGAGG - Intronic
1109568282 13:64149374-64149396 TAATCTCAGCACTTTGGTGGGGG + Intergenic
1110778894 13:79441601-79441623 TAATCCCAGCACTTTGGTGTAGG + Intergenic
1112309888 13:98308933-98308955 TAATCCCAGCACTTTGGTGGGGG - Intronic
1112342174 13:98561720-98561742 TAATCCTAGCACTTTGGGGGAGG + Intronic
1115248355 14:31319789-31319811 TAGTCCCAGCACGTTGGAGGTGG + Intronic
1117114275 14:52493898-52493920 TAGTCCCAGCTATTTGGTGGAGG - Intronic
1125586067 15:40820928-40820950 TAATCTCGGCACTTTGGTGGGGG + Intronic
1127845519 15:62866995-62867017 TATTGCACGCACTTGGGAGGTGG + Intergenic
1129052576 15:72795027-72795049 TAGTCCAGGCACTGTGGTCTGGG + Intergenic
1129806066 15:78459044-78459066 TAATCCCCGCACTTTGGGAGGGG - Intronic
1129807057 15:78470949-78470971 TAGTCCCAGCACTTTGGGGGGGG - Intronic
1131700243 15:94927764-94927786 TAGGCCAAGCACTTTGCTGTGGG + Intergenic
1132230894 15:100183243-100183265 TAATCCCAGCACTTTGGGGGAGG - Intronic
1133161265 16:3913473-3913495 TAATCCAAGCACTTTGGGAGAGG - Intergenic
1133527969 16:6624906-6624928 TAATCCCAGCACTTTGGTCGAGG + Intronic
1135545005 16:23359704-23359726 AAGTCCAGGCAGTTTGGTGTTGG - Intronic
1141069972 16:80945310-80945332 TAGTTGCCGCACGTTGGTGGGGG + Intergenic
1141782255 16:86170735-86170757 TAGTTCCCTCACTGTGGTGGGGG - Intergenic
1144571124 17:16399832-16399854 TAATCCCAGCACTTTGGTGTAGG + Intergenic
1146091405 17:29882495-29882517 TAATCCCAGCACTTTGGGGGAGG + Intronic
1146965735 17:37028296-37028318 TAGTCCCAGCTCCTTGGTGGTGG + Intronic
1147279405 17:39346213-39346235 TAGTCCCAGCTATTTGGTGGGGG + Intronic
1150724286 17:67638852-67638874 TAATCCCAGCACTTTGGGGGAGG + Intronic
1152172996 17:78765999-78766021 TAATCCCAGCACTTTGGGGGTGG + Intronic
1152194753 17:78911033-78911055 TAGTACAGTCACTATGGTGGAGG - Intronic
1153663900 18:7351118-7351140 TATTCCTCTCTCTTTGGTGGAGG - Intergenic
1155698698 18:28716021-28716043 TAATCCCAGCACTTTGGCGGTGG - Intergenic
1156057453 18:33024905-33024927 TAATCCCAGCACTTTGGGGGAGG - Intronic
1159614674 18:70567853-70567875 TAATCCTAGCACTTTGGGGGAGG + Intergenic
1161393431 19:4032825-4032847 TAGTCCACGCAGGGTGGGGGAGG + Intronic
1161635988 19:5389205-5389227 TAATCCCAGCACTTTGGGGGAGG + Intergenic
1163728286 19:18934763-18934785 TAGTCCCAGCTCCTTGGTGGAGG - Intronic
1164262387 19:23579377-23579399 TAATCCCAGCACTTTGGGGGGGG - Intronic
1164990980 19:32683744-32683766 TAATCCCAGCACTTTGGTGGAGG - Intergenic
1165241695 19:34473795-34473817 TAATCCCAGCACTTTGGGGGAGG - Intergenic
1166070151 19:40382349-40382371 TAGTCCACGCACTTTGGTGGGGG - Intronic
930125364 2:47792098-47792120 TAATCCCAGCACTTTGGTAGGGG - Intronic
931368152 2:61637437-61637459 TAATCCCAGCACTTTGGTTGAGG + Intergenic
931732745 2:65167422-65167444 TAATCCCAGCACTTTGGGGGAGG - Intergenic
937367206 2:121272038-121272060 TAGGCCAGGCACTTCGGTGCAGG - Intronic
