ID: 1166090049

View in Genome Browser
Species Human (GRCh38)
Location 19:40502957-40502979
Sequence CAGGGTAAAGGGACGGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 893
Summary {0: 1, 1: 0, 2: 3, 3: 95, 4: 794}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166090038_1166090049 5 Left 1166090038 19:40502929-40502951 CCCAGGTACAAGGTGTAGGGCTT 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG 0: 1
1: 0
2: 3
3: 95
4: 794
1166090039_1166090049 4 Left 1166090039 19:40502930-40502952 CCAGGTACAAGGTGTAGGGCTTG 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG 0: 1
1: 0
2: 3
3: 95
4: 794
1166090034_1166090049 19 Left 1166090034 19:40502915-40502937 CCAGCGTCTGGTCTCCCAGGTAC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG 0: 1
1: 0
2: 3
3: 95
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166090049 Original CRISPR CAGGGTAAAGGGACGGAGGG CGG Intronic
900124113 1:1062051-1062073 CGGGGACAAGGGAGGGAGGGAGG - Intergenic
900681761 1:3920390-3920412 GAGGGAAGAGGGAGGGAGGGAGG - Intergenic
900860196 1:5223398-5223420 CAGGACACAGGGAGGGAGGGAGG + Intergenic
901190095 1:7404629-7404651 CAGGGTGAGGGGACGGACGTGGG - Intronic
901938554 1:12644880-12644902 AAGGGGGAAGGAACGGAGGGAGG - Intronic
902170142 1:14603721-14603743 GAGGGTAAAGGGATGGAGAGAGG - Intronic
902208995 1:14891305-14891327 CAGGGTAAAGGGTGGGAAGGGGG - Intronic
902228895 1:15014838-15014860 CAGGGTGAGGGCACGGAAGGCGG - Intronic
903229686 1:21914247-21914269 CAGGGTGAGGGGACGGGGAGTGG + Intronic
903265729 1:22156899-22156921 AAGGAGAAAGGGAGGGAGGGAGG - Intergenic
903336097 1:22625793-22625815 CAAGGTAAAGGGAGGAGGGGAGG + Intergenic
903435158 1:23343985-23344007 CGGGCTAAAGGGGCGGGGGGAGG + Intronic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904431733 1:30468753-30468775 CAGGGGAAGGGGAGAGAGGGTGG - Intergenic
904512114 1:31020055-31020077 AAAGGGAAAGGGAAGGAGGGAGG - Intronic
904713260 1:32447765-32447787 TAGGGGAAGGGGAAGGAGGGGGG - Intergenic
904989262 1:34578389-34578411 CAGAGTAAAGGGACAAAGGGTGG - Intergenic
905872622 1:41413688-41413710 CAAGGAAGAGGGATGGAGGGAGG + Intergenic
905896306 1:41547975-41547997 CAGGGTCAAAGGTCGGAGGCTGG - Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
905989070 1:42316867-42316889 CAGGGGAAAGGGTGGGAGTGGGG + Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
906562652 1:46770507-46770529 CAGGGGAAAAGGGTGGAGGGTGG - Intronic
906805711 1:48777024-48777046 CGCGGAAAAGGGAGGGAGGGGGG + Intronic
907765645 1:57408097-57408119 CAGGCTACAGGGACTGAGAGAGG + Intronic
907913986 1:58852324-58852346 CACAGAAAAGGGAGGGAGGGAGG + Intergenic
907960134 1:59271473-59271495 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
908916734 1:69136248-69136270 GAGGAGAAAGGGAAGGAGGGAGG + Intergenic
909790687 1:79674293-79674315 TAGGGGAAAGGGTGGGAGGGGGG - Intergenic
910357173 1:86372961-86372983 TAGGGAGAAGGGAGGGAGGGAGG + Intronic
910363249 1:86436364-86436386 AAGGGAAAAGGGAGGTAGGGAGG - Intronic
911089048 1:94002792-94002814 CAGGGAAAAGTAACGCAGGGAGG - Intronic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
912904497 1:113689610-113689632 CAGGGAGAAGGGATGCAGGGAGG + Intergenic
913044143 1:115059123-115059145 CAGGGGAAAGGGTAGGAGTGAGG + Intronic
913403067 1:118457313-118457335 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
913683464 1:121209023-121209045 CAGGGAAAAGGGGCTGAGGGAGG - Intronic
913954924 1:143280877-143280899 AAGGGGAAAGGAAGGGAGGGAGG - Intergenic
914035305 1:143996647-143996669 CAGGGAAAAGGGGCTGAGGGAGG - Intergenic
914154148 1:145071323-145071345 CAGGGAAAAGGGGCTGAGGGAGG + Intronic
915004423 1:152623298-152623320 CAGGGGAGAGGGCCGGAGGAAGG - Intergenic
915213223 1:154325130-154325152 GAGGGTGAAGGAACGGAGGGCGG + Exonic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
915977122 1:160398901-160398923 AAGGGTTAAGGGAAGTAGGGAGG - Intergenic
917079726 1:171245132-171245154 TAGGGGAAAGGGCAGGAGGGAGG + Intergenic
917410816 1:174758440-174758462 AAGGGGAAAGGGTGGGAGGGCGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918330021 1:183449968-183449990 CAGGGTAAAGGGATAGGGGCTGG - Intergenic
918660465 1:187081781-187081803 GAAGGAAAAGGGAGGGAGGGAGG - Intergenic
919243650 1:194948802-194948824 CAGGGGAAAGGGTTGAAGGGGGG + Intergenic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919846794 1:201647853-201647875 CAGGTAAAAGAGACGGAGGGAGG - Intronic
919867441 1:201793038-201793060 CAAGGTAAAGGGAATGAGGCCGG - Intronic
920278211 1:204824290-204824312 CAGCATTAAGGGAAGGAGGGAGG - Intergenic
920340891 1:205274493-205274515 GAGGAAAAAGGGAGGGAGGGTGG + Intergenic
920470772 1:206227532-206227554 CAGGGAAAAGGGGCTGAGGGAGG - Intronic
921236648 1:213138501-213138523 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
921370705 1:214419938-214419960 GAGGATAGAGGGATGGAGGGAGG - Intronic
921755029 1:218845503-218845525 CAGGGAATAGGGAAGGAGGTAGG + Intergenic
922171463 1:223159184-223159206 GAGGGGCAAGGGAAGGAGGGAGG + Intergenic
922420793 1:225460105-225460127 CGGGGTAAAGGCAAGGCGGGTGG + Intergenic
922481277 1:225941275-225941297 AAGGGAAGAGGGAGGGAGGGAGG + Exonic
923008025 1:230067451-230067473 CAGGGGACAGGGGCGCAGGGTGG - Intronic
923063045 1:230494685-230494707 AAGGAAAAAGGGAGGGAGGGAGG + Intergenic
923250952 1:232179260-232179282 AAGAGAAAAGGGAGGGAGGGAGG + Intergenic
923263886 1:232293982-232294004 TAGGGGAAAGGCAGGGAGGGGGG - Intergenic
923433936 1:233950602-233950624 AAGGGTGGAGGGATGGAGGGAGG - Intronic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923569584 1:235101642-235101664 AAGGGGAGAGGGAGGGAGGGAGG + Intergenic
923621971 1:235587074-235587096 CAGGGCAAAGGGAGGAGGGGAGG + Intronic
924419236 1:243891921-243891943 CAGGCTAAATGGACTGAGAGTGG + Intergenic
924494697 1:244575738-244575760 TAGGGGAAAGGGAAGGAGAGGGG - Intronic
1063842282 10:10085981-10086003 CGGGGAAAAGGGCAGGAGGGAGG - Intergenic
1063944747 10:11165673-11165695 CAGAGTAAAGGTACAGAGCGCGG + Exonic
1064463821 10:15559821-15559843 CAGGGTAGGGGGGCGGGGGGAGG + Intronic
1065063047 10:21927954-21927976 CAGAGTAAAGGAAGGGAAGGAGG + Intronic
1065310331 10:24409740-24409762 CAGGGGAAAGGGTGGGAGAGGGG - Intronic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1066706329 10:38183042-38183064 CAGGGAAAAGGGTGGGAAGGGGG - Intergenic
1067728938 10:48794967-48794989 CAGGGATTAGGGATGGAGGGAGG + Intronic
1068206102 10:53856121-53856143 CAGGGGAAAGGGTGGGATGGAGG + Intronic
1069457125 10:68561691-68561713 CGGGGGAGAGGGAGGGAGGGAGG - Intronic
1069604578 10:69731486-69731508 CAGGATGGAGGGAGGGAGGGAGG - Intergenic
1069900994 10:71706662-71706684 CAGGGCACAGGGACAGCGGGAGG + Intronic
1070509468 10:77147426-77147448 CAGGGGGAAGGGAAGGAGGGAGG - Intronic
1070707028 10:78647193-78647215 CAGGGGTAAGGGACAGAGTGGGG + Intergenic
1071418981 10:85470065-85470087 CAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1071555005 10:86594696-86594718 CAGGGAAAAGGGGCAGAGGGAGG + Intergenic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1073061932 10:100738371-100738393 TAGGGCAAAGGGAGAGAGGGAGG + Intronic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074002440 10:109386725-109386747 GAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1074829452 10:117238674-117238696 AAGGGGAAAGGGAGGGAGGGGGG - Intergenic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076181509 10:128412587-128412609 CAGGGAAAAGCCAGGGAGGGTGG - Intergenic
1076315070 10:129534145-129534167 CACAGCAAAGGGACAGAGGGTGG + Intronic
