ID: 1166074062

View in Genome Browser
Species Human (GRCh38)
Location 19:40403713-40403735
Sequence CAGGCTGAGGCTCCTGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 345}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166074039_1166074062 24 Left 1166074039 19:40403666-40403688 CCCGCAGTTCGACCCCGCCCCAC 0: 1
1: 0
2: 2
3: 8
4: 97
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074040_1166074062 23 Left 1166074040 19:40403667-40403689 CCGCAGTTCGACCCCGCCCCACA 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074048_1166074062 5 Left 1166074048 19:40403685-40403707 CCACACCCCGGGCCCGCCCACCT 0: 1
1: 0
2: 8
3: 96
4: 729
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074044_1166074062 11 Left 1166074044 19:40403679-40403701 CCCGCCCCACACCCCGGGCCCGC 0: 1
1: 0
2: 5
3: 108
4: 1073
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074054_1166074062 -8 Left 1166074054 19:40403698-40403720 CCGCCCACCTTCCTGCAGGCTGA 0: 1
1: 0
2: 7
3: 53
4: 531
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074045_1166074062 10 Left 1166074045 19:40403680-40403702 CCGCCCCACACCCCGGGCCCGCC 0: 1
1: 0
2: 7
3: 143
4: 1235
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074047_1166074062 6 Left 1166074047 19:40403684-40403706 CCCACACCCCGGGCCCGCCCACC 0: 1
1: 0
2: 3
3: 55
4: 477
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074038_1166074062 25 Left 1166074038 19:40403665-40403687 CCCCGCAGTTCGACCCCGCCCCA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074037_1166074062 26 Left 1166074037 19:40403664-40403686 CCCCCGCAGTTCGACCCCGCCCC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074053_1166074062 -7 Left 1166074053 19:40403697-40403719 CCCGCCCACCTTCCTGCAGGCTG 0: 1
1: 0
2: 6
3: 90
4: 1371
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074049_1166074062 0 Left 1166074049 19:40403690-40403712 CCCCGGGCCCGCCCACCTTCCTG 0: 1
1: 0
2: 3
3: 26
4: 373
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074035_1166074062 30 Left 1166074035 19:40403660-40403682 CCCGCCCCCGCAGTTCGACCCCG 0: 1
1: 0
2: 1
3: 10
4: 94
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074036_1166074062 29 Left 1166074036 19:40403661-40403683 CCGCCCCCGCAGTTCGACCCCGC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074046_1166074062 7 Left 1166074046 19:40403683-40403705 CCCCACACCCCGGGCCCGCCCAC 0: 1
1: 0
2: 6
3: 63
4: 594
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074043_1166074062 12 Left 1166074043 19:40403678-40403700 CCCCGCCCCACACCCCGGGCCCG 0: 1
1: 0
2: 8
3: 93
4: 1182
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074051_1166074062 -2 Left 1166074051 19:40403692-40403714 CCGGGCCCGCCCACCTTCCTGCA 0: 1
1: 0
2: 3
3: 43
4: 460
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345
1166074050_1166074062 -1 Left 1166074050 19:40403691-40403713 CCCGGGCCCGCCCACCTTCCTGC 0: 1
1: 0
2: 4
3: 63
4: 551
Right 1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG 0: 1
1: 0
2: 1
3: 26
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166074062 Original CRISPR CAGGCTGAGGCTCCTGGCGG CGG Exonic
900469793 1:2848095-2848117 CAGCCTGAGGCTCGAGGCAGAGG - Intergenic
900593366 1:3469474-3469496 CAGCCTGAGCATCCTGGTGGAGG + Exonic
901002269 1:6154696-6154718 CAGGCTGGGGCACCTGCGGGGGG + Exonic
901049365 1:6418796-6418818 CAGGTTGAAGCTCTTGGTGGCGG - Exonic
901229665 1:7634679-7634701 CAGGCTGGGGCTGCCGGAGGAGG + Intronic
901879496 1:12185568-12185590 CAAACTGAGGCTCCAGACGGGGG + Intronic
902105916 1:14035951-14035973 CAGGCTCAGGCTTCAGGCTGAGG + Intergenic
