ID: 1166084436

View in Genome Browser
Species Human (GRCh38)
Location 19:40465714-40465736
Sequence CCGCGCGTGCCGAGACTCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166084436_1166084442 -1 Left 1166084436 19:40465714-40465736 CCTCAGAGTCTCGGCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1166084442 19:40465736-40465758 GGAACCCACTGGCTGCTGGGCGG 0: 1
1: 0
2: 8
3: 44
4: 319
1166084436_1166084445 24 Left 1166084436 19:40465714-40465736 CCTCAGAGTCTCGGCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1166084445 19:40465761-40465783 CTCTCTGCCCTACTCAAGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 229
1166084436_1166084440 -5 Left 1166084436 19:40465714-40465736 CCTCAGAGTCTCGGCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1166084440 19:40465732-40465754 CGCGGGAACCCACTGGCTGCTGG 0: 1
1: 0
2: 1
3: 5
4: 108
1166084436_1166084441 -4 Left 1166084436 19:40465714-40465736 CCTCAGAGTCTCGGCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1166084441 19:40465733-40465755 GCGGGAACCCACTGGCTGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166084436 Original CRISPR CCGCGCGTGCCGAGACTCTG AGG (reversed) Exonic
908496632 1:64701008-64701030 CAGCGAGTGCAAAGACTCTGAGG - Intergenic
909475351 1:76075192-76075214 CCGCGGGTCCCGCGGCTCTGTGG + Intronic
920700299 1:208213044-208213066 ACGCCTGTGCCCAGACTCTGTGG - Intronic
1067039579 10:42942024-42942046 CTGCGACTGCCCAGACTCTGAGG + Intergenic
1074295414 10:112183411-112183433 CCGCGCGTGCAGATACTTAGGGG + Intronic
1075273668 10:121075113-121075135 CCGCGAGTGCAAAGACCCTGAGG + Intergenic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1117097649 14:52314455-52314477 CGGAGCGTTCCGAGACTCAGAGG - Exonic
1121244576 14:92452558-92452580 CGGTGGGTGCCGAGAGTCTGGGG - Intronic
1129741899 15:77993374-77993396 CCGCGCCTGCCGAGGTGCTGTGG - Intronic
1130224546 15:82046940-82046962 GCGCCCGGGCCGAGACCCTGCGG + Intergenic
1144778068 17:17794886-17794908 CAGCGCCTGCCTGGACTCTGTGG + Exonic
1146172318 17:30643592-30643614 CAGCGGGTGCCAAGACTCTGGGG + Intergenic
1146345771 17:32059613-32059635 CAGCGGGTGCCAAGACTCTGGGG + Intergenic
1152269486 17:79315737-79315759 CCGCCCGTGCCGCCACCCTGGGG + Intronic
1152798715 17:82321463-82321485 CCGCACCTGCCGAGCCTCTTTGG - Exonic
1162990109 19:14296453-14296475 CAGCGGGTGCCAAGACTCTGGGG - Intergenic
1166084436 19:40465714-40465736 CCGCGCGTGCCGAGACTCTGAGG - Exonic
1167449148 19:49556844-49556866 CCGTGCGTGCCGGGGCGCTGTGG + Intronic
1167792202 19:51689572-51689594 CCGCGGGAGCCGTGAGTCTGCGG + Intergenic
927482310 2:23464262-23464284 CCGGGCTTGCAGAGACCCTGGGG - Intronic
928186659 2:29116006-29116028 CTGCGCGTGCGGGGACTCTCGGG - Intronic
933657299 2:84899546-84899568 CCGCCCTTGCCTAGACCCTGCGG - Intronic
948702437 2:239768711-239768733 CCGCACGTGCCCCGGCTCTGAGG + Intronic
1172095425 20:32457822-32457844 CAGCGCGGGCCGGGACTCCGAGG - Intronic
1182688254 22:32137268-32137290 CCGTGGCTGCTGAGACTCTGGGG - Intergenic
1184726817 22:46351902-46351924 CCCCGCGGGCCGAGACAATGAGG + Intronic
950029417 3:9842414-9842436 CAGCAAGTGCCGAGGCTCTGAGG - Intronic
985762819 5:1759948-1759970 CCTCGGGTGCCGAGAGTCTCAGG + Intergenic
1035546303 8:484428-484450 CCTTTCCTGCCGAGACTCTGGGG + Intergenic
1035677626 8:1466418-1466440 CCACGCGTGCAGTGACCCTGTGG + Intergenic
1048428308 8:134343063-134343085 CCTCCCGTGCTGAGTCTCTGAGG - Intergenic
1197657370 X:129131761-129131783 CAGCTAGTGCCAAGACTCTGAGG + Intergenic