1076361671 10:129894053-129894075 CAGGTTAATAGGAAGGAGGGGGG - Intronic
1077463542 11:2722790-2722812 TGGGGTAGAGGGAAGGAGGGAGG - Intronic
1077664836 11:4098398-4098420 AAGGAGGAAGGGACGGAGGGAGG - Intronic
1077975795 11:7247247-7247269 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079514288 11:21248655-21248677 CAGGGTAAAAGAACGCTGGGTGG - Intronic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079939499 11:26660741-26660763 CAGTGTAATGGGAAAGAGGGTGG + Exonic
1080169323 11:29280513-29280535 CAGGGAAAAGGGACTGAGGCTGG + Intergenic
1080884231 11:36350686-36350708 CGGGGGAAAGGGTGGGAGGGTGG - Intronic
1081149426 11:39608466-39608488 CAGGGTAAAGGTTGGGTGGGTGG + Intergenic
1081394531 11:42569873-42569895 AAGGGTAAAGGGATGGAGAGTGG - Intergenic
1081489488 11:43556550-43556572 GAGGGTAGAGGGAGGGAGGGAGG - Intronic
1081539493 11:44020774-44020796 CAGGGGAAATGGTGGGAGGGGGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081846765 11:46246364-46246386 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
1083515778 11:63257458-63257480 AAGGGAGAAGGGAGGGAGGGAGG - Intronic
1083613029 11:64013436-64013458 CAGGGCAAAGGCCCGGAGGCAGG + Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083840380 11:65301145-65301167 CAAGGCAAAGAGAGGGAGGGAGG + Intronic
1084006568 11:66326429-66326451 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084295436 11:68210753-68210775 CAGGGTGATGGAGCGGAGGGAGG + Intronic
1084344868 11:68540041-68540063 GAGGGAAAATGGAAGGAGGGAGG + Intronic
1084957863 11:72701001-72701023 AAGGGTAAAGGGAGAGATGGGGG + Intronic
1085199263 11:74691858-74691880 CAGGGTGAGGGGAAGCAGGGTGG + Intergenic
1085326604 11:75611132-75611154 AAGGATAGAGGGAAGGAGGGAGG - Intronic
1085787598 11:79468762-79468784 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1086846024 11:91750700-91750722 AAGGGGAAAGGGAAGGAAGGGGG - Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087957519 11:104306962-104306984 GAGGGACTAGGGACGGAGGGAGG - Intergenic
1088442428 11:109886209-109886231 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088736155 11:112729301-112729323 GAGGGGAAAGGGAGGCAGGGAGG + Intergenic
1089027529 11:115287358-115287380 GAGGGTGAGGGGACGGAGGCAGG + Intronic
1089544634 11:119213907-119213929 CATGGAAAAGGTATGGAGGGGGG + Intronic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1089868867 11:121655243-121655265 CAGGCAAGAGGGACGGTGGGGGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1091111125 11:132969100-132969122 CAGGGGGAAGGGTGGGAGGGGGG - Intronic
1091312152 11:134582189-134582211 CAGGGTCTAAGGATGGAGGGTGG + Intergenic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1091618874 12:2070919-2070941 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618904 12:2071026-2071048 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618926 12:2071098-2071120 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091842012 12:3628118-3628140 AAGGGTGAAGGAAGGGAGGGAGG - Intronic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093284467 12:17241422-17241444 CTGGGAAAAGGGTGGGAGGGGGG - Intergenic
1093311756 12:17596533-17596555 CAGGGTAAAGGTTTGGAGGAGGG + Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093796790 12:23322166-23322188 AAGAGAAAAGGGAGGGAGGGAGG - Intergenic
1095536095 12:43249445-43249467 CAGGGGAAAGGGTGGGAGGGAGG + Intergenic
1095861658 12:46924273-46924295 CAAGGAAAAGGGAAGGAGGTAGG + Intergenic
1095901420 12:47332318-47332340 CAGGGGAAAGGGTGGGACGGGGG + Intergenic
1096348519 12:50873182-50873204 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1096445229 12:51683993-51684015 CAGGGCAGAGGGAGGGAGGTGGG + Intronic
1096674734 12:53220273-53220295 CAGGGGAAAGGGACTGGGCGGGG + Intronic
1096883978 12:54698739-54698761 CAGGGAAAGGGGACGTAGAGTGG + Intergenic
1096978022 12:55710854-55710876 CAGGGGACAAGGATGGAGGGGGG + Intronic
1097141111 12:56903046-56903068 GGGGGTCAAGGGAAGGAGGGTGG + Intergenic
1097222124 12:57457131-57457153 CAGGGACTAGGGAGGGAGGGAGG + Exonic
1097751699 12:63361918-63361940 GAGGGGAAAGGGAGGGAGGGAGG - Intergenic
1098524587 12:71471995-71472017 CAGGGAAAAGGGTAGAAGGGCGG + Intronic
1098740467 12:74167697-74167719 CAGGGGAAAGGGTGGGAGGGAGG + Intergenic
1099042438 12:77672676-77672698 CAGGGGAAAGGGTGGGAGTGGGG + Intergenic
1099767454 12:87006282-87006304 CAGAGTAAAGGGATGGAGAAAGG - Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100274307 12:93058019-93058041 CAGGGTCAAGGGCAGGAGGGAGG + Intergenic
1100337941 12:93650168-93650190 CAGGGTAGCGGGAGGGAGGGAGG - Intergenic
1100456692 12:94758584-94758606 CAGGGGAAAGGGTAGGAAGGGGG - Intergenic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1100748064 12:97667311-97667333 GAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1101434800 12:104655420-104655442 CAGGATAAAGGGATGCTGGGGGG - Intronic
1101717253 12:107321407-107321429 CCAGGTGAAGGGACCGAGGGCGG - Intronic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101759104 12:107644720-107644742 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
1101807408 12:108076421-108076443 AAGGGCAAAGGTATGGAGGGAGG - Intergenic
1101925700 12:108969659-108969681 GAGGGAGAAGGGACAGAGGGAGG - Intronic
1102007389 12:109597287-109597309 GAGGGGACAGGGACAGAGGGAGG - Exonic
1102258717 12:111430593-111430615 CAGGGTCCAGGGGCGAAGGGTGG + Intronic
1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG + Intronic
1102508029 12:113396325-113396347 AAGGAAAAAGGGAGGGAGGGAGG - Intronic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102733018 12:115131155-115131177 CAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1102784508 12:115593377-115593399 CAGGGGAAAGGGTGGGAAGGTGG - Intergenic
1102854074 12:116277862-116277884 CCGGGAAGAGGGAGGGAGGGAGG + Intergenic
1103314494 12:120041604-120041626 CAGAGGAAAGGAATGGAGGGCGG + Intronic
1104034249 12:125087535-125087557 GAGGGGAAAGGGAGGGAGGTCGG - Intronic
1104565925 12:129883043-129883065 CAGGGAAAAGGGAAAGAAGGAGG + Intronic
1104833060 12:131767832-131767854 GAGGGTGGAGGGAGGGAGGGAGG + Intronic
1104843677 12:131836184-131836206 GGGGGTAAAGGCACAGAGGGGGG + Intronic
1104882884 12:132084522-132084544 CCGGGTGATGGGACGGAGAGAGG - Intronic
1106299408 13:28450506-28450528 AAGGGAGAAGGGAAGGAGGGAGG + Intronic
1106991924 13:35429768-35429790 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107251802 13:38372623-38372645 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1107336550 13:39361913-39361935 GAGGGAAAAGGGCAGGAGGGAGG + Intronic
1107359631 13:39603901-39603923 GAAGGGAAAGGGAGGGAGGGAGG - Intergenic
1108060776 13:46530904-46530926 TAGGGGAAAGAGACGGGGGGGGG + Intergenic
1108151299 13:47537521-47537543 CAGGGAGAAGGGTGGGAGGGAGG + Intergenic
1108391254 13:49950018-49950040 CAGGGGAAAGGGTGGGAGAGGGG + Intergenic
1108841710 13:54625936-54625958 CAGGGTAAAGGGACAGAAAGGGG + Intergenic
1108902403 13:55428022-55428044 CAAGGAAAAGGGTGGGAGGGGGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1109671314 13:65612208-65612230 CAGGCAGAAGGGAGGGAGGGAGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110544768 13:76744129-76744151 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1110570380 13:76996446-76996468 CGGGGAAAAGGGTCGGAGAGGGG - Intronic
1111469490 13:88659690-88659712 GAGGGCAGAGGGAGGGAGGGAGG + Intergenic
1111690434 13:91556814-91556836 CAGGGGAAAGGGTGTGAGGGGGG + Intronic
1112007920 13:95270058-95270080 GAGGATAAAGGAAGGGAGGGAGG + Intronic