940919528 2:159291479-159291501 TAATCCCAGCACTTTGGTGGGGG - Intergenic
941938361 2:171005489-171005511 TAATCCAAGCACTTTGGGAGAGG + Intronic
944243668 2:197510207-197510229 TAGTCCCAGCACTTTGGAGGCGG - Intronic
946110637 2:217412322-217412344 TAGTCCTCCCACTTTGGGGAGGG + Intronic
946983634 2:225247500-225247522 TAATCCCAGCACTTTGGGGGAGG + Intergenic
1169223564 20:3841612-3841634 TAATCCCAGCACTTTGGGGGTGG + Intergenic
1172270180 20:33650620-33650642 TAGTCCCAGGACTTTGGCGGGGG - Intergenic
1172705631 20:36880348-36880370 TAATCCCAGCACTTTGGGGGAGG - Intronic
1182292072 22:29287918-29287940 TAATCCCAGCACTTTGGGGGAGG + Intronic
1182309189 22:29392631-29392653 TAATCCCAGCACTTTGGAGGTGG - Intronic
1183222450 22:36524705-36524727 TACTCCTCTCAGTTTGGTGGTGG - Exonic
1184055590 22:42045988-42046010 TATTCCACCCACCCTGGTGGAGG - Intronic
949551937 3:5118963-5118985 TAGTCCCAGGACTTTGGGGGGGG - Intergenic
949630449 3:5920237-5920259 TAGTCCCAGGACTTTGGGGGCGG + Intergenic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
950081711 3:10227189-10227211 TAATCCCAGCACTTTGGAGGAGG + Intronic
952757695 3:36886363-36886385 TAATCCTAGCACTTTGGGGGAGG - Intronic
954070019 3:48136127-48136149 TAGCCCATGCCATTTGGTGGAGG + Intergenic
954781259 3:53063083-53063105 TATTCCACCCACCCTGGTGGAGG + Intronic
956277924 3:67523039-67523061 TAATCCGAGCACTTTGGAGGCGG - Intronic
960611587 3:119559739-119559761 TAGTCCATGCACGGTGGTGAGGG - Intergenic
962514621 3:136138965-136138987 TAATCCCAGCACTTTGGGGGAGG - Intronic
967835483 3:193959104-193959126 TAATCCCAGCACTTTGGGGGAGG + Intergenic
968152003 3:196344338-196344360 TAATCCCAGCACTTTGGAGGCGG + Intergenic
972214116 4:36875706-36875728 TATTCCACTGAGTTTGGTGGTGG - Intergenic
975325146 4:73050814-73050836 TAATCCCAGCACTTTGGGGGGGG + Intergenic
975570414 4:75811410-75811432 TAATCCCAGCACTTTGGGGGGGG - Intronic
976923461 4:90467131-90467153 TAATCCCAGCACTTTGGAGGTGG + Intronic
977939126 4:102839389-102839411 TAGTCCTAGCTCTTTGGTGGTGG - Intronic
978380595 4:108124325-108124347 TACTCCCCACACTTTGCTGGGGG - Intronic
978719724 4:111894271-111894293 TAGTCCAGACACTGTGGTGTTGG + Intergenic
989098666 5:37804727-37804749 TAGTCCATGCAGTTTGGATGAGG + Intergenic
989596380 5:43159918-43159940 TAATCCCAGCACTTTGGGGGAGG + Intronic
991521689 5:67505801-67505823 TAATCCCAGCACTTTGGTGGGGG - Intergenic
994822659 5:104674086-104674108 TAATCCCAGCACTTTGGTGGTGG - Intergenic
994862105 5:105209955-105209977 TAATCCCAGCACTTTGGAGGCGG - Intergenic
995759418 5:115547578-115547600 TAGTCCCAGCACTTTGGGAGGGG - Intergenic
998375596 5:141688556-141688578 TAATCCCAGCACTTTGGCGGAGG - Intergenic
999602376 5:153281627-153281649 TAATCCAAGCACTTTGGAGGCGG - Intergenic
1000315558 5:160087120-160087142 TAATCCTAGCACTTTGTTGGGGG + Intronic
