ID: 1166072591

View in Genome Browser
Species Human (GRCh38)
Location 19:40395642-40395664
Sequence CAATTTCAACAGAGGGCACT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166072582_1166072591 14 Left 1166072582 19:40395605-40395627 CCTTCCTCAATTTCCACGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG 0: 1
1: 0
2: 1
3: 22
4: 178
1166072584_1166072591 10 Left 1166072584 19:40395609-40395631 CCTCAATTTCCACGGCGGGCAGC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG 0: 1
1: 0
2: 1
3: 22
4: 178
1166072580_1166072591 15 Left 1166072580 19:40395604-40395626 CCCTTCCTCAATTTCCACGGCGG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG 0: 1
1: 0
2: 1
3: 22
4: 178
1166072578_1166072591 18 Left 1166072578 19:40395601-40395623 CCGCCCTTCCTCAATTTCCACGG 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG 0: 1
1: 0
2: 1
3: 22
4: 178
1166072588_1166072591 1 Left 1166072588 19:40395618-40395640 CCACGGCGGGCAGCTGTGGGGTG 0: 1
1: 0
2: 4
3: 22
4: 390
Right 1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG 0: 1
1: 0
2: 1
3: 22
4: 178
1166072577_1166072591 22 Left 1166072577 19:40395597-40395619 CCAGCCGCCCTTCCTCAATTTCC 0: 1
1: 0
2: 1
3: 24
4: 298
Right 1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG 0: 1
1: 0
2: 1
3: 22
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166072591 Original CRISPR CAATTTCAACAGAGGGCACT CGG Exonic
900828552 1:4947118-4947140 CAATTTCAACAGGGGAAACCCGG + Intergenic
901040872 1:6362570-6362592 CCAGCTCATCAGAGGGCACTCGG + Intronic
901988912 1:13096726-13096748 CACCTTCCACAGAGGGCACCTGG - Intergenic
901992901 1:13130041-13130063 CACCTTCCACAGAGGGCACCTGG + Intergenic
906989239 1:50720569-50720591 TACTTTGAACTGAGGGCACTTGG + Intronic
908214862 1:61940931-61940953 CACTTTCAACTGAGATCACTAGG + Intronic
908770343 1:67590350-67590372 CAATTTGAAAAAAAGGCACTTGG + Intergenic
908991195 1:70092117-70092139 CACTTTCAGAATAGGGCACTAGG - Intronic
912426085 1:109592008-109592030 CAATTTGAACTGAGAGTACTGGG + Intronic
917046565 1:170867040-170867062 CATTGTCAACCGAGGGCACATGG - Intergenic
917350735 1:174074952-174074974 CTGTTTCAGCAGAGGGCACTAGG - Intergenic
918216572 1:182396898-182396920 AAATTCCACAAGAGGGCACTAGG - Intergenic
923796815 1:237164656-237164678 CACTTTAGCCAGAGGGCACTTGG + Intronic
1063897809 10:10700659-10700681 CAATTTCTACAGGAGTCACTAGG - Intergenic
1065854870 10:29821903-29821925 TACTTTCAACTGAGGGCTCTTGG - Intergenic
1076507559 10:130987900-130987922 CAACTTCTGCAGAGGGCATTTGG + Intergenic
1076529844 10:131136840-131136862 CCATTCAAACTGAGGGCACTGGG + Intronic
1077884076 11:6372954-6372976 CAATTTCAAAAGAGAGGAGTGGG + Intergenic
1078568035 11:12434148-12434170 TATTTTAACCAGAGGGCACTTGG - Intronic
1078632925 11:13019983-13020005 CAATTTCAACAAATGGTTCTGGG - Intergenic
1079309653 11:19353544-19353566 CATTTTCAACATAGGACAATGGG + Intronic
1081056536 11:38416321-38416343 AAACTGCAACAGAGAGCACTTGG + Intergenic
1088911109 11:114193173-114193195 CAACATCAGCAGGGGGCACTCGG - Intronic
1088949075 11:114547098-114547120 CTCTTTCAAAAGAGGTCACTAGG - Intronic