1112690260 13:101885342-101885364 CAGGGTGGAGGGTGGGAGGGAGG + Intronic
1112782695 13:102918575-102918597 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1112889478 13:104212568-104212590 AAGGGTAGAGACACGGAGGGAGG + Intergenic
1112967377 13:105213116-105213138 CAGGGGAGAGAGACGGATGGGGG - Intergenic
1113235466 13:108268206-108268228 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113438163 13:110308565-110308587 CTGGGTAAAGGGGCGGGGCGAGG + Intronic
1113474376 13:110569772-110569794 CAGGGAAAAGGGAGAGGGGGTGG + Intergenic
1113674115 13:112196354-112196376 CAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1114122667 14:19687495-19687517 AGGGGGAAAGGGAGGGAGGGAGG - Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115653479 14:35420700-35420722 AAGGGAGAAGGGAGGGAGGGGGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116361484 14:44004110-44004132 GAGGGTGGAGGGACGGAGGAAGG + Intergenic
1116786203 14:49291482-49291504 CAGGGGAAGGGAAGGGAGGGAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117192712 14:53308935-53308957 CAGGGTGAAGCGTGGGAGGGGGG - Intergenic
1117342194 14:54802045-54802067 CAGGGGAAAGGGTGGGAGGGAGG + Intergenic
1117416420 14:55500668-55500690 CAGGGTAAAGTGAAGGATTGTGG - Intergenic
1117703610 14:58440307-58440329 CAGGAAAGAGGGAGGGAGGGAGG - Intronic
1117766948 14:59093205-59093227 AAGTGCAAAGGGATGGAGGGTGG - Intergenic
1118616035 14:67575060-67575082 CAGGGTGCCGGGAGGGAGGGAGG - Intronic
1118663113 14:68037059-68037081 AAGGATAAAGGAAGGGAGGGAGG - Intronic
1119456478 14:74760353-74760375 AAAGGAAAAGGGAAGGAGGGAGG - Intergenic
1119847442 14:77840906-77840928 GAGGGAAGAGGGAGGGAGGGAGG + Intronic
1120287664 14:82524849-82524871 CAGGGGAAAGGGTGGGAGGGTGG + Intergenic
1120873748 14:89360373-89360395 AAAGGGAAAGGGAGGGAGGGAGG + Intronic
1120876680 14:89381870-89381892 AAGGGGAAAGGGAGGGACGGAGG + Intronic
1122091294 14:99342738-99342760 TAGGGGAAAGGGAGGGATGGGGG - Intergenic
1124906440 15:33872918-33872940 CAGGGTGAAGGGACACAGGTCGG - Intronic
1125228478 15:37424544-37424566 CAGGGGAAAGGGCAGGAGAGGGG - Intergenic
1125297914 15:38222676-38222698 CAGGGTAAATGGTCTGAGAGTGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1126227125 15:46284042-46284064 GAGGGTAGAGGGCCGGAGGAGGG - Intergenic
1127019124 15:54726294-54726316 GAGGGTAGAGGGAGAGAGGGGGG - Intergenic
1127226459 15:56935622-56935644 CAGGGAAAAGGGTGGGAGGGCGG - Intronic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1127736144 15:61840798-61840820 AAGGGAACAGGGAGGGAGGGAGG - Intergenic
1127867539 15:63043990-63044012 GGGGGTACAGGGAGGGAGGGGGG - Intronic
1128704394 15:69828163-69828185 CAGGTTAGAGGGACGGGGTGAGG - Intergenic
1129318668 15:74761797-74761819 CAGTGCAATGGGGCGGAGGGGGG + Intergenic
1129332131 15:74833148-74833170 AAGGGGAAAAGGAGGGAGGGAGG - Intergenic
1129643526 15:77408385-77408407 CAGGGGGAAGGGTGGGAGGGGGG + Intronic
1129803674 15:78436941-78436963 CAGGGAAAATGGACAGAGGGAGG + Intergenic
1130681576 15:86001581-86001603 GAGGGAAAAGGAAGGGAGGGAGG - Intergenic
1130987539 15:88854605-88854627 CAGGGAGAAAGGAAGGAGGGAGG - Intronic
1131419391 15:92291667-92291689 CAGGAACAAGGGAGGGAGGGAGG + Intergenic
1132022295 15:98373138-98373160 CAGGGATAAAGGAAGGAGGGTGG + Intergenic
1132627324 16:897689-897711 CAGGGTGAAGGGACCGCTGGTGG + Intronic
1132664596 16:1075863-1075885 CAGGGTAGGGGGAGAGAGGGAGG - Intergenic
1132772099 16:1569427-1569449 AAGGGAAGAGGGAGGGAGGGAGG - Intronic
1132781052 16:1625897-1625919 CAGGGTAGAGGGCCGGTGGGAGG - Intronic
1133656722 16:7872090-7872112 AAGGAAAAAGGGAAGGAGGGAGG - Intergenic
1134032431 16:11003248-11003270 AAGGCTAAAGGTACAGAGGGTGG + Exonic
1134213430 16:12297125-12297147 CAGGGTTAGGGGTCGGAGGCTGG + Intronic
1134754021 16:16650613-16650635 CAGGAGAAAGGGAGGGAGGGAGG - Intergenic
1134992038 16:18708431-18708453 CAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1135206618 16:20490382-20490404 CAGAGAAAAGGGACAAAGGGTGG + Intergenic
1135212268 16:20533250-20533272 CAGAGAAAAGGGACAAAGGGTGG - Intergenic
1135213724 16:20546253-20546275 CAGAAAAAAGGGACGGAGGGAGG - Intronic
1135348286 16:21707773-21707795 AAGGGGAAAGGGATGGGGGGGGG - Intronic
1135852308 16:25975290-25975312 GAGGGGGAAGGGAGGGAGGGAGG + Intronic
1136375576 16:29863277-29863299 CAAGGGAGAGGGGCGGAGGGAGG - Exonic
1136622100 16:31436180-31436202 CAGGATAAAGGAAGGGAGGTCGG + Exonic
1137236819 16:46624180-46624202 CAGGGCTTAGGGAGGGAGGGAGG - Intergenic
1137436618 16:48459805-48459827 TAGGGGAAAGGGAATGAGGGAGG - Intergenic
1137738382 16:50742028-50742050 CAGGGAAGAGGGAGGGAGCGGGG - Intronic
1138941265 16:61793402-61793424 GAGGGTAGAGGGAGGGAGGAGGG - Intronic
1139375726 16:66495307-66495329 AAGGATCAAGGGAAGGAGGGAGG - Intronic
1139402972 16:66696732-66696754 CAGCGGAAAGGGAGGGAGGTGGG + Intergenic
1140347237 16:74225977-74225999 AAGGGGGAAGGGAGGGAGGGAGG + Intergenic
1140730569 16:77852309-77852331 CAGGATCAAGGGTGGGAGGGAGG - Intronic
1140781435 16:78300492-78300514 GAGGGGAGAGGGAAGGAGGGAGG - Intronic
1141225982 16:82115250-82115272 CAGGGGAAAAGGTGGGAGGGAGG - Intergenic
1141432981 16:83980525-83980547 AGGGGTAAAGGGACAGAGAGTGG - Intronic
1141537753 16:84694660-84694682 GAGGGGGAAGGGAGGGAGGGGGG + Intergenic
1141539168 16:84705573-84705595 AGAGGGAAAGGGACGGAGGGAGG - Intronic
1141827068 16:86488038-86488060 CAGAGAAAGGGCACGGAGGGAGG - Intergenic
1142261495 16:89044572-89044594 CAGGGGAAGGGAATGGAGGGGGG - Intergenic
1142629563 17:1215916-1215938 CAGGGTAAATGGATTAAGGGCGG + Intronic
1143014770 17:3885810-3885832 CAGGGCAAAGGCATGGAGGTGGG - Intronic
1143493064 17:7294855-7294877 CGGTGGAAAGGGGCGGAGGGGGG - Intergenic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144727036 17:17507207-17507229 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1145961116 17:28887009-28887031 TAGGGGAGAGGGAGGGAGGGAGG + Intronic
1146055065 17:29576831-29576853 CAGGGGAGTGGGAAGGAGGGTGG + Intronic
1146086353 17:29833774-29833796 AAGGAGAAAGGGAGGGAGGGAGG - Intronic
1146086381 17:29833851-29833873 AAGGAGAAAGGGAGGGAGGGAGG - Intronic
1146307836 17:31744146-31744168 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1146430387 17:32787741-32787763 GAGGGGAAAGGGAGGGAGGTGGG - Intronic
1146659698 17:34657536-34657558 CAGGGCAAAGGGCAGAAGGGAGG - Intergenic
1147141620 17:38463602-38463624 CAGGGTATCTGGAAGGAGGGTGG + Intronic
1147845950 17:43403971-43403993 GAGGGAAGAGGGAGGGAGGGGGG - Intergenic
1147847675 17:43416500-43416522 CAGGGTAAAGGAAAGGTGTGGGG - Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148564038 17:48622731-48622753 AAGGGCAAAGGAAAGGAGGGAGG + Exonic
1148770625 17:50064054-50064076 CTGGGGATAGGGACGGAGGTGGG - Intronic
1148971618 17:51488224-51488246 CATGTTAGAGAGACGGAGGGCGG + Intergenic
1149080685 17:52653106-52653128 AAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1149291367 17:55220814-55220836 CAGGGGAAAGGGTGGGAGAGGGG - Intergenic
1149399760 17:56283734-56283756 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149646456 17:58244981-58245003 CAGTGTAAAGGGACAGCGAGAGG - Intronic
1149923222 17:60678046-60678068 CAGTGCAAGGGGCCGGAGGGCGG + Intronic
1150136285 17:62697055-62697077 CAGGCTGGAGGGAGGGAGGGCGG + Intergenic
1150677782 17:67259583-67259605 AGGGGTAGAGGGAGGGAGGGAGG + Intergenic
1151018192 17:70581512-70581534 CAGGGGCAAGGGAGAGAGGGAGG - Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151452955 17:74210539-74210561 CAGGGTACTGGGATGGGGGGAGG + Exonic