902290487 1:15431763-15431785 CAGGCTGAGACCCTTGGTGGAGG - Intergenic
902329727 1:15725383-15725405 CTGGGTGGGGCTCCTGGTGGAGG - Exonic
902519997 1:17010875-17010897 CTGGCTGTGGTTCCCGGCGGCGG + Intronic
902545930 1:17190398-17190420 CATGCTGAGGCCACAGGCGGTGG + Intergenic
902873908 1:19329797-19329819 CAGGGAGAGCCTCCTGGAGGAGG + Intergenic
903141964 1:21344574-21344596 CAGGCTGGGCTTCCTGGGGGGGG - Intronic
903234116 1:21938396-21938418 CAGGCTGAGGCTGGGTGCGGTGG - Intergenic
903257005 1:22109111-22109133 CAGGCTGAGGCTCTTCTCTGGGG + Intergenic
903293536 1:22329467-22329489 CAGTCGGAGGCTCTTGGAGGAGG - Intergenic
903339272 1:22643883-22643905 CATGGTGAGGCTCCTGGGGGAGG + Intronic
904676044 1:32199845-32199867 CTGGCAGAGGCTCCTGGCGCAGG - Intergenic
904720057 1:32500815-32500837 CGCGCGGAGCCTCCTGGCGGCGG + Intronic
905488889 1:38328110-38328132 CAGGCTGAGGCTCAACGCTGAGG + Intergenic
907076826 1:51586741-51586763 GAGGCTGAGGCCCCTTGGGGTGG + Intronic
907310717 1:53537501-53537523 CAGGTTCAGGCTCCCGGTGGTGG - Intronic
907657658 1:56360513-56360535 CAGCCTGAGTCTCCTAGCTGAGG - Intergenic
908382008 1:63605683-63605705 CAGGCTGAGGCTCAGGTGGGAGG - Intronic
908823732 1:68114182-68114204 CAGGCTGAGGCTCTGGGCCAAGG + Intronic
912562952 1:110563421-110563443 AAGGCTGAGGCTCATGGAGGAGG + Intergenic
914879707 1:151538030-151538052 AAGGCTGAGGGCCCTGGCTGGGG - Exonic
915214068 1:154328669-154328691 CAGGCTGCGGCTCCTGCAGTCGG + Intronic
917966514 1:180182479-180182501 CAGGCCCAGGCTCCTGACGGTGG - Intronic
920196793 1:204233285-204233307 CAGCCTAAGCCTCCTGGAGGAGG + Intronic
922228227 1:223664196-223664218 AAGGCAGAGGCTCCTGGATGCGG - Intronic
922463479 1:225830194-225830216 CAGGCTGAGGCTCCCTGGGTAGG + Intronic
922465473 1:225843438-225843460 CCTGCTGAGGCTCTTGGAGGAGG - Intronic
923032813 1:230263396-230263418 CATGCAAAGGCGCCTGGCGGGGG - Intronic
924179176 1:241424150-241424172 CGGGCTGAGGCACCTGCCGGCGG + Intergenic
1063040914 10:2336453-2336475 CAGGGTGAGGCTACAGGCAGTGG - Intergenic
1063473453 10:6307689-6307711 CAGGCTGTGGCACCAGACGGTGG - Intergenic
1064588680 10:16865765-16865787 CAGGTTGCGGCTGCTGGCTGGGG - Intronic
1067064072 10:43093882-43093904 CAGGCGCAGGCTCCTGCTGGTGG + Intronic
1067760205 10:49039263-49039285 CAGGATGAGGGTCCTGGGTGGGG + Intronic
1068121580 10:52786373-52786395 CAGGCTCAGCCTTCTGGCTGTGG + Intergenic
1068695618 10:59965305-59965327 CAGGGTGTGGCTCATGGTGGTGG + Intergenic
1069719375 10:70539777-70539799 CAGGCTGAGGCCTCTGGGGAGGG + Intronic
1069793072 10:71035710-71035732 CTTGCTGAGGCTGCTGGTGGGGG - Intergenic
1069804132 10:71107280-71107302 CAGGCTGTGGCTCCAGAGGGTGG + Intergenic
1070204889 10:74247996-74248018 CAGGTTGAGCCTCATGGTGGGGG + Intronic
1070669481 10:78368018-78368040 CAGGCTGAGGGCCCTGGATGTGG + Intergenic
1070763797 10:79044916-79044938 CAGGCTGAGGCTCATTGGGAGGG - Intergenic
1071435528 10:85645841-85645863 CAGGCTGGGGCACCTAGCTGTGG - Intronic
1072617953 10:97062319-97062341 CAGTGTGAGGCTCTTGGCTGTGG - Intronic
1074813940 10:117130942-117130964 CAGGCTGAGGCCCCTGGGAGAGG + Intronic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1075713263 10:124542021-124542043 CCAGCTGAGGCTCCTGGAGTTGG + Intronic
1075817439 10:125275574-125275596 CAGGCTGGGCCTCCAGGCTGGGG + Intergenic
1075898599 10:126019786-126019808 CAGGCAGAGGCTTCTGAGGGGGG + Exonic
1076408557 10:130230259-130230281 CAGGATGGGGCACCTGGCAGGGG + Intergenic
1076562079 10:131373603-131373625 CAGGCAGAGGCTGCTGGAGCTGG - Intergenic
1076602385 10:131667207-131667229 CAGGCTGAGGCTTGTGGGGAGGG + Intergenic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1076900485 10:133335342-133335364 CGGGCGGAGACTCCTGGCGCGGG - Intronic