1090135341 11:124192219-124192241 CAATTTTGACAGAGTGGACTGGG - Intergenic
1090578317 11:128132739-128132761 CATTTTCAAATGAGGGCACAGGG + Intergenic
1091955391 12:4637273-4637295 CATTGTCGACAGAGGGTACTGGG + Intronic
1097526511 12:60743605-60743627 AAATTTCAACAGAGCAAACTTGG - Intergenic
1098802893 12:74984919-74984941 CAGCTTCCACAGATGGCACTAGG + Intergenic
1099687221 12:85906024-85906046 CATTTTCAACAAATGGCACTAGG - Intergenic
1102715075 12:114963520-114963542 CAATATTAGCAGAGGGCACTTGG + Intergenic
1103201053 12:119088272-119088294 CAGCTTCATCAGAGGTCACTGGG + Intronic
1105041975 12:132967778-132967800 CAGCTTCAACAGCTGGCACTGGG - Intergenic
1105829757 13:24153554-24153576 CACTTTCAACAGAGGACACGTGG + Intronic
1106878219 13:34099746-34099768 TAATTTCAACAATGAGCACTTGG + Intergenic
1108793098 13:53996533-53996555 CAGTTTCAAAAGAGGGGCCTTGG + Intergenic
1109360255 13:61285989-61286011 CACTTTGAACTGAAGGCACTTGG - Intergenic
1110979695 13:81880567-81880589 CAAGTACAACTGAGAGCACTTGG + Intergenic
1113519089 13:110925657-110925679 CAACTTCAAGAGAGGGTTCTTGG - Intergenic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1116119753 14:40706929-40706951 CTATTTCAACAGAAGTCACTTGG - Intergenic
1117891939 14:60431427-60431449 CAATATCAACAGAGCAGACTAGG - Intronic
1118548527 14:66921969-66921991 CCTTTTCAACAAAGGGCGCTGGG + Intronic
1119780084 14:77271381-77271403 CAAATTCAACACAGTGCCCTCGG - Intergenic
1121254681 14:92522616-92522638 CATTTAAAACAGAGGGGACTTGG - Intronic
1121379358 14:93449195-93449217 TATTTTTAACAGAGGGCCCTGGG + Intronic
1121390604 14:93570283-93570305 CAATTTCAAAATAGGGCAGTTGG - Intronic
1126998111 15:54468680-54468702 TATTTTCAACAGATGGTACTGGG - Intronic
1128422386 15:67506054-67506076 CAATTTCTAGAGAGGTGACTGGG + Intergenic
1128771594 15:70286718-70286740 CAGCCTCTACAGAGGGCACTTGG + Intergenic
1129076062 15:72997111-72997133 TACTTTGAACAGAGAGCACTTGG - Intergenic
1129544216 15:76377426-76377448 AAGGTTAAACAGAGGGCACTGGG - Intronic
1130722095 15:86398214-86398236 CCATTTCAACAGAGCTCACCAGG - Intronic
1137689807 16:50415436-50415458 CGTTTTCAACAGATGGTACTGGG - Intergenic
1139910166 16:70392775-70392797 CAAAAACAACAGATGGCACTGGG - Intronic
1139911281 16:70399007-70399029 CAATCACAACAGAGAGCACAGGG + Exonic
1141386819 16:83628984-83629006 CGTATTCAACAAAGGGCACTGGG - Intronic
1147233095 17:39033728-39033750 ATGTTTCAACTGAGGGCACTGGG + Intergenic
1148173680 17:45546101-45546123 ATGTTTCAACAGAGGGCACTGGG - Intergenic
1148275589 17:46299347-46299369 ATGTTTCAACAGAGGGCACTGGG + Intronic
1148297698 17:46516915-46516937 ATGTTTCAACAGAGGGCACTGGG + Intronic
1148362247 17:47021403-47021425 ATGTTTCAACAGAGGGCACTGGG + Intronic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1150404888 17:64893025-64893047 ATGTTTCAACAGAGGGCACTGGG - Intronic
1151159894 17:72156596-72156618 GAATTTCAACACAGGTCAGTGGG - Intergenic
1151832887 17:76565987-76566009 CCTTGCCAACAGAGGGCACTGGG - Exonic
1153073723 18:1137098-1137120 CTAATTCAACAAATGGCACTGGG - Intergenic
1153295430 18:3541472-3541494 CAATTTCAAGGGTGGGTACTGGG + Intronic
1155324452 18:24651854-24651876 CTTTATCAACAAAGGGCACTGGG - Intergenic