1151797060 17:76353515-76353537 CAGAGTAAGGGGGCGGTGGGAGG - Exonic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151945857 17:77319529-77319551 CAGACTAATGGGACGGAGGGGGG + Intronic
1152103438 17:78315767-78315789 CAGGGAAAATGGAAGGCGGGCGG + Intergenic
1152399957 17:80059912-80059934 CAGGGTAAAGGGAGGGCCCGGGG + Intronic
1152507587 17:80760776-80760798 CATAGTAAAGGGAGGGAGGGAGG - Intronic
1152626510 17:81390251-81390273 CAGGGTAAGGGGGCTGAGGCAGG - Intergenic
1153033019 18:732686-732708 CACAGTAAAGGGAAGGAGTGGGG + Intronic
1153274335 18:3353115-3353137 AAGGAGAAAGGGAGGGAGGGAGG - Intergenic
1153766154 18:8376734-8376756 AAGGGGGAAGGGAGGGAGGGAGG - Intronic
1153826630 18:8881445-8881467 TAGGGGAAAGGGAAGGAGAGAGG - Intergenic
1155048941 18:22129951-22129973 AAGGGAAGAGGGAGGGAGGGAGG - Intergenic
1155464077 18:26116121-26116143 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1156261806 18:35451468-35451490 GAGGGAAAAGGGTAGGAGGGAGG + Intronic
1156413412 18:36859524-36859546 AAGGAAAAAGGGAGGGAGGGAGG - Intronic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1156602932 18:38631318-38631340 CAGGGTAAAGGGAGAGAAAGGGG + Intergenic
1156883263 18:42105739-42105761 AAGTGTAAAGGGATTGAGGGAGG - Intergenic
1156992012 18:43420397-43420419 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1157055211 18:44219922-44219944 CAGGGTAAAGGGTGGGAGTGAGG + Intergenic
1157073555 18:44439044-44439066 AAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1157327352 18:46678687-46678709 CAGGGAGAAAGGAAGGAGGGAGG + Intronic
1157484351 18:48076412-48076434 GAGGGTAAGGGGAGGGAGGTGGG + Intronic
1157612732 18:48968489-48968511 AAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1158126921 18:54110412-54110434 GAGGGTGAAGGGTGGGAGGGGGG - Intergenic
1158155726 18:54423378-54423400 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1158377113 18:56883657-56883679 CAGGGGAAAGGGTGGGAGAGGGG - Intronic
1159116624 18:64121336-64121358 AAAGGTAAGGGGACAGAGGGGGG - Intergenic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1160483243 18:79262119-79262141 CAAGGAAAGGGGAGGGAGGGAGG - Intronic
1161678333 19:5665984-5666006 CAGGGTGAAGGGAGAGATGGCGG - Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162173144 19:8807246-8807268 CAGCCTGAAGGGACGAAGGGAGG - Exonic
1162651471 19:12092106-12092128 CAGGGCACAGGGAGGGAGGTGGG + Intergenic
1163389509 19:17021888-17021910 CAGGGGCATGGGAGGGAGGGAGG - Intronic
1163491197 19:17618068-17618090 AAGGGTAGAGGGAAGGATGGGGG - Intronic
1163976623 19:20858847-20858869 TAGGGGAAAGGGAAGGAGAGGGG + Intronic
1164339342 19:24372184-24372206 CAAGGTAAATGGAGGCAGGGCGG - Intergenic
1164730398 19:30499868-30499890 CAGGGGCAAGGGAGGGATGGTGG + Intronic
1164794455 19:31014807-31014829 ATGGGAAAAGGGAGGGAGGGAGG + Intergenic
1164937087 19:32223404-32223426 AAGGATAGAGGGAAGGAGGGAGG + Intergenic
1165070705 19:33253503-33253525 CAGGGGCCAGGAACGGAGGGGGG - Intergenic
1165143720 19:33718542-33718564 GATGGGAAGGGGACGGAGGGTGG - Intronic
1165271159 19:34708835-34708857 CAGGGGAAAGGGTGGCAGGGAGG + Intergenic
1165795804 19:38518494-38518516 CAGGGTAAGGGGCCAGAGGCTGG + Intronic
1165902542 19:39175435-39175457 CAGGGTGAGGGGACGGGCGGCGG + Exonic
1166052754 19:40270169-40270191 AAGGGTAAGGGGAGGTAGGGTGG - Intronic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166231435 19:41427476-41427498 CAGGAGAGAGGGAGGGAGGGAGG + Exonic
1166827868 19:45620776-45620798 CAGGGGTAAGGAAGGGAGGGAGG + Intronic
1167121690 19:47521113-47521135 CAGGGGACAGGGAGGGTGGGGGG + Exonic
1167194276 19:48016431-48016453 AAGAGAAAAGGGAGGGAGGGAGG - Intronic
1167258546 19:48444571-48444593 TAGGGAAAAGCGACCGAGGGTGG - Exonic
1167444232 19:49528055-49528077 CAGGGTAAAGGGAGTGGGTGGGG + Exonic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1167679692 19:50911559-50911581 CAGGGTCTAGGGACCCAGGGAGG + Intergenic
1167913431 19:52721672-52721694 GAGGGGAAAGGGAGAGAGGGAGG + Intronic
1168109199 19:54182051-54182073 AAGGGAAAAGGGAAGGACGGAGG + Intronic
1168254437 19:55157954-55157976 CAGGGTCCTGGGACTGAGGGAGG - Intronic
1168296152 19:55378147-55378169 GAGGGGGAAGGGACGGAGGAGGG + Exonic
925212344 2:2060716-2060738 GAGGGAAAAGGAAGGGAGGGGGG - Intronic
925606955 2:5669346-5669368 CGGGGAAAAGGGAGGAAGGGAGG + Intergenic
925609989 2:5694313-5694335 CACGATAAAGGAAGGGAGGGGGG - Exonic
925665701 2:6252977-6252999 CAGGGAAACGGGATGGAGGGAGG - Intergenic
925706554 2:6689822-6689844 CAGGTAAAAGGGTGGGAGGGGGG + Intergenic
925901579 2:8512974-8512996 CAGGGCAAGGGCAGGGAGGGTGG - Intergenic
925910106 2:8568237-8568259 CAGCAAAAAGGGAGGGAGGGAGG + Intergenic
925917231 2:8615410-8615432 CCGGGTCAGGGGATGGAGGGCGG + Intergenic
925961721 2:9023399-9023421 CAGGGAGAAGGGTGGGAGGGGGG + Intergenic
925965678 2:9063025-9063047 GAAGGGAAAGGGAGGGAGGGAGG + Intergenic
926059244 2:9794895-9794917 GAGGGTGGAGGGAGGGAGGGAGG - Intergenic
926288790 2:11511927-11511949 CAGAGGAAAGGGGCGGTGGGTGG - Intergenic
927484581 2:23479749-23479771 CATGGCTAAGGGAGGGAGGGAGG - Intronic
927518370 2:23685178-23685200 CAGGGCAGAGGGCAGGAGGGAGG - Intronic
927524369 2:23723449-23723471 AAGGAGAAAGGGAGGGAGGGAGG + Intergenic
927878357 2:26673812-26673834 CAGGGTCAAGGGACAGGGGGTGG + Intergenic
928164804 2:28962840-28962862 CAGAGAAAAGGAAGGGAGGGAGG - Intronic
928174469 2:29024461-29024483 AAGGGTGCAGGGAGGGAGGGAGG + Intronic
928953093 2:36832465-36832487 CAGCGGAAAGGGTGGGAGGGGGG - Intergenic
929279856 2:40066041-40066063 GAGGGAGAAGGGAGGGAGGGGGG - Intergenic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
929641909 2:43589677-43589699 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
929642532 2:43596046-43596068 CAGGGCAAAGGGAGGGAGAGAGG + Intronic
930258946 2:49123002-49123024 AAGGATAAAGGAAAGGAGGGAGG - Intronic
930423541 2:51183479-51183501 CAGGGGAAAGGGTGAGAGGGAGG + Intergenic
930833461 2:55770236-55770258 AAGGGAGAAGGGAGGGAGGGAGG - Intergenic
932063972 2:68533693-68533715 CATGGTACAGGGAGGGAGGTGGG - Intronic
932302538 2:70677234-70677256 GAGGGGAGAGGGAGGGAGGGTGG + Intronic
933320581 2:80771352-80771374 GAGGGAAAAGGGAGGGAGAGAGG - Intergenic
933513359 2:83269540-83269562 CAGGGTAGAGGGACAAAGGGAGG - Intergenic
934567654 2:95349497-95349519 CAAGGGAAAGGGACTGATGGGGG - Intronic
934675105 2:96244232-96244254 CAGGGTAAAGGGTGGGAAGGGGG + Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
936266960 2:111018212-111018234 CAGGGAGAGGGGACGGAGGAGGG + Intronic
936439142 2:112535001-112535023 AAGGAGAAAGGGAGGGAGGGAGG + Exonic
936614576 2:114035428-114035450 CAGGAGAAAGGGTGGGAGGGGGG - Intergenic
936855088 2:116948113-116948135 TAGGAGAAAGGGTCGGAGGGTGG - Intergenic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
937766044 2:125661594-125661616 AAGGGTAAAGGGAGGGATAGTGG + Intergenic
938119612 2:128624383-128624405 CAGGGAAAAGGGACAGGGAGGGG - Intergenic
938236503 2:129710400-129710422 GAGGGCAGAGGGAGGGAGGGAGG + Intergenic
938285882 2:130116494-130116516 CAGGGTGAAGGGTGGGAGGAGGG - Intronic
938429723 2:131222408-131222430 CAGGGTGAAGGGTGGGAGGAGGG + Intronic
938589018 2:132719626-132719648 CAGGGTCTAGGGACAAAGGGAGG + Intronic
939118384 2:138087920-138087942 CAGGCTAAAGGGAGTGAAGGGGG + Intergenic
939671244 2:145015367-145015389 CAGGGTAGAGGGAGGGAGAGGGG - Intergenic
939945831 2:148409432-148409454 AAAGGAAAAGGGAAGGAGGGAGG + Intronic
940141769 2:150499376-150499398 CAGGGGAAAGGGTGGGAGGCAGG - Intronic