1077096664 11:801884-801906 CAGGGTGAGGCTCTGGGCAGAGG + Intronic
1077214988 11:1391458-1391480 CAGGCCCAGGCTCTTGGGGGAGG + Intronic
1077219735 11:1410687-1410709 CAGGCGGGGGCTCCTGAGGGTGG - Intronic
1077287342 11:1773425-1773447 GAGGTTGAGGCTCCTGGAAGAGG - Intergenic
1077373257 11:2193512-2193534 TAGGCAGAGGCTCCAGGCAGGGG + Intergenic
1077403469 11:2370213-2370235 GAGGCTGAGGCTCTGGGCTGGGG - Intergenic
1077441219 11:2570123-2570145 CAGGCTAGGGTTCCTGGCGTGGG + Intronic
1077441244 11:2570195-2570217 CAAGCTGGGGTTCCTGGCGTCGG + Intronic
1077441267 11:2570267-2570289 CAAGCTGGGGTTCCTGGCGTCGG + Intronic
1077842025 11:5985873-5985895 CAGTCACAGGCTCCTGGCTGTGG + Exonic
1078406772 11:11077032-11077054 CAGGATGAGGCTGGGGGCGGTGG - Intergenic
1078438894 11:11347896-11347918 CAGGCTGAGGCTGAGGGCTGGGG + Intronic
1078444338 11:11392994-11393016 CATGCTCAGTCTCCTGGAGGGGG + Intronic
1081747907 11:45485904-45485926 CAGGCCCAGGCTGCTGGAGGTGG - Intergenic
1081808547 11:45902797-45902819 CGGGCTGAGCCCCCAGGCGGAGG + Exonic
1083162678 11:60864974-60864996 CAGGCTGAGGGTGCTGGCGAGGG - Intergenic
1083342596 11:61968012-61968034 CACCCTGAGGCTCCTGGCCCGGG + Intergenic
1083847680 11:65345487-65345509 CGGCCTGATGCTCCTGGCTGAGG + Intronic
1084238926 11:67805690-67805712 CAGGATAAGGGTCCTGGAGGCGG + Intergenic
1085297655 11:75440006-75440028 CAGACTGAGGCTCCAGACTGAGG + Intronic
1085353326 11:75814947-75814969 CGGGCAGAGTCTCCTGGTGGAGG - Intergenic
1087063297 11:94003874-94003896 CCAGCCTAGGCTCCTGGCGGTGG + Intergenic
1087327191 11:96738572-96738594 CAGGCAGAGGCTGCTGCTGGTGG + Intergenic
1087437178 11:98136154-98136176 CAGGTTGCGGCTGCTGGCTGGGG - Intergenic
1089005537 11:115087728-115087750 CAGGCTGGGGCTTCTCGGGGAGG + Intergenic
1090136493 11:124204473-124204495 CAGGCTGCAGCTGCTGGGGGTGG + Intergenic
1090354968 11:126134162-126134184 CCGGCTGAGCCTTCTTGCGGAGG + Intergenic
1091978955 12:4850282-4850304 CAGGCTGAGGGTCCGAGAGGGGG + Intronic
1092192947 12:6533687-6533709 CGGGCTGGGGCCCCAGGCGGAGG - Intergenic
1096260165 12:50085391-50085413 CAGTCTGTGGCTCCAAGCGGCGG + Exonic
1096799351 12:54099358-54099380 AAGGCTGAAGCCCCTGGCTGAGG - Intergenic
1096896130 12:54821937-54821959 CAGCCTAAGGATCCTGGAGGTGG - Intergenic
1097354511 12:58586460-58586482 CTGGCTTAGGTTCCTGGCTGTGG - Intronic
1100212997 12:92417486-92417508 CAGTCCTAGGCTCATGGCGGTGG - Intergenic
1101550307 12:105755059-105755081 CAGGCTGAGGCTCGTGGGTGGGG + Intergenic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1102259959 12:111437642-111437664 CAGGCTTGGGGTCCTGGTGGGGG + Intronic
1103438954 12:120948980-120949002 GAGGCTGAGGCAGGTGGCGGAGG - Intergenic
1103715807 12:122944788-122944810 CAAGCTGAGGAGCCTGGGGGTGG - Intronic
1104052718 12:125206937-125206959 CTCGCAGAGGCTCCTGGGGGAGG + Intronic
1104640156 12:130462045-130462067 CAGGCTGTGGCTGCTGGCCGTGG + Intronic
1104720321 12:131041753-131041775 CAGGCAGAGGCGCCAGGCAGGGG - Intronic
1104917738 12:132274493-132274515 CTGGCTGGGGCTCCTGGGGCAGG + Intronic
1105280878 13:18961933-18961955 AAGCCTGAGGCTCTTGGCTGTGG - Intergenic
1105701837 13:22940211-22940233 CAGACTGAGGCACCTGGGGTGGG + Intergenic
1105777346 13:23676197-23676219 CAGGCAGCGGCTCCTGCCTGTGG + Intergenic
1105854463 13:24361996-24362018 CAGACTGAGGCACCTGGGGTGGG + Intergenic
1108149737 13:47521120-47521142 CAGGCTGCCGCTGCTGGCTGGGG + Intergenic
1109620577 13:64900076-64900098 CAGGCTGAGGCACCCTGCAGTGG - Intergenic
1110060676 13:71034220-71034242 CAGGCAGAGGCCCCTGGCTTGGG + Intergenic
1115460101 14:33650798-33650820 TAGGCTGCTGCTCCTGGCAGAGG - Intronic