1158376792 18:56879822-56879844 CATTTTCAGCAAATGGCACTAGG - Intronic
1158874664 18:61721756-61721778 CAATTTAAACACAGGCAACTTGG - Intergenic
1159057496 18:63480467-63480489 CACTTTCAACAGAAGTCATTAGG + Intronic
1160278506 18:77463219-77463241 CAATTTCTACAGAGACCAGTAGG + Intergenic
1161121380 19:2528757-2528779 GAATTCCAACAGAGGTCACTGGG - Intronic
1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG + Exonic
1166902618 19:46077400-46077422 CATTTTCACCACAGGGAACTTGG + Intergenic
1202657368 1_KI270708v1_random:36409-36431 AAATTTCAATAGAGGCCAATTGG - Intergenic
925922806 2:8648449-8648471 CAATTTCACCAGAGAGAATTTGG - Intergenic
930971095 2:57397004-57397026 CAACTTCCACAGCTGGCACTGGG + Intergenic
931695819 2:64869718-64869740 CACCTTCATCAGAGGGGACTTGG + Intergenic
932246290 2:70199495-70199517 CTTTGTCAATAGAGGGCACTTGG + Intronic
934818417 2:97350746-97350768 CAGTTTCAAAGGAGGGCACAGGG + Intergenic
935601540 2:104927254-104927276 CAATTTCAACACATGGCTTTTGG + Intergenic
936345042 2:111669146-111669168 CAATGTCAAAAGCGGGCACAGGG - Intergenic
937077455 2:119117539-119117561 CAATTTCAGCAGTGGGCTCTGGG - Intergenic
937471666 2:122179122-122179144 CCATTTCAAAGGATGGCACTGGG - Intergenic
937611222 2:123863928-123863950 CACTTTAAGCTGAGGGCACTTGG - Intergenic
938979110 2:136508633-136508655 CAATTTGTACAGAGGTGACTGGG - Intergenic
940014400 2:149088118-149088140 CAATTCCAACAGTGGACAGTAGG - Intronic
941165325 2:162077721-162077743 CAATTTAAAATGAGGTCACTAGG + Intergenic
941744684 2:169074289-169074311 CACTATCATCAGAGGGCCCTCGG - Intronic
944104405 2:196063783-196063805 CAATTTCAACCAAAGGCACTTGG + Intronic
945021768 2:205580317-205580339 CCATTTCAGCAGAGGGCCCCTGG + Intronic
945525620 2:210884894-210884916 CAATGTCAATTGATGGCACTTGG - Intergenic
947433324 2:230050077-230050099 TAATTTCATCAGAGAGCACAAGG + Intronic
948000922 2:234566794-234566816 CAATTTCAACATCAGGCAATTGG + Intergenic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171322749 20:24260746-24260768 GAATTTCCACTGAGGGCCCTGGG - Intergenic
1174434174 20:50493659-50493681 AAATTTCAACAGAGACCATTTGG - Intergenic
1176597239 21:8758753-8758775 AAATTTCAATAGAGGCCAATTGG - Intergenic
1176643056 21:9324715-9324737 AAATTTCAATAGAGGCCAATTGG - Intergenic
1177561864 21:22766218-22766240 CAATTTCAACATACGGAATTTGG + Intergenic
1177688317 21:24469029-24469051 CAATTTCAACAAATGGTGCTGGG + Intergenic
1178466991 21:32858159-32858181 CAATTTCCAGAGATGGCACTGGG + Intergenic
1180369878 22:11974501-11974523 AAATTTCAATAGAGGCCAATTGG + Intergenic
1180376366 22:12097604-12097626 AAATTTCAATAGAGGCCAATTGG - Intergenic
1180421207 22:12816081-12816103 AAATTTCAATAGAGGCCAATTGG + Intergenic
1182505108 22:30776549-30776571 TACTATCAACAGAAGGCACTGGG + Intronic
949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG + Intronic
950828418 3:15850145-15850167 CTTTTTCAACAAATGGCACTGGG + Intronic
950893050 3:16422245-16422267 CAATTTCAACAGAGTTTACCAGG + Intronic
950916125 3:16647027-16647049 TTACTTTAACAGAGGGCACTTGG + Intronic
953528253 3:43713487-43713509 CAATCCAAACAGAAGGCACTAGG - Intronic