1001458829 5:171890274-171890296 TAATCCCCGCACTTTGGGGCAGG + Intronic
1004577723 6:16914269-16914291 TAATCCAAGCACTTTGGGAGGGG - Intergenic
1004666367 6:17751804-17751826 TAATCCCAGCACTTTGGAGGCGG - Intergenic
1011472555 6:87722262-87722284 TAATCCAAGCACTTTGGCGGTGG - Intergenic
1015015863 6:128412279-128412301 TAATCCCCACACCTTGGTGGGGG + Intronic
1015724776 6:136289195-136289217 TACTCAACGCACTTTGCTGCGGG + Intronic
1016407780 6:143748318-143748340 TAATCCTAGCACTTTGGCGGGGG - Intronic
1017456129 6:154603266-154603288 AAGGCCAGGCACTTTGGTGGGGG - Intergenic
1019793023 7:3029622-3029644 TAATCCCAGCACTTTGGGGGCGG + Intronic
1027387440 7:77672415-77672437 AATTCCAAGTACTTTGGTGGTGG - Intergenic
1029242639 7:99175065-99175087 TAATCCCAGCACTTTGGGGGAGG - Intronic
1030001779 7:105072055-105072077 TAATCCCAGCACTTTGGGGGAGG + Intronic
1031083630 7:117281492-117281514 TAATCCCAGCACTTTGGTGGGGG - Intronic
1031486656 7:122334927-122334949 TAGACCACACACTTTGCTAGAGG - Intronic
1032144911 7:129370440-129370462 TAATCCCAGCACTTTGGGGGAGG + Intronic
1033277809 7:139985872-139985894 TGGTCCACACACTATGGGGGAGG - Intronic
1034555259 7:151846218-151846240 TAATCCCAGCACTTTGGGGGTGG + Intronic
1035972729 8:4269318-4269340 TAATCCCAGCACTTTGGGGGAGG - Intronic
1039955565 8:42204767-42204789 TAATCCCAGCACTTTGGAGGAGG + Intronic
1042470869 8:69186378-69186400 TAGTCCAGCCACTGTGGAGGGGG - Intergenic
1045679848 8:104646926-104646948 TAGTCCCAGCACTTTGGAGGAGG + Intronic
1046225631 8:111275443-111275465 TAATCCAAGCACTTTGTGGGAGG + Intergenic
1048534931 8:135284314-135284336 TAGTCCAGGCAGCATGGTGGAGG - Intergenic
1050260361 9:3835188-3835210 TAGTGCCCACAGTTTGGTGGTGG - Intronic
1051260970 9:15264395-15264417 TAATCCCAGCACTTTGGGGGAGG + Intronic
1053250671 9:36571860-36571882 TAATCCCAGCACTTTGGTGGGGG - Intergenic
1055493521 9:76830396-76830418 TAATCCCAGCACTTTGGAGGTGG + Intronic
1055738571 9:79361014-79361036 CAGTCCTCACACTTTGGTAGAGG + Intergenic
1061030994 9:128082870-128082892 TAATCCCAGCACTTTGGAGGCGG - Intronic
1187688627 X:21841162-21841184 TAATCCCAGCACTTTGGGGGAGG + Intronic
1189776166 X:44471696-44471718 TAGTCCCAGCACTTTGGGAGTGG + Intergenic
1190176110 X:48151329-48151351 TAATCCCAGCACTTTGGAGGTGG + Intergenic
1192118856 X:68435905-68435927 TAATCCCAGCACTTTGGTGGGGG - Intergenic
1192557276 X:72100757-72100779 TTCTCCACGGACTTGGGTGGGGG - Intergenic
1194154046 X:90364473-90364495 TAATCCCAGCACTTGGGTGGAGG - Intergenic
1196644269 X:118099696-118099718 TAGTCCCAGCAACTTGGTGGGGG + Intronic
1196678056 X:118441211-118441233 TAATCCTAGCACTTTGGGGGAGG - Intronic
1200500398 Y:3941356-3941378 TAATCCCAGCACTTGGGTGGAGG - Intergenic
1200763620 Y:7062283-7062305 TAGGCTACGCCCTTTGTTGGAGG - Intronic
1201038343 Y:9805092-9805114 AAGTCCCTGCAGTTTGGTGGAGG + Intergenic