940472598 2:154117415-154117437 CAGGGTAAAGGGTGAGAGGAGGG - Intronic
942328867 2:174800637-174800659 CAGAGTGAAGGGAGGGTGGGTGG - Intronic
942405852 2:175653966-175653988 CAGTGGAAAGGGTGGGAGGGGGG + Intergenic
942965853 2:181891901-181891923 GAGGGGACAGGGAGGGAGGGAGG - Exonic
943281035 2:185933154-185933176 CAGGGGGAAGGGAGGGAGTGGGG + Intergenic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
943702736 2:191004135-191004157 CAGGGTGGAGGGAAGCAGGGAGG - Intronic
944072698 2:195690998-195691020 CAGCGGAAAGGGTGGGAGGGGGG - Intronic
944165684 2:196717599-196717621 CAGGATAAAGGGGCGGGGCGTGG + Intronic
944486113 2:200207583-200207605 CAGGGGAAAGGGTCAGAAGGGGG + Intergenic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
944585662 2:201171145-201171167 TAGGGGAAAGGGTGGGAGGGGGG + Exonic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
945212401 2:207397441-207397463 CATGGAAAAGGAAAGGAGGGTGG + Intergenic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
946679590 2:222199366-222199388 CAGGAAGAAGGGAAGGAGGGAGG + Intergenic
947013972 2:225597291-225597313 CAGGAGAAAGGGTGGGAGGGGGG - Intronic
947030110 2:225783210-225783232 AGGGGGAAAGGGAGGGAGGGAGG - Intergenic
947438463 2:230094501-230094523 CAGGGGAAAGGGTGGGAGGGAGG - Intergenic
947809903 2:232997746-232997768 CAGAGGAAAAGGACAGAGGGTGG - Intronic
948107426 2:235426822-235426844 GAGAGAAAAGGGAGGGAGGGAGG + Intergenic
948779887 2:240312599-240312621 CAGGGGAAAGGGTGGGAGAGGGG - Intergenic
949030928 2:241796919-241796941 CAGGGTGAGGGGACTGCGGGGGG + Intronic
949035278 2:241813315-241813337 CGGGGCTAAGGGAAGGAGGGAGG - Intronic
1168910071 20:1440504-1440526 CAGGTCAAAGGGATGGAGGGTGG + Intergenic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1169779864 20:9297363-9297385 CAGGGGAAAGGGTCAGAGTGGGG + Intronic
1170184049 20:13567268-13567290 GAGGGTGAAGGGTGGGAGGGGGG + Intronic
1170435795 20:16327285-16327307 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1170927608 20:20740133-20740155 CAGGGTAAAGGGTGGGAGGGGGG + Intergenic
1170938246 20:20827872-20827894 GAGGGGGAAGGGAGGGAGGGAGG + Intergenic
1172110949 20:32544566-32544588 CAGGGTAAAGGGGTGGGAGGTGG + Intronic
1172113973 20:32563026-32563048 GAGGGTAGAGGGAGGGAGAGTGG + Intronic
1172221515 20:33277464-33277486 CAGGGGCAAAGGAAGGAGGGTGG - Intronic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172804018 20:37598388-37598410 AAGGGAAAAAGGACGGGGGGCGG - Intergenic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173047987 20:39530987-39531009 AAGGGAAAAAGGATGGAGGGAGG - Intergenic
1173062859 20:39679003-39679025 CAGGGTACAGGGATGGAGTCTGG - Intergenic
1173380487 20:42535322-42535344 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1174655364 20:52167510-52167532 AAGGGAAGAGGGAGGGAGGGAGG - Intronic
1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG + Intronic
1175199784 20:57268891-57268913 CAGGGTGAGGTGATGGAGGGTGG + Intergenic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175645310 20:60665931-60665953 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1176286478 21:5021692-5021714 CAGGGATCAGGGAGGGAGGGCGG + Intergenic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177519966 21:22208514-22208536 CGGGGGAAAGGGTGGGAGGGAGG - Intergenic
1178570190 21:33728718-33728740 CAAGGTAAAGGGAAAGAGGTGGG - Intronic
1178570358 21:33730214-33730236 CAGGGTAAAGGGATAGAAGAGGG - Intronic
1178761444 21:35406295-35406317 CAGGGTAGAGGTATTGAGGGAGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179116711 21:38499855-38499877 AAGGAGAAAGGGAGGGAGGGAGG + Intronic
1179669865 21:42939122-42939144 CAAGGAAAAGGGAGGAAGGGTGG - Intergenic
1179870703 21:44241783-44241805 CAGGGATCAGGGAGGGAGGGCGG - Intergenic
1180170264 21:46054896-46054918 CGGGGCAGAGGGAGGGAGGGGGG - Intergenic
1180170276 21:46054924-46054946 CGGGGCAGAGGGAGGGAGGGGGG - Intergenic
1180170288 21:46054952-46054974 CGGGGCAGAGGGAGGGAGGGGGG - Intergenic
1180244625 21:46538920-46538942 CAGGACAAAGGGCAGGAGGGTGG - Intronic
1180643128 22:17315560-17315582 GAGCGTAAGGGGACGGAGAGAGG + Intergenic
1180711574 22:17842731-17842753 CAGGGTGAAAGGACGCAGGCAGG - Intronic
1181373133 22:22433714-22433736 CAGGAGAAAGGGTAGGAGGGGGG - Intergenic
1182086309 22:27563547-27563569 CAGGGCAGAGGGATGGAGGCAGG - Intergenic
1182394854 22:30027901-30027923 GAGGGAAAAGGGACGAAGAGGGG - Intronic
1182716884 22:32364092-32364114 CAGGGTGAAGGGAGTGGGGGAGG - Intronic
1183248359 22:36711029-36711051 CAGGATCCAGGGACAGAGGGAGG - Intergenic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183579390 22:38714653-38714675 CAGGGGCAAGGGAAGGGGGGTGG + Intronic
1183625492 22:38999145-38999167 AAGGGTCAAGGAAGGGAGGGAGG - Intergenic
1183848473 22:40562738-40562760 AAGGGGGAACGGACGGAGGGGGG + Intronic
1184196809 22:42935301-42935323 CAGGGGAAAGGGAAACAGGGAGG - Intronic
1184243212 22:43222419-43222441 CAGGGTCAGGGGACCGTGGGAGG - Intronic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
949107105 3:212700-212722 AAGGATACAGGGACGGAGAGGGG - Intronic
949677055 3:6467446-6467468 AAAGGAAAAGGGAGGGAGGGAGG + Intergenic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
950496739 3:13338308-13338330 CAGGGTACAGGGACGAATGCAGG + Intronic
950543903 3:13627732-13627754 CAGGGTCATGGGTCTGAGGGCGG + Intronic
950602973 3:14051560-14051582 CAGGGTGATGGAAGGGAGGGGGG - Intronic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
952113733 3:30154889-30154911 CAGGATATAGGGAGGAAGGGAGG + Intergenic
952344861 3:32473902-32473924 CATGGTAAAGGGAGGGATGGAGG - Intronic
952949811 3:38513691-38513713 AAGGAGAAAGGGAAGGAGGGAGG - Intronic
953438217 3:42896658-42896680 CAGGATTAAGGGAATGAGGGGGG + Intronic
953843334 3:46407211-46407233 CGGGGTACAGGGCCAGAGGGAGG + Intronic
953888931 3:46736275-46736297 CAGGGGCATGGGACGGAGGCTGG - Intronic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
955496660 3:59540636-59540658 GAGGGTAAAGGGAGGAAGGAAGG + Intergenic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955697240 3:61649120-61649142 AAGGGAAAAGGGAGGGAGGGAGG - Intronic
955855139 3:63264804-63264826 CAGGGTGGAAGGACGGAGTGAGG + Intronic
955956763 3:64298127-64298149 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
956240845 3:67128470-67128492 CAGGGGAAAGGGTAGGAGAGGGG + Intergenic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
956860903 3:73322685-73322707 CAGGGTCAAGGGCCGGAGGAGGG - Intergenic
957200217 3:77124832-77124854 AAAGGTAAAGGGAAGAAGGGAGG - Intronic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958014303 3:87920245-87920267 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
959084458 3:101836106-101836128 GAGGGTAGAGGGACAGAGTGGGG + Intronic
959111774 3:102131269-102131291 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
959356325 3:105334044-105334066 AAGGGGAAAGGAAGGGAGGGAGG + Intergenic
959796276 3:110432410-110432432 GAGGGGAGAGGGAAGGAGGGGGG - Intergenic
961570585 3:127795395-127795417 GAGGGGGAAGGGAGGGAGGGGGG + Intronic
961660243 3:128464840-128464862 GAGGGGGAAGGGAGGGAGGGAGG - Intronic
961749938 3:129088877-129088899 CAGGGCTTAGGGAGGGAGGGAGG - Exonic
961788021 3:129359131-129359153 CAGGGCAAAGGCCCGGAGGCTGG + Intergenic
961958123 3:130825385-130825407 CAGGGAGGAGGGAGGGAGGGAGG + Intergenic
962557133 3:136565035-136565057 CAGGCAGAAGGGAGGGAGGGAGG + Intronic
963112005 3:141695802-141695824 GAGGGTAGAGACACGGAGGGTGG + Intergenic
964120700 3:153180310-153180332 GAGAATAAAGGGAGGGAGGGAGG - Intergenic