1118292859 14:64541566-64541588 CATGGTGAGCCACCTGGCGGAGG + Exonic
1119474898 14:74921487-74921509 AAGGCTCAGGCTCCAGGCCGGGG + Exonic
1120375496 14:83700321-83700343 GAGGCTGGGGGTCCTGGGGGTGG + Intergenic
1121013771 14:90536176-90536198 CAGGGTGAGCTTCCTGGAGGAGG - Exonic
1121098414 14:91233708-91233730 CAGGCTGGGGCTGCTGGTCGGGG - Exonic
1121129143 14:91429306-91429328 CAGATTGAGGCTCCTGCTGGAGG - Intergenic
1121564288 14:94896899-94896921 CAGGTTGAGGGTTCTGGTGGGGG - Intergenic
1122217028 14:100211546-100211568 CAGGCTGAGGCACCTGGGGCTGG - Intergenic
1122322737 14:100865469-100865491 CAGGCTGTGGCTGCCGGCAGGGG - Intergenic
1122371564 14:101231825-101231847 CATGCAGAGGCTCATGGAGGAGG - Intergenic
1122388649 14:101365426-101365448 CAGGGTGAGGCGGCTGGTGGGGG + Intergenic
1122947741 14:105020888-105020910 GAGTCTGTGGCTCCTGGCGCTGG - Intronic
1124041923 15:26113465-26113487 CATGCTGAGGCTCCAGGCCAGGG - Intergenic
1125654150 15:41342145-41342167 CAGCCTGAGCCTCCTAGCGTGGG + Intronic
1125795522 15:42401666-42401688 CCGTCTGAAGCTCCTGGAGGAGG + Exonic
1127260604 15:57323956-57323978 CAGGCAGAGTTTCCTGGAGGAGG + Intergenic
1127982567 15:64045809-64045831 CAGGCCGGGGCGCCTGACGGCGG + Intronic
1129389800 15:75214830-75214852 CAGGCTGAGGCTAGGGGCTGTGG - Intergenic
1130546413 15:84859915-84859937 CAGGCTGAGACCCCGGGCCGCGG - Intronic
1132020065 15:98353334-98353356 CAGGCTGGGGCTCTTGGAGTAGG - Intergenic
1132662993 16:1069850-1069872 CTGGCTGACCCTCCTGGCCGTGG - Intergenic
1132751127 16:1458200-1458222 GAGGATGAGGCCCCTGGGGGCGG - Intronic
1133008822 16:2898919-2898941 CAGGCAGAGGCTTCTGGCCCTGG + Intronic
1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG + Exonic
1133055384 16:3143186-3143208 CAGGCTGAGTCCCTTGGAGGAGG + Intergenic
1133269202 16:4602379-4602401 CAGGTTCAGCCTCCTGGTGGGGG - Intergenic
1134467508 16:14492434-14492456 CATGGTGAGGGTCCAGGCGGTGG - Intronic
1135423934 16:22323014-22323036 CCGGCAGAGGCTCCAGGTGGAGG + Intronic
1135957293 16:26966348-26966370 AAGGCTTGGGCTCCAGGCGGAGG + Intergenic
1136408181 16:30061436-30061458 GAGGCTGATGCTCCTGGCACTGG + Intronic
1136616284 16:31400447-31400469 CAGGATGTGGCTGCTGGTGGAGG + Intronic
1138418825 16:56886429-56886451 CAGGCTGAGGTTCCGGGTGAAGG - Exonic
1139424054 16:66868053-66868075 CAGGCTCAGGCCCCGGGTGGTGG - Intronic
1139551077 16:67673425-67673447 CAGGCCGAGGCTCCTGCCACAGG + Intergenic
1139790378 16:69429296-69429318 CAGGTTGATGCTGCTGGCTGGGG + Intronic
1139949987 16:70664001-70664023 CAGGCTGAGCCTCTTTGGGGAGG + Exonic
1141611523 16:85183762-85183784 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1141867367 16:86760066-86760088 CATGCTGAGCCTCCTCTCGGGGG - Intergenic
1142683092 17:1561928-1561950 CAGGCAGGGCCTCCCGGCGGTGG - Intronic
1143536297 17:7542074-7542096 CAGGCTCAGGCCGCTTGCGGTGG + Intergenic
1143759527 17:9090918-9090940 CAGGCTGAGGGTCCCGGTGGAGG - Intronic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1144726212 17:17503964-17503986 CAGGCCGAGCATCCTGGCTGGGG + Intergenic
1144731371 17:17528282-17528304 CTGGCTGCGGCTCCTGGGGCTGG - Intronic
1145295874 17:21592566-21592588 GAAGCTGAGGCCCCTGACGGAGG + Intergenic
1145812159 17:27770975-27770997 CAGGCTGAGCTGCCTGGAGGAGG - Exonic
1146426434 17:32743903-32743925 CAGGCTGAGGCTGGTCGCAGTGG - Intronic
1146842189 17:36163858-36163880 TAGGCTGAGCTTCCTGGAGGAGG - Intergenic
1146866121 17:36336559-36336581 TAGGCTGAGCTTCCTGGAGGAGG + Intronic
1146877756 17:36426790-36426812 TAGGCTGAGCTTCCTGGAGGAGG - Intronic
1147160196 17:38565037-38565059 CACTCAGAGGCTCCTGGGGGAGG - Intronic
1147176153 17:38657454-38657476 CTGGCTGGGGCTCCGGGAGGTGG - Intergenic