953723352 3:45375910-45375932 CCTTTTCAACAAATGGCACTGGG - Intergenic
956609823 3:71111297-71111319 CACGTTTAAGAGAGGGCACTTGG - Intronic
957097027 3:75785868-75785890 AAATTTCAATAGAGGCCAATTGG + Intergenic
957486773 3:80871634-80871656 CAGCTTCCACAGAGGGCACCAGG - Intergenic
958577990 3:95976872-95976894 CCTTTTCAACAAACGGCACTGGG + Intergenic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
961159235 3:124707785-124707807 CAACTTCAAAAAGGGGCACTTGG + Intronic
965253196 3:166368987-166369009 CAAATTCACCAGAGAGCCCTTGG + Intergenic
967234221 3:187368571-187368593 CAATACCAACAGAGAGCATTTGG + Exonic
967486404 3:190036728-190036750 CAGATTCTACAGAGGGAACTTGG - Intronic
1202743829 3_GL000221v1_random:80314-80336 AAATTTCAATAGAGGCCAATTGG + Intergenic
970162921 4:13207399-13207421 AAATGTGAACAAAGGGCACTTGG + Intergenic
971403747 4:26301248-26301270 GAATTTAAACAGAGGCCACGTGG - Intronic
973360533 4:49160972-49160994 AAATTTCAATAGAGGCCAATTGG - Intergenic
973399552 4:49626943-49626965 AAATTTCAATAGAGGCCAATTGG + Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
976410405 4:84706771-84706793 AAATTACAAGAGAGGGAACTGGG + Intronic
980243289 4:130203649-130203671 CAACTTCCACAGCTGGCACTGGG - Intergenic
980543222 4:134222429-134222451 CAATTTCAACAGAGTGAATTGGG - Intergenic
980622781 4:135330762-135330784 CAATTTAAAATGAGGCCACTAGG - Intergenic
983695222 4:170519760-170519782 AAATTTCAATAGAGAGCACATGG + Intergenic
984030296 4:174596133-174596155 CAATATCAACAGAGGAAAGTGGG - Intergenic
1202757965 4_GL000008v2_random:83037-83059 AAATTTCAATAGAGGCCAATTGG - Intergenic
991521627 5:67505207-67505229 CTATTTCTATAGAGGTCACTGGG + Intergenic
993639522 5:90384788-90384810 CAACTCCCACAGAGGGCAATTGG - Intergenic
995439955 5:112180429-112180451 CACTTTCAACAAAGGCCACAAGG + Intronic
997642159 5:135456358-135456380 CGATTACAACAGAAGGCAGTGGG - Intergenic
999494521 5:152084028-152084050 CAATTTCAAAACAGAGCCCTAGG - Intergenic
999885995 5:155923552-155923574 CAATTTCCACACAAGGCCCTTGG + Intronic
1000195296 5:158951335-158951357 CAATGGCAAAAGAGGGAACTTGG + Intronic
1000285139 5:159820197-159820219 CACTTTCCACTGAGGTCACTTGG + Intergenic
1001937801 5:175718039-175718061 GCATTTCAGCAGAGGACACTGGG - Intergenic
1003853947 6:10253265-10253287 CAATTTCAACAAAGGGGAATAGG - Intergenic
1005919109 6:30382830-30382852 CATTTTCAGCAGGGGGCTCTGGG - Intergenic
1006137452 6:31903854-31903876 TAGATTCAACAGAGGGAACTGGG - Intronic
1008567266 6:52781572-52781594 AAATTACAGCAGAGGGCCCTTGG - Intergenic
1011646679 6:89465550-89465572 CATTTTAAACAGAGGAAACTGGG - Intronic
1015321927 6:131885891-131885913 AGATTTAAACAGAGGGCTCTGGG - Intronic
1018388818 6:163327807-163327829 CAATCTCCACAGAGGGCCCAGGG - Intergenic
1019959378 7:4446227-4446249 CACCTTGAAAAGAGGGCACTGGG - Intergenic
1020868717 7:13600386-13600408 CCTTTTCAACACAGGGCTCTAGG - Intergenic
1021428192 7:20528034-20528056 TCTTTTCAACAAAGGGCACTGGG + Intergenic
1023630154 7:42155675-42155697 CAACTTCAAAAGAGGTCCCTGGG + Intronic
1026392412 7:69914852-69914874 CATTTTAAACCGAGGGCACGTGG - Intronic