964617856 3:158688473-158688495 AAGGGTAAAGGGAAGGAAAGAGG - Intronic
964645443 3:158953919-158953941 AAGGGAGAAGGGAGGGAGGGAGG + Intergenic
965778705 3:172260797-172260819 CAGGGAAAAAGCACGGAGAGAGG - Intronic
966549130 3:181184385-181184407 GAGGATGGAGGGACGGAGGGAGG + Intergenic
966888952 3:184392432-184392454 CAGGGCAGAGGGACAGATGGGGG + Intronic
967350772 3:188511325-188511347 GAGGGACAAGGGAGGGAGGGAGG - Intronic
967568493 3:190999697-190999719 GAGAGTGAAGGGAGGGAGGGAGG + Intergenic
968173667 3:196530053-196530075 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
968719603 4:2191330-2191352 AAGGGTAAGGGGGCGGTGGGTGG + Intronic
968829521 4:2925663-2925685 CAGGGAGAAGGCAGGGAGGGAGG + Intronic
968985857 4:3873916-3873938 CAGGGAAAGGGGAGAGAGGGAGG + Intergenic
968991617 4:3917157-3917179 AAGGAGAGAGGGACGGAGGGAGG + Intergenic
969032204 4:4224390-4224412 GAGGGAATAGGGAGGGAGGGAGG + Intronic
969109369 4:4832564-4832586 CGGGGGAAAGGGTGGGAGGGTGG + Intergenic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969387779 4:6867312-6867334 CAGAGTAGAAGGACGGAGGCAGG + Intronic
969835404 4:9836145-9836167 CGGGGGAAAGGGTGGGAGGGGGG + Intronic
969920054 4:10530008-10530030 GAAGGAAAAGGGAAGGAGGGAGG - Intronic
971015960 4:22488934-22488956 GAGGTTATAGGGACTGAGGGAGG + Intronic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
974454207 4:62105262-62105284 CAGGGTGAAGGGTGGGAGGAGGG - Intergenic
975642934 4:76518460-76518482 CAGGCAAAAAGGAAGGAGGGGGG - Intronic
975660444 4:76683433-76683455 GAGGGTAAAGGCAAGGAAGGAGG - Intronic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976726273 4:88218592-88218614 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
977711911 4:100135997-100136019 CATGGTAAAGGGCAGGAGGCAGG - Intergenic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
978381863 4:108137259-108137281 CAGGGGAAAGGGTGGGAGTGGGG + Intronic
978430956 4:108633055-108633077 CAGGGTAGAGGGTGGGAGGAGGG - Intergenic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
978726030 4:111970543-111970565 CAGGGGAAAGGGTGGGAGGGGGG + Intergenic
979128574 4:117009404-117009426 GATGGAAAAGGGAAGGAGGGAGG + Intergenic
979610947 4:122688251-122688273 AAGGAGAAAGGGAGGGAGGGAGG + Intergenic
979792415 4:124801977-124801999 CAGCGGAAAGGGTGGGAGGGAGG + Intergenic
980093652 4:128467661-128467683 CAGAGTACAGGCAAGGAGGGCGG - Intergenic
980312216 4:131145783-131145805 CAGGGCAAAGAGTGGGAGGGGGG + Intergenic
980586378 4:134821937-134821959 CAGGGAAAAGGGTGGGAGAGGGG - Intergenic
981602624 4:146507708-146507730 CATAGTAAAGGGACAGAGTGAGG - Intronic
981680792 4:147395416-147395438 CAGGGGAAAGGGTGGGAGGTGGG + Intergenic
981733292 4:147922233-147922255 GAGAGTGAAGGGAGGGAGGGAGG + Intronic
981803100 4:148680868-148680890 CAGAATACAGGGACAGAGGGAGG - Intergenic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
982318642 4:154057453-154057475 TAGGGTAGAGACACGGAGGGAGG - Intergenic
982451547 4:155558338-155558360 CAGGGGAAAGGGTGAGAGGGAGG + Intergenic
982520200 4:156407022-156407044 CAGGGGAAAGGGTGGGAGTGGGG + Intergenic
984760092 4:183356419-183356441 CAGGGAGAAAGGAGGGAGGGAGG - Intergenic
985231799 4:187826804-187826826 CAGGGCAGAGCCACGGAGGGGGG - Intergenic
985497467 5:217964-217986 CAGGGAATGGGGTCGGAGGGGGG - Intronic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986241703 5:5965642-5965664 GAGGGTAAGGGGACGGAGAGTGG - Intergenic
986313354 5:6571075-6571097 GAGGGAAGAGGGAAGGAGGGTGG + Intergenic
987333627 5:16878826-16878848 CAGGGAGAAGGGTGGGAGGGTGG + Intronic
988487993 5:31682839-31682861 CAGGGGAAAGGGAGGGGTGGAGG - Intronic
988776426 5:34481768-34481790 AAGGGGAAAGGGAGGAAGGGTGG - Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989199543 5:38750073-38750095 CAGGGCAAGGGGATGGAGAGAGG + Intergenic
989513300 5:42313609-42313631 GAGGGTAGAGGGTAGGAGGGAGG - Intergenic
990163578 5:52970809-52970831 TGGGGTAGGGGGACGGAGGGAGG - Intergenic
990252369 5:53929217-53929239 AAGCGAAAAGGGACAGAGGGAGG + Intronic
990358310 5:54992928-54992950 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
990461850 5:56037980-56038002 CAGGGAAGATGGACAGAGGGAGG - Intergenic
990782959 5:59386684-59386706 CAGGAGGAAGGGAGGGAGGGAGG + Intronic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
992077173 5:73202233-73202255 CAGGGCGGAGGGAGGGAGGGAGG + Intergenic
992520159 5:77542273-77542295 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
992732974 5:79690669-79690691 CTTCTTAAAGGGACGGAGGGTGG - Intronic
992872766 5:81023079-81023101 GAGGGTAGAGGGTGGGAGGGAGG + Intronic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993050413 5:82920000-82920022 CAGGGTAAAGGAAAGGAAAGGGG - Intergenic
993505567 5:88704905-88704927 CAGGGGAAAGGGTGGGAGAGGGG + Intergenic
993696697 5:91070104-91070126 GATGGGAAAGGGATGGAGGGGGG + Intronic
993743766 5:91570516-91570538 CAGGGGAAAGGGTGGGAGGGGGG + Intergenic
994022574 5:95044642-95044664 CTGGGTTAAAGGACAGAGGGAGG - Intronic
994409395 5:99388088-99388110 AAGGGAAAAGGGAGGGAGGGAGG - Intergenic
994685606 5:102947522-102947544 CAGGGTAAAGGATGGGAAGGAGG + Intronic
994731631 5:103498681-103498703 AAGGGAAAAGGAAAGGAGGGAGG + Intergenic
994777670 5:104055506-104055528 CAGGGAGAAGGGTGGGAGGGAGG - Intergenic
995095440 5:108230565-108230587 CAGAGGAAAGGGTAGGAGGGGGG + Intronic
995375360 5:111468166-111468188 CAGGGGAAAGGGTGGGAGTGGGG + Intronic
995789442 5:115868915-115868937 GAGGATGAAGGGAGGGAGGGAGG + Intronic
996638757 5:125728258-125728280 CAGAGCAAAGGGATGGAGAGTGG + Intergenic
996834870 5:127779879-127779901 TAGGGGAAAGGGTGGGAGGGGGG - Intergenic
997241670 5:132312424-132312446 CAGGTGAAGGGGACTGAGGGCGG - Intronic
997423389 5:133786613-133786635 CAGGGGAGAGGGATGCAGGGAGG + Intergenic
997702994 5:135917897-135917919 TAGGGCAGAGGGAAGGAGGGAGG + Intergenic
997917723 5:137944950-137944972 GAGGGGGAAGGGAGGGAGGGGGG + Intronic
998593547 5:143503242-143503264 CAGGGTGAAGGGAAGGAGTTTGG - Intergenic
998738469 5:145170833-145170855 GAGGGTATAGGGAGGGAGGTGGG - Intergenic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999329124 5:150660806-150660828 GAAGGTAGAGGGAGGGAGGGAGG + Intergenic
999480183 5:151940962-151940984 CAGGGCAAAGGGGCGGGGGTGGG + Intergenic
999759857 5:154691654-154691676 CAGGGAACAGGGACGGAGGGAGG - Intergenic
1000115366 5:158148917-158148939 GAGGGGAAGGGGAGGGAGGGAGG - Intergenic
1000495357 5:161976243-161976265 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1000537309 5:162494454-162494476 CACTGTAAATGGAGGGAGGGAGG + Intergenic
1000687474 5:164270208-164270230 CAGGAGAGAGGGAGGGAGGGAGG - Intergenic
1001134370 5:169090226-169090248 GAGGGTGAAGGGGAGGAGGGAGG + Intronic
1001733220 5:173975487-173975509 CAGGGGAAAGGGTGGGAGTGAGG - Intronic
1002500859 5:179646811-179646833 AGGAGGAAAGGGACGGAGGGAGG - Intergenic
1002639043 5:180621987-180622009 CAGGAGAGAGGGAGGGAGGGAGG - Intronic
1002822963 6:745436-745458 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1002904730 6:1438987-1439009 CAGGGTAAAGGCTGGGTGGGGGG - Intergenic
1003228488 6:4227878-4227900 AAGGGTAGTGGGAAGGAGGGAGG + Intergenic
1003812240 6:9796929-9796951 GAGGGGGAAGGGAGGGAGGGAGG + Intronic
1004649325 6:17593489-17593511 GAGGGAGAAGGGAGGGAGGGAGG - Intergenic
1005123164 6:22413379-22413401 CAGGGTGAAGGCATGGAGGGTGG + Intergenic
1006088727 6:31615465-31615487 CAGGGTAAGGAGAGGAAGGGAGG + Intronic
1006184908 6:32176030-32176052 CAGCAGAAAGGGAGGGAGGGAGG - Intronic