1147598428 17:41731661-41731683 GAAGCTGAGGCTGCTGGAGGAGG - Exonic
1147686264 17:42288518-42288540 CCGGCCGGGGTTCCTGGCGGCGG - Exonic
1147739238 17:42660948-42660970 CAGGCTGAGGCTCCTTGGGAAGG - Intronic
1149845346 17:60006301-60006323 CAGGCTGAGCTGCCTGGAGGAGG - Intergenic
1150742132 17:67787783-67787805 GAGGCTGAGGCACGAGGCGGAGG + Intergenic
1152282077 17:79390774-79390796 CAGGGTGGGGATCCTGGCAGTGG + Intronic
1152464409 17:80457810-80457832 GAGGCGGAGGCTCCAGGCAGGGG - Intergenic
1152728581 17:81959391-81959413 CTGGCTGGGGCTCCAGGAGGCGG + Intronic
1152743774 17:82030091-82030113 CAAGCTGAGACTGCTGGCGCAGG + Exonic
1152798445 17:82320161-82320183 AAGGCTGTGGCTCGAGGCGGTGG + Intergenic
1152926178 17:83088788-83088810 AACTCTGAGGCTCCTGGAGGGGG - Intronic
1152930572 17:83107604-83107626 CAGCCTGGGGCTCCTGCTGGGGG + Intergenic
1154334895 18:13457364-13457386 CATGCAGAGGCTCTTGGAGGGGG - Intronic
1156764470 18:40634999-40635021 CAGGTTGAGGCTGCTGGCTGGGG + Intergenic
1158142452 18:54269719-54269741 CAGGCGGACGCTCGGGGCGGCGG + Intronic
1158228595 18:55228394-55228416 AATGCTGAGGCTTCTGGCAGAGG + Intronic
1160364572 18:78313255-78313277 CAGGCCCAGGCTCCTGGGGACGG + Intergenic
1160870230 19:1274599-1274621 CAGGCGCGGGCTCCAGGCGGGGG - Intronic
1161010034 19:1955512-1955534 CAGGGTGAGGCTCCGCGGGGTGG + Intronic
1161038488 19:2097973-2097995 CAGGCTGAGGGGCGTGCCGGTGG + Intronic
1161828544 19:6586176-6586198 CAGGCTGATGCTACGGGAGGCGG + Exonic
1162314853 19:9932552-9932574 CAGGGTGAGCCTCTTGGAGGAGG + Intronic
1162874405 19:13610141-13610163 CAGGCGCAGGCACCTGGCTGGGG - Intronic
1162992469 19:14312478-14312500 CCGGCTGCGGCTCCTGTCCGAGG - Intergenic
1163035446 19:14566622-14566644 CAGGCTGTGGGTGTTGGCGGGGG + Intronic
1163596940 19:18225901-18225923 CAGGCTGTGCGTCCTGGCAGTGG - Intronic
1163737993 19:18993431-18993453 CAGGCTGAGGTGCCTTTCGGGGG + Exonic
1164605343 19:29593926-29593948 CAGGCTCAGCCTCCTGCCGCTGG + Intergenic
1164648218 19:29874094-29874116 CTGGCTGCGGGTCCTGGAGGGGG + Intergenic
1164772111 19:30817261-30817283 CAAGCAGAGGCTCCTGGCCAGGG + Intergenic
1164990096 19:32676659-32676681 CAGCCTGCGGCTCGAGGCGGAGG + Exonic
1165443727 19:35845468-35845490 CAGAAGGACGCTCCTGGCGGCGG + Exonic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166108340 19:40608497-40608519 CAGGCCGGGGCTCCAGGCGATGG - Exonic
1166380390 19:42352493-42352515 CAGGCTGGGGCACATGGAGGTGG + Intronic
1166651870 19:44581004-44581026 CAGGATGAGACTTCTGGCTGAGG - Intergenic
1166906712 19:46115564-46115586 CAGGCTGAGGTTTCTGGGGTTGG - Intergenic
1167037904 19:47005141-47005163 CAGGCTTAGGCGCCCGGGGGGGG + Intergenic
1167240290 19:48339315-48339337 CAGGCTCAGCCTCCCGGCTGGGG - Intronic
1168121119 19:54253165-54253187 CAGGCTGAGGAGCCTGGGGCAGG - Intronic
1168354143 19:55691671-55691693 CAAGCTGGGGCCCGTGGCGGGGG - Intronic
925011514 2:488940-488962 CAGCATGAGGGTCCTGGCTGAGG - Intergenic
926121460 2:10243370-10243392 CAGGCTGCGACTCCTGGCCCGGG - Intergenic
926196091 2:10764495-10764517 CAGGCTGAGGCTGTTGGCAGGGG - Intronic
926350502 2:11989725-11989747 CAGGCTGAGGCACATGGTGTGGG - Intergenic
927487064 2:23495740-23495762 CAGGCTCCGGCTCATGGCTGTGG + Intronic
927520850 2:23697149-23697171 CAGGCTGGGACTCCCAGCGGAGG - Intronic
927642264 2:24852704-24852726 CGGGCAGCGGCTCCTGGCCGTGG - Intronic
927920778 2:26970716-26970738 GAGGCTGCGGCTCCGGCCGGCGG - Exonic
927947998 2:27148935-27148957 CAGGCGGAGGCTTTTCGCGGGGG + Intergenic
929537306 2:42791878-42791900 CAGGCAGAGGCTACTGGCAGAGG + Intronic
930780816 2:55223706-55223728 CCTGCCGAGGCTCCTGGGGGCGG - Intronic
931711037 2:64989249-64989271 CCGGCGGCGGCTCCCGGCGGCGG + Intronic