1028129586 7:87153461-87153483 CAATTGCACAAAAGGGCACTTGG - Intronic
1028864974 7:95698511-95698533 CATTTTCAATACATGGCACTGGG - Intergenic
1030026229 7:105327380-105327402 CAGTTACAACAGAGGTCACTTGG + Intronic
1031316708 7:120267667-120267689 CAATTTGTACAGAGGTCACCAGG + Intergenic
1034551023 7:151820758-151820780 CACCTTCAACAGAAGGAACTTGG + Intronic
1036428399 8:8667296-8667318 CAATGTCAGCAGAGGCCACATGG - Intergenic
1037729150 8:21508813-21508835 CAATCTCAACAGAGATCTCTGGG + Intergenic
1039630539 8:39107501-39107523 CGATCTCGACAGAGGGCGCTGGG + Intronic
1039931569 8:41995535-41995557 AAACTTCAACAGAGAGCATTGGG - Intronic
1041849462 8:62373800-62373822 TAATTTCTACAGAGGGTATTGGG - Intronic
1042882742 8:73511986-73512008 CATTTTCAACAGAGGGTACTGGG - Intronic
1046044906 8:108953196-108953218 CAATTTCAACACAGCTCATTTGG + Intergenic
1048063691 8:130946780-130946802 CAATTTCATGAGATGCCACTGGG - Intronic
1048428673 8:134346705-134346727 CAATTTCTACAAATGGCAATTGG - Intergenic
1049985637 9:948237-948259 CACTTTCAACAGAGGGGAGGAGG - Intronic
1050360104 9:4822114-4822136 CAATTTGTACAAAGGGCACTGGG - Intronic
1050628434 9:7533388-7533410 TCATTTCATAAGAGGGCACTGGG - Intergenic
1051484796 9:17596633-17596655 CAAGTTCAACAGGGATCACTGGG - Intronic
1052345007 9:27400525-27400547 CAATTTCACCTGAGGACATTAGG - Intronic
1053920936 9:42989614-42989636 GAATTTCAACAGAAAGCAGTGGG - Intergenic
1054946589 9:70802936-70802958 TCATTTCAAAAGAGGCCACTAGG + Intronic
1056548026 9:87629139-87629161 CAAGTTAAAATGAGGGCACTTGG + Intronic
1058868952 9:109186135-109186157 GGATATCAACAGAGGGCACCAGG + Intronic
1060175451 9:121494243-121494265 AAATTTGAACAGAAGGCAATGGG + Intergenic
1203689570 Un_GL000214v1:30057-30079 AAATTTCAATAGAGGCCAATTGG - Intergenic
1203712461 Un_KI270742v1:110278-110300 AAATTTCAATAGAGGCCAATTGG + Intergenic
1203538755 Un_KI270743v1:67909-67931 AAATTTCAATAGAGGCCAATTGG - Intergenic
1203556060 Un_KI270743v1:208604-208626 AAATTTCAATAGAGGCCAATTGG + Intergenic
1203646705 Un_KI270751v1:73996-74018 AAATTTCAATAGAGGCCAATTGG + Intergenic
1186473509 X:9839086-9839108 AAATTTCACCAGGTGGCACTGGG + Intronic
1186651105 X:11561074-11561096 CAGTTTCAACAGAGACCACAAGG + Intronic
1186671173 X:11768949-11768971 CAATTTCCACAGAGGGCCAGAGG + Intronic
1187750305 X:22456296-22456318 CAGATTCAACAGTGGGCACCAGG - Intergenic
1189150931 X:38705902-38705924 CAATTTAAACATTGGGGACTGGG - Intergenic
1192008375 X:67241463-67241485 CAATTTCAAAACATGGCAATTGG + Intergenic
1192102401 X:68278583-68278605 AAATATCAAAAGAGAGCACTGGG + Intronic
1192323109 X:70108130-70108152 TTATTTGAACTGAGGGCACTTGG - Intergenic
1197375819 X:125680970-125680992 CAATGTCAACAGGGATCACTGGG + Intergenic
1199112353 X:143949714-143949736 CCTTTTCAACACAGGGCTCTTGG - Intergenic
1199676795 X:150196152-150196174 CAATTTCAACAGGGGCACCTTGG - Intergenic
1199685379 X:150260693-150260715 CAAATTAAACTGAGGGCATTAGG - Intergenic
1201911790 Y:19140121-19140143 CAATTTCTACTGAGGACACTTGG + Intergenic
1202305074 Y:23460553-23460575 AAATTTCAAAAGATGGCAGTGGG + Intergenic
1202565735 Y:26210036-26210058 AAATTTCAAAAGATGGCAGTGGG - Intergenic