1006373784 6:33660515-33660537 CAGATTTAAGGGAGGGAGGGAGG - Intronic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1007316550 6:40993854-40993876 CAGGGTACTGGGAAGGATGGAGG - Intergenic
1007380166 6:41485035-41485057 CAGGGTAGAGAGACTGGGGGTGG + Intergenic
1007695018 6:43726319-43726341 CAGGGTTAGGTGACGCAGGGAGG + Intergenic
1007741052 6:44009655-44009677 AAGGGAGAAGGGAAGGAGGGAGG + Intergenic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1007905812 6:45459775-45459797 CAGGGTAAGGGGACAGAGGGAGG + Intronic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1008362344 6:50635560-50635582 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1008427750 6:51379381-51379403 AAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1008483087 6:52006837-52006859 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1008793028 6:55262109-55262131 CAGGGGAAAGTGAGGGAGAGGGG + Intronic
1010252612 6:73723741-73723763 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1010507219 6:76675401-76675423 GAGGGTAGAGGGAGGGAGGAGGG - Intergenic
1011286424 6:85729343-85729365 CAGGTGAAAGGGTGGGAGGGGGG - Intergenic
1011289590 6:85762858-85762880 CAGGGGAAAGGGTGGGAGGTTGG - Intergenic
1011740095 6:90350867-90350889 CAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012263040 6:97110621-97110643 CAGGGGAAATGTACTGAGGGAGG - Intronic
1012681204 6:102183484-102183506 AAGGGAAAAGGGAGGGAAGGAGG - Intergenic
1012983442 6:105853358-105853380 CAGGGTAAATGGATTAAGGGCGG - Intergenic
1013216610 6:108033114-108033136 GAGGGAAGAGGGAGGGAGGGAGG - Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1013913404 6:115306035-115306057 CAGGGGAAAGGGTGGGAGGGAGG - Intergenic
1014022306 6:116605222-116605244 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014379213 6:120717888-120717910 CAGGGTAGTGGGACGGAGCGGGG + Intergenic
1014558636 6:122863690-122863712 CAGGGCAAAGTGAGGAAGGGAGG + Intergenic
1014942056 6:127453217-127453239 CAGGGTCAACGGACTGAGGGAGG + Intronic
1014942300 6:127456950-127456972 GAGGAGAAAGGGAAGGAGGGAGG - Intronic
1015079675 6:129208704-129208726 GAAGGAAAAGGGAGGGAGGGAGG + Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015743401 6:136483358-136483380 GAGGGTGAAGGGCGGGAGGGGGG + Intronic
1015793766 6:136990024-136990046 CAGGGGAGCGGGGCGGAGGGCGG - Intergenic
1016392126 6:143585160-143585182 CAGGCTACAGGGACAGAGAGTGG + Intronic
1016495048 6:144651962-144651984 CAGGGGAAAGTGTGGGAGGGGGG - Intronic
1017189426 6:151636078-151636100 AAGGAAAAAGGGAGGGAGGGAGG - Intergenic
1017319686 6:153075427-153075449 CAGGGTAGAGGTAGGGATGGGGG - Intronic
1017472257 6:154750451-154750473 TGGGGGAAAGGGAGGGAGGGAGG - Intronic
1017493238 6:154962347-154962369 CAGGGTAGAAGGAGAGAGGGAGG + Intronic
1017555853 6:155567448-155567470 CAGGGAAAAGGGTGGCAGGGGGG - Intergenic
1018061941 6:160096916-160096938 CAGGGTAGAGGGACAGAGCTGGG - Intronic
1018168259 6:161121161-161121183 CAGGGGAAAGGGTGGGAAGGCGG - Intergenic
1018323046 6:162633783-162633805 CAGGATGAAGCGAGGGAGGGAGG + Intronic
1018433876 6:163744256-163744278 CAGGGGAGAGGCAAGGAGGGAGG - Intergenic
1018444507 6:163842888-163842910 AAGGGTAAAGGGAGGAAAGGAGG - Intergenic
1018857740 6:167687532-167687554 CAGGATAAAGGAACAGATGGAGG + Intergenic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019477276 7:1249945-1249967 CTGGGGGGAGGGACGGAGGGAGG + Intergenic
1019483490 7:1277043-1277065 AAGGGAAGAGGGAGGGAGGGAGG - Intergenic
1019572653 7:1720171-1720193 CAGGGAAAATGGGCAGAGGGTGG - Intronic
1019962625 7:4473564-4473586 CAGGGGAAAGGGAGAGAGAGAGG + Intergenic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1022177638 7:27887124-27887146 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1022957782 7:35397325-35397347 CAGGGTGAGGGGACAGAGGATGG - Intergenic
1023356422 7:39371540-39371562 CAGGGGTAAAGGATGGAGGGAGG - Intronic
1023360970 7:39414690-39414712 CGGGGTAGAAGGATGGAGGGCGG - Intronic
1023528432 7:41129430-41129452 CAGGCTACAGGGATGGAAGGTGG - Intergenic
1023737441 7:43247666-43247688 AAGGGGAGAGGGAGGGAGGGAGG + Intronic
1023880058 7:44313202-44313224 CAGGGGAATGGGACGGAGCGAGG - Intronic
1023910047 7:44547293-44547315 GAGGGGGAAGGGAAGGAGGGAGG + Intergenic
1024049142 7:45607589-45607611 GAGGAGAGAGGGACGGAGGGAGG - Intronic
1024175075 7:46831269-46831291 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
1024665080 7:51538089-51538111 CAGGGGGAAGGGTGGGAGGGAGG - Intergenic
1025556771 7:62319156-62319178 AAGGGGAAAGGAAGGGAGGGAGG - Intergenic
1025857340 7:65293817-65293839 TAGGGCAAAGGGTGGGAGGGGGG - Intergenic
1026004541 7:66590800-66590822 CAGGGTGGAGTGACGGAGAGGGG - Intergenic
1026040737 7:66865892-66865914 GGAGGTAAAGGGAGGGAGGGAGG - Intergenic
1026231162 7:68485329-68485351 AAAGGAAAAGGGAGGGAGGGAGG + Intergenic
1026268524 7:68816452-68816474 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1026282333 7:68933080-68933102 CAGGGTAGAGGGAGGAAGGAAGG - Intergenic
1026577279 7:71582811-71582833 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
1026638797 7:72106647-72106669 GGGGGAAAAGGGAAGGAGGGAGG + Intronic
1026865539 7:73821913-73821935 AAGCATAAAGGGAGGGAGGGAGG + Intronic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1028911881 7:96216745-96216767 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1029732184 7:102445818-102445840 AAGAGAAAAGGGAGGGAGGGAGG - Intronic
1029891346 7:103933484-103933506 CAGGAGAAAGGAAGGGAGGGAGG + Intronic
1031051507 7:116950348-116950370 GAGGGGGAAGGGAAGGAGGGAGG - Intergenic
1031232007 7:119119821-119119843 TAGGGGAAAGGGTGGGAGGGTGG - Intergenic
1031330298 7:120455810-120455832 CAGGGTTAAGGGTGGGAGGAAGG + Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031756135 7:125645392-125645414 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1032189031 7:129752265-129752287 CAGTGTAAAAGGAAGGAGTGGGG + Intronic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032625003 7:133582118-133582140 GAGGGTAGAGGGAGGGAGGAAGG - Intronic
1033014827 7:137661474-137661496 CTGGGGAAAGGGCCAGAGGGGGG + Intronic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034198666 7:149266942-149266964 CTGGGTAAGGCCACGGAGGGAGG + Exonic
1034220088 7:149437412-149437434 CAGGGTATGGGGCCGAAGGGTGG - Intronic
1035625627 8:1068638-1068660 GAGGGAACAAGGACGGAGGGAGG + Intergenic
1035776406 8:2191514-2191536 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1035776420 8:2191544-2191566 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1035776475 8:2191650-2191672 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1036942690 8:13066869-13066891 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1037055273 8:14432523-14432545 CAGGGTAAAGGGTGAGAAGGGGG + Intronic
1037116534 8:15236100-15236122 CTGGGCAAAGGGAAGTAGGGAGG - Intronic
1037170693 8:15887886-15887908 CAGAGAAAATGGAGGGAGGGAGG + Intergenic
1037320332 8:17635284-17635306 CAGGGGAAAGGGTTGGGGGGAGG - Intronic
1037353502 8:17991849-17991871 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1037373028 8:18200534-18200556 AAGGGTAAAGGGTGGGAGGATGG + Intronic
1037480687 8:19302359-19302381 AAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1037685948 8:21139486-21139508 CAAGGTGAAGGGCAGGAGGGAGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037764464 8:21763756-21763778 CAGGGTAGGGGGACGGATGAGGG - Intronic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1038117692 8:24576229-24576251 CAGGGTAAAGGGAAGGGTAGTGG - Intergenic