932329488 2:70889602-70889624 CTGGCTCTGGCTCCTAGCGGCGG - Intergenic
932499944 2:72174404-72174426 CAGGGGGAGGCTCCTGGAGAAGG + Intergenic
932619516 2:73257510-73257532 TAGGCTGCTGGTCCTGGCGGGGG - Exonic
934766854 2:96884548-96884570 CAGACTGAGGCTCTTGGCCTGGG - Intronic
935735954 2:106106771-106106793 CAGGCTGAGGGAGCTGGCAGTGG - Intronic
935819655 2:106882183-106882205 CAGGCTGAGCCTGCTGGATGGGG - Intronic
936909435 2:117575175-117575197 CAGGCTGTGGCTTCAGACGGTGG - Intergenic
937153373 2:119701333-119701355 CAGGCTAAGGTTCCTGGGGCTGG + Intergenic
937398751 2:121563002-121563024 TTGGCTGAGGCTCCTGGGGTTGG + Intronic
941095633 2:161237715-161237737 GAGGCTGAGGCTGCTGCCAGCGG + Intergenic
941552071 2:166929060-166929082 GAGGCTGAGGCTGCTGGTTGGGG - Intronic
942451504 2:176110920-176110942 AAGGCTGAGAATTCTGGCGGGGG + Intronic
945997183 2:216447567-216447589 GAGGCTGAGGCCCCAGGCAGAGG + Intronic
946157787 2:217818282-217818304 CAGGCTGGGGCTCCCCGGGGTGG + Exonic
946336508 2:219040861-219040883 GAGGCTGAGGCTCCGGGAGATGG - Intronic
946370643 2:219279494-219279516 GAGGCCGGGACTCCTGGCGGAGG + Exonic
946416398 2:219542137-219542159 CAGGCAGAGGCTGCTGGTGGCGG - Exonic
947156231 2:227164774-227164796 CCTGCTGGTGCTCCTGGCGGCGG + Exonic
948408240 2:237739197-237739219 CTGGCTGCGTGTCCTGGCGGTGG + Intronic
948764473 2:240212419-240212441 CTGGCTGAGGCTCCAGGCCCTGG - Intergenic
948777867 2:240299239-240299261 CAGGCTGAGGAGCCCGGAGGAGG - Intergenic
948908535 2:240991562-240991584 CAGGCTGAGTCTCCAGGGGTGGG - Intronic
1173799128 20:45883801-45883823 CGGGCTGGAGCACCTGGCGGCGG - Exonic
1175402292 20:58707511-58707533 CAGGCAGAAGCTCATGGCAGGGG + Intronic
1175972753 20:62695136-62695158 CAGGCTGAGGCACCTTGGGTGGG + Intergenic
1176180590 20:63747613-63747635 CAGGCAGAGACTCCTGGTGGGGG + Intronic
1176676854 21:9786746-9786768 CCAGCTGCGGCTCCTGGCTGAGG - Intergenic
1179491061 21:41741854-41741876 CAGCCTGCTGCACCTGGCGGTGG - Exonic
1179645008 21:42770371-42770393 CCGGCTGAGGGTCCTGGGAGTGG - Intronic
1179802162 21:43816256-43816278 GTGGCTGAGGGTCCTGGAGGCGG - Intergenic
1179981757 21:44899559-44899581 CCGTCTGTGGCTCCCGGCGGAGG + Intronic
1180231654 21:46430101-46430123 CGTGCAGAAGCTCCTGGCGGCGG + Exonic
1180955565 22:19739753-19739775 AAGGCAGGGGCCCCTGGCGGGGG + Intergenic
1181538788 22:23562018-23562040 CAGGCTGAGGGCCCTGGCACAGG - Intergenic
1182509763 22:30810548-30810570 CCGGCTGAAGCTCATGGCCGTGG - Intronic
1182557297 22:31136144-31136166 GAGGCTGAGGCTTCTGGCTCAGG - Intronic
1182805974 22:33070709-33070731 ACAGCTGAGGCTTCTGGCGGAGG + Intergenic
1183942999 22:41306893-41306915 CAGGCTGAGCCTCCAGCCTGGGG - Intronic
1184033498 22:41908110-41908132 CAGGCTGAGGCTGTGGGCAGTGG - Intergenic
1184089558 22:42285090-42285112 CAGCCTGAGGCCCCTGGCCCAGG + Intronic
1184711075 22:46249934-46249956 CCTGCCGAGGCTCCTGGGGGCGG + Intronic
1184834890 22:47015237-47015259 CAGGATGCGGTTCCTGGCGCAGG + Intronic
1185200426 22:49499577-49499599 CAGGTTGGGGCTGCTGGGGGAGG - Intronic
954745965 3:52787754-52787776 CAGCCTGAGGTCCCTGGGGGAGG + Intronic
957096908 3:75785358-75785380 CAGGCCGCGGACCCTGGCGGGGG - Intronic
958503051 3:94938287-94938309 CCGGCTGAGGCTCCTAGCCCTGG - Intergenic
961745071 3:129059467-129059489 CAGGCTGAGGCTCCTCTCCATGG + Intergenic
961747774 3:129076333-129076355 GAGGCTGAGGCACGAGGCGGAGG + Intergenic
961956895 3:130814107-130814129 CAGGTTGCGGCTGCTGGCTGGGG + Intergenic
962753420 3:138451082-138451104 GAGACTGAGACTCCTGGAGGGGG + Intronic
963275979 3:143330068-143330090 CTGGCTTAGACTCCTGGTGGAGG + Intronic
967055451 3:185825469-185825491 CGGGCTGGGGCTCCGGGCGCCGG + Intergenic
968462569 4:732664-732686 CAGGCTGGGCCTCTTGGTGGCGG + Intronic
968483606 4:848378-848400 GAGGCTCAGGCCCCTGACGGAGG + Intergenic
968651084 4:1760610-1760632 CAGGCGGAGGATCCGGGCAGGGG - Intergenic
969057925 4:4413698-4413720 CAGGCACAGGCCCCTGGAGGAGG + Intronic
972890314 4:43549877-43549899 AAGGCAGAGTCTCCTGGTGGTGG - Intergenic
973360646 4:49161484-49161506 CGGGCTGCGGACCCTGGCGGGGG + Intergenic
977177453 4:93834618-93834640 CTGGCAGAGGCTCCTGGCCGCGG + Intergenic
981718458 4:147775347-147775369 TAGGCTGAGGCTAATGGAGGTGG + Intronic
983628472 4:169826514-169826536 CAGGCAGAGCCTCCTGGCTTAGG + Intergenic
985398685 4:189572037-189572059 CCAGCTGCGGCTCCTGGCTGAGG + Intergenic
985480869 5:109472-109494 CAGGGTGTGGCACCTGGGGGTGG - Intergenic
985931776 5:3064085-3064107 CAGGCTCAGCCTCCTGGTGGAGG - Intergenic
992528096 5:77630645-77630667 CAGGCTGTCGCCCATGGCGGCGG + Exonic
995480155 5:112585233-112585255 CAGGTTGAGGTTGCTGGGGGAGG + Intergenic
996185257 5:120465566-120465588 CAGGCGGCGGCTCCGGGCGGGGG + Intronic
1000026131 5:157360718-157360740 GAGACTGAGGCTCCAGGCAGTGG + Intronic
1001017672 5:168156128-168156150 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1001406717 5:171482060-171482082 CTGGCTGGGACTCCTGGCTGGGG - Intergenic
1001673886 5:173496685-173496707 TAGGATGAGCCTCCTGGTGGAGG + Intergenic
1002066568 5:176654837-176654859 CAGGGTGAGGCTCCTGGGATGGG + Intronic
1002106019 5:176879753-176879775 CAGGTTGAGGATCATGGCTGTGG - Exonic
1002309984 5:178308585-178308607 CAGGCCCATGCTCCTGGCCGAGG + Intronic
1002571304 5:180140728-180140750 CAGGCTGGAGCTCCTGCTGGAGG - Intronic
1005136022 6:22570290-22570312 CATGCCGAGGCACCGGGCGGCGG + Exonic
1005268975 6:24142860-24142882 CAGGTTGCGGCTACTGGCGCGGG + Intronic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006100663 6:31684187-31684209 TAGGCTGAGGCCCCTGGATGGGG + Intergenic
1006131877 6:31874585-31874607 CAGGCTGAGCCCCATGGTGGTGG - Intronic
1006341158 6:33447840-33447862 CAGGCTGATGCTGGTGGAGGAGG + Exonic
1006393342 6:33771708-33771730 CCGGCCGCGGCTCTTGGCGGCGG - Exonic
1007178911 6:39914595-39914617 CAGGCTGGGGGTGCTGGAGGGGG - Intronic
1007421846 6:41724414-41724436 CAGGCCGTGGCTCCTGGAGAAGG + Intronic
1013977063 6:116091356-116091378 CAGGCTGCCGCTGCTGGCTGGGG - Intergenic
1014590665 6:123263739-123263761 CAGGCTGAGTCTCTTGTTGGAGG + Intronic
1014940136 6:127428552-127428574 CAGGTTGAGGCTGCTGGCCCCGG + Intergenic
1015138579 6:129902973-129902995 CAGACAGAGGCACCTGGGGGAGG - Intergenic
1016521710 6:144953893-144953915 AATGCTGAGGCTGCTGGCAGAGG - Intergenic
1017948798 6:159118249-159118271 CAGGCAGAGACTCCTGGAGAAGG - Intergenic
1018091507 6:160349558-160349580 CAGGCGGAGGCTGCTGCCGGCGG + Intronic
1018736109 6:166688331-166688353 GAGGTTGAGGACCCTGGCGGGGG - Intronic
1018796052 6:167186400-167186422 CAAGCTCAGGCTCCTCGCTGGGG - Intronic
1018804433 6:167248054-167248076 CAGGATGTGGCTCCTCGTGGAGG + Intergenic
1018820267 6:167368664-167368686 CAAGCTCAGGCTCCTCGCTGGGG + Intronic
1018976350 6:168570362-168570384 CAGGCTGAGGCCCACCGCGGGGG + Intronic
1019612991 7:1946238-1946260 CAGTGTGAGGCTCCAGGCGTGGG + Intronic
1019714312 7:2531308-2531330 CAGGCTGCGGCTCCAGGCAGAGG - Intergenic
1019738713 7:2662560-2662582 CAGGCTGGGGCTGCGGGCTGAGG + Exonic
1019742010 7:2679764-2679786 CAGGCTGCTGCTCCAGGCAGAGG + Intronic
1019998010 7:4737650-4737672 CTGGCTGAGGGTCCAGGCAGGGG - Intronic
1022795400 7:33727720-33727742 CATGCTCCTGCTCCTGGCGGAGG + Exonic
1024006662 7:45229338-45229360 CAGGCAGAGGCTGCTGCTGGCGG - Intergenic
1027052165 7:75027406-75027428 CAGGGTGAGGCTGCTGGCGAGGG - Intronic
