ID: 1166087026

View in Genome Browser
Species Human (GRCh38)
Location 19:40483131-40483153
Sequence GTGAAAACTGGGGTCCCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166087019_1166087026 10 Left 1166087019 19:40483098-40483120 CCAAATCTAGTCCAAATCCCTCT No data
Right 1166087026 19:40483131-40483153 GTGAAAACTGGGGTCCCGAGAGG No data
1166087018_1166087026 23 Left 1166087018 19:40483085-40483107 CCACTGAAGAAAGCCAAATCTAG No data
Right 1166087026 19:40483131-40483153 GTGAAAACTGGGGTCCCGAGAGG No data
1166087021_1166087026 -7 Left 1166087021 19:40483115-40483137 CCCTCTTTTTGCGAATGTGAAAA No data
Right 1166087026 19:40483131-40483153 GTGAAAACTGGGGTCCCGAGAGG No data
1166087022_1166087026 -8 Left 1166087022 19:40483116-40483138 CCTCTTTTTGCGAATGTGAAAAC No data
Right 1166087026 19:40483131-40483153 GTGAAAACTGGGGTCCCGAGAGG No data
1166087017_1166087026 30 Left 1166087017 19:40483078-40483100 CCAGAATCCACTGAAGAAAGCCA No data
Right 1166087026 19:40483131-40483153 GTGAAAACTGGGGTCCCGAGAGG No data
1166087020_1166087026 -1 Left 1166087020 19:40483109-40483131 CCAAATCCCTCTTTTTGCGAATG No data
Right 1166087026 19:40483131-40483153 GTGAAAACTGGGGTCCCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166087026 Original CRISPR GTGAAAACTGGGGTCCCGAG AGG Intronic