ID: 1166079269

View in Genome Browser
Species Human (GRCh38)
Location 19:40433816-40433838
Sequence CAGAAAATGGAGACGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166079259_1166079269 30 Left 1166079259 19:40433763-40433785 CCAGGGTGGTCCTAGAGAGAGAT No data
Right 1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG No data
1166079261_1166079269 20 Left 1166079261 19:40433773-40433795 CCTAGAGAGAGATTCTTCGAGGC No data
Right 1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166079269 Original CRISPR CAGAAAATGGAGACGGAGCC AGG Intergenic
No off target data available for this crispr