1027134944 7:75617502-75617524 CAGGCTGAGGCTGGGCGCGGTGG - Intronic
1027374513 7:77537118-77537140 GCGGCTGCGGCTGCTGGCGGGGG + Intergenic
1030009329 7:105150430-105150452 GAGGCTGAGGCACAAGGCGGAGG + Intronic
1031895970 7:127347977-127347999 CAGGCAGCGGCTCCCGGGGGCGG + Intronic
1031923663 7:127619362-127619384 CAGTCTGAGGATGCTGGAGGAGG - Intergenic
1032198823 7:129805064-129805086 GTGGCAGAGGCTCCTGGGGGTGG + Intergenic
1033742137 7:144283884-144283906 CAGGCTGTGGCTCCTAGTGAGGG - Intergenic
1033751765 7:144365730-144365752 CAGGCTGTGGCTCCTAGTGAGGG + Exonic
1034210557 7:149358838-149358860 CAGGCTGAGTCACCTATCGGTGG - Intergenic
1034489864 7:151387423-151387445 CAGGCTGAGGACCCTGGGGCTGG - Intronic
1035268152 7:157703641-157703663 CAGGCAGAGGCACCTGCAGGAGG + Intronic
1037297197 8:17413512-17413534 CAGGCAGAGGCGCGTCGCGGCGG - Intronic
1038205141 8:25458443-25458465 CAGGCTGAGGAGCCTAGGGGCGG - Exonic
1039496700 8:37985908-37985930 CAGGCTGAGCCACCTGGCCCAGG + Intergenic
1039565887 8:38552431-38552453 CAGGCTGGGGCTCTTTGCAGTGG + Intergenic
1039889439 8:41674122-41674144 GAGGCTGAGGCCCCGAGCGGAGG - Intronic
1041705977 8:60846810-60846832 CTGGCTGAGGGTCCTTGAGGAGG - Intronic
1042963803 8:74329886-74329908 CAGGCTGAGGCTCTGTGGGGAGG - Intronic
1043836345 8:85051552-85051574 CACACTGAGTCTCCGGGCGGTGG - Intergenic
1044836143 8:96297541-96297563 GAGGCTGAGGCTGCAGGCAGGGG - Intronic
1048455365 8:134573446-134573468 CAGGCTGATGTTGCTGGTGGAGG + Intronic
1049096477 8:140551268-140551290 CAGGCAGAGGCTCCGGCCTGGGG - Intronic
1049288733 8:141790658-141790680 CAGGCTGAGGGGCCAGGCTGAGG + Intergenic
1049439673 8:142603543-142603565 GAGGCTGAGGCTGATGCCGGAGG - Intergenic
1049573125 8:143378787-143378809 GAGCCCGAGGCTCCTGGCAGGGG - Exonic
1049988429 9:972174-972196 CAGGCCGAGGCGCCCTGCGGAGG - Intergenic
1051658985 9:19408797-19408819 CAGGGTGGGGCGCCTGGAGGCGG - Intergenic
1055843298 9:80531583-80531605 CAGGCTGTGGCTTCAGACGGTGG - Intergenic
1057180654 9:93028140-93028162 CAGGCTGAGGTTTCTGGAGCTGG - Intronic
1058874269 9:109229527-109229549 CAAGTTGGGGTTCCTGGCGGCGG + Intronic
1059284460 9:113160763-113160785 ATGGCTGAGGCTCCTGGATGGGG - Intronic
1060409498 9:123390734-123390756 GAGGGTGAGGCCCCTGGGGGTGG - Intronic
1060919208 9:127408818-127408840 CAGTCTGAAGCTCCAGTCGGTGG - Intergenic
1061027187 9:128057347-128057369 CAGCCACAGCCTCCTGGCGGTGG + Intergenic
1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG + Intronic
1061243375 9:129387257-129387279 CAGGCTGAGGGCCCTGGCACAGG + Intergenic
1061313166 9:129777220-129777242 CAGGCAGAGGCGCCTGGGGACGG - Intergenic
1061434439 9:130552166-130552188 CAGGCTGAGGATCCCTGTGGGGG + Intergenic
1061550914 9:131334202-131334224 TCAGCTGAGGCTGCTGGCGGGGG + Intergenic
1061883411 9:133579037-133579059 GATGCTGCGGCTCCTGGCGAAGG + Exonic
1061954616 9:133955317-133955339 CAAGGCGAGGCTCCTGGCTGCGG + Intronic
1061961277 9:133990541-133990563 CAGGCTGGGGCTCAGGGCAGAGG - Intronic
1062016365 9:134293217-134293239 CAGGCTGGGGCTCCTGGAGGGGG + Intergenic
1062158806 9:135068563-135068585 CTGGAGGAGGCACCTGGCGGGGG + Intergenic
1062571840 9:137189340-137189362 CCGGCTGGGGCTCCCGGCTGTGG + Intronic
1062586202 9:137251089-137251111 CAGGCTGGGGGTCCTGGCCCAGG + Intergenic
1185501573 X:600496-600518 CAGCCTCAGGCTCCTTGGGGCGG - Intergenic
1190332306 X:49243324-49243346 CAGGCTGAGGCACCTGGGTAGGG - Exonic
1190904276 X:54710661-54710683 CAGGGTGAGGCTGCTTGCAGTGG - Intergenic
1191830164 X:65407433-65407455 GCGGCGGAGGCTCCTGGCCGGGG - Intronic
1200115274 X:153767287-153767309 CAGGCTGAGGACCCTGGTGACGG + Exonic
1201456030 Y:14167601-14167623 CAGGCTGCGGCTGCTGGCTGGGG - Intergenic