ID: 1166091817

View in Genome Browser
Species Human (GRCh38)
Location 19:40514262-40514284
Sequence CTGCAGGCACAGTAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 1, 2: 4, 3: 35, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166091817_1166091826 16 Left 1166091817 19:40514262-40514284 CCTTGCCCCTACTGTGCCTGCAG 0: 1
1: 1
2: 4
3: 35
4: 331
Right 1166091826 19:40514301-40514323 AACATTGATTTAAAGATGGGAGG 0: 1
1: 0
2: 2
3: 15
4: 258
1166091817_1166091824 12 Left 1166091817 19:40514262-40514284 CCTTGCCCCTACTGTGCCTGCAG 0: 1
1: 1
2: 4
3: 35
4: 331
Right 1166091824 19:40514297-40514319 TTGAAACATTGATTTAAAGATGG 0: 1
1: 0
2: 6
3: 63
4: 679
1166091817_1166091825 13 Left 1166091817 19:40514262-40514284 CCTTGCCCCTACTGTGCCTGCAG 0: 1
1: 1
2: 4
3: 35
4: 331
Right 1166091825 19:40514298-40514320 TGAAACATTGATTTAAAGATGGG 0: 1
1: 0
2: 0
3: 37
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166091817 Original CRISPR CTGCAGGCACAGTAGGGGCA AGG (reversed) Intronic
900126697 1:1071975-1071997 CTGCAGGGACTGGAGGCGCATGG - Exonic
900161842 1:1227618-1227640 CTGGAGGCAGAGCAGGGTCAGGG - Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900759971 1:4463830-4463852 CTGCAGGCCAAGCAGGGCCATGG - Intergenic
901028220 1:6290473-6290495 CTGAGGGCACAGCAGGGCCATGG - Intronic
901062050 1:6476068-6476090 CTGCAGGCTAAGGAGGGGCGGGG - Intronic
901624719 1:10617483-10617505 CCGCAGGTACAGTGGGGGCTGGG - Intronic
903047314 1:20574589-20574611 CTGCAGGCACAGTGGGGCATGGG + Intergenic
904032499 1:27541960-27541982 CTGCAAGCCCTGTGGGGGCAGGG + Intronic
904619438 1:31766497-31766519 CCGGGGGCTCAGTAGGGGCAAGG + Intergenic
904732839 1:32607483-32607505 CTGCCGATTCAGTAGGGGCAGGG + Intronic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
905795400 1:40813316-40813338 ATTCAGGCACAGTGGAGGCAGGG + Intronic
910342478 1:86203435-86203457 CTGCAGTCACAGGACGAGCAGGG - Intergenic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912471888 1:109911872-109911894 CTACCGCCACAGTTGGGGCAGGG - Intronic
912949318 1:114109935-114109957 CTAAAGACACAGAAGGGGCAGGG