1038407623 8:27333851-27333873 GAGGGCTAAGGGAGGGAGGGAGG - Intronic
1038413339 8:27375255-27375277 CAGGGTAAGGGGACTCAGGAGGG - Intronic
1038735691 8:30167025-30167047 GAGAGGAAAGGGAGGGAGGGAGG + Intronic
1038806206 8:30794493-30794515 CAGAGAAAAGGAAGGGAGGGAGG - Intronic
1039030559 8:33304569-33304591 CAGGAGAAAGGGTGGGAGGGGGG + Intergenic
1039428449 8:37506249-37506271 AAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1039476085 8:37840095-37840117 CGGGGTCAAGGCACGGAGGCTGG - Intronic
1039566499 8:38555810-38555832 CAGGGCAAAGGGGCTGATGGCGG - Intergenic
1039572502 8:38599058-38599080 CAGGGGAAAGGGTGGGAGGGGGG - Intergenic
1039812653 8:41063380-41063402 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1041800475 8:61792471-61792493 CAGGGAAAAAGGAGGGAGAGTGG + Intergenic
1041926804 8:63245446-63245468 CAGGGGAAAGGGTAGGAGAGGGG - Intergenic
1042161054 8:65895965-65895987 CAGGGGAAATGGTGGGAGGGTGG + Intergenic
1042214198 8:66413052-66413074 CGGGGGAAAGGGTGGGAGGGGGG - Intergenic
1042399826 8:68332012-68332034 CAGGAGAAAGGGACGGAGAAAGG + Intronic
1042433839 8:68741080-68741102 GAGGGTGAAGGGAGGGAGGGGGG + Intronic
1043322653 8:79009366-79009388 AAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1043691614 8:83160463-83160485 CAGGGAAAAGGGTGGGAGGGGGG - Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1043998420 8:86847667-86847689 AAGAGGAAAGGGAGGGAGGGAGG + Intergenic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1045349979 8:101329758-101329780 CAGGGGAGTGGGAAGGAGGGAGG - Intergenic
1045636138 8:104193070-104193092 GAGATTAAAGGGAAGGAGGGAGG - Intronic
1045878418 8:107009989-107010011 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
1046002182 8:108434304-108434326 AAGGGTACAGGGAGGGAGGGAGG + Intronic
1046048198 8:108987982-108988004 GAGGGTAGAGGGAGGGAGGAGGG + Intergenic
1046624989 8:116567170-116567192 CAAGGGAAAGGGTGGGAGGGGGG + Intergenic
1046719978 8:117608435-117608457 GAGGGAAGAGGGAGGGAGGGGGG - Intergenic
1049258371 8:141625740-141625762 CAGGGTAGAGTGACAGAGTGAGG + Intergenic
1049409986 8:142468780-142468802 CAGGATAAAGGGTCAGAGAGTGG - Intronic
1049461604 8:142732069-142732091 CAGGGGAAGGGGAAGGAGAGGGG - Intronic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050160804 9:2717427-2717449 CAGGGTCAAGGGAGTGGGGGAGG + Intergenic
1050441545 9:5669279-5669301 CAGGGAAAAGGGTGGGAGGCGGG - Intronic
1050707192 9:8414868-8414890 CAGGAGAGAGGGAGGGAGGGAGG + Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1052744191 9:32423749-32423771 CAGGGCAAAGGGTGGGAGGGAGG + Intronic
1053054641 9:34987427-34987449 CAGGACAATGGGACTGAGGGCGG + Intergenic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054732719 9:68717082-68717104 AAGGGGACAGGGAAGGAGGGAGG + Intronic
1054947346 9:70810125-70810147 CAGGGTGATGGAAAGGAGGGTGG - Intronic
1055372851 9:75619349-75619371 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1055711832 9:79071742-79071764 CAGGGTAAATGGTGGGAGGGGGG + Intergenic
1056027148 9:82510764-82510786 CAGGGGGAAGGGTGGGAGGGAGG + Intergenic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056137775 9:83646650-83646672 AAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1056435826 9:86575364-86575386 CATGGTAAAGGCAGGAAGGGTGG + Intergenic
1056604639 9:88076642-88076664 CAGGGGAAATGAAGGGAGGGTGG - Intergenic
1057212001 9:93205510-93205532 CAGGGTGCAGGGACGGACAGGGG - Intronic
1057973497 9:99579656-99579678 CAGAGTAATGGGACAGAGAGTGG + Intergenic
1058257656 9:102789508-102789530 CACAGTCAAGGGACGGTGGGAGG - Intergenic
1058663646 9:107289103-107289125 AAGGGGGAAGGGAGGGAGGGAGG - Intronic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059730886 9:117055754-117055776 GAGGGCAAGGGGACTGAGGGAGG + Intronic
1061036800 9:128118737-128118759 AAGGGTACAGGGATGGAGGATGG + Intergenic
1061157905 9:128876090-128876112 AAGAGTAAAGGGAGGGAAGGTGG - Intronic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1062143990 9:134978888-134978910 GAGGATAGAGGGAGGGAGGGAGG + Intergenic
1062201708 9:135306228-135306250 GAGGGGGAAGGGAGGGAGGGAGG - Intergenic
1185887280 X:3794047-3794069 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1186039928 X:5464468-5464490 AAAGGTGAAGGGAGGGAGGGAGG + Intergenic
1187447646 X:19373058-19373080 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1187493271 X:19772740-19772762 CAGGGAAAAGGGTCGGGAGGAGG + Intronic
1187984662 X:24797217-24797239 CAGGGGAAATGGAGAGAGGGTGG - Intronic
1188270599 X:28135408-28135430 CAGGGTTTAGGGATGGTGGGAGG - Intergenic
1188595347 X:31893570-31893592 AAGGGGAAAGGGAGGGAGGGAGG + Intronic
1188737051 X:33729907-33729929 AAGGGTAATGGGATGGAGAGTGG - Intergenic
1189297690 X:39930332-39930354 CAGGGTAGGGTGACGGAGGGTGG - Intergenic
1189382861 X:40514062-40514084 CAGGGTGGAGTGAAGGAGGGAGG + Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1189643998 X:43106568-43106590 CAGGGTGTAGGGTAGGAGGGTGG - Intergenic
1190114710 X:47619160-47619182 AAGGTTTAAGGGGCGGAGGGGGG + Intronic
1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG + Intronic
1190259023 X:48786513-48786535 GAGGGAGAAGGGAGGGAGGGAGG + Intergenic
1190280099 X:48923681-48923703 CAGGGTAGAGGGACACAAGGGGG + Exonic
1190685751 X:52871273-52871295 CAGGGGAAAGGGTGGGAGGGGGG + Intergenic
1191001185 X:55661169-55661191 CAGGGGAAAGGGTGGGATGGGGG + Intergenic
1191067236 X:56362554-56362576 CAGGGGAAAGTGTGGGAGGGTGG - Intergenic
1191918609 X:66229446-66229468 CAGGGGAAAGGGTGGGAGGGAGG + Intronic
1192179824 X:68909437-68909459 CAGGGTAAAAGGAAAGAGAGTGG + Intergenic
1192252311 X:69422722-69422744 CAGGGTAAATGGATTAAGGGCGG + Intergenic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1193636249 X:83952765-83952787 CAGGGAAAAGGGTTGGGGGGTGG + Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194602191 X:95935807-95935829 CAGGGGAAAGGGTGGGAGGTGGG - Intergenic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195476860 X:105297053-105297075 CAGGGAAAAGGGATGGAGATTGG + Intronic
1195702141 X:107713666-107713688 GAGAGTAAAGGCAAGGAGGGGGG - Exonic
1195865246 X:109425645-109425667 CGGGGGAAAGGGTGGGAGGGGGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1199293264 X:146129149-146129171 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1199341271 X:146680061-146680083 CTGGATACAGGGAGGGAGGGTGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199715564 X:150505326-150505348 TAGGGTGAAGGGATGGAGGGTGG - Intronic
1200705137 Y:6436220-6436242 CAGGGTGAAGGGAGGAAGTGAGG - Intergenic
1200818979 Y:7562746-7562768 CAGGGGAAAGGGTGGGAGCGGGG + Intergenic
1200940373 Y:8774252-8774274 CAGGGTAAAGAGAGGCAGTGAGG - Intergenic
1201028974 Y:9728488-9728510 CAGGGTGAAGGGAGGAAGTGAGG + Intergenic
1201074264 Y:10175243-10175265 AAGGAGACAGGGACGGAGGGAGG - Intergenic
1201235371 Y:11905147-11905169 AAAGGAAAAGGGAAGGAGGGAGG + Intergenic
1201550381 Y:15211788-15211810 AAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1201697820 Y:16846027-16846049 CAGGGGGAAGGGAGGGAGAGGGG - Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic
1202163644 Y:21963249-21963271 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202227712 Y:22623116-22623138 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic
1202315445 Y:23573062-23573084 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202555356 Y:26097535-26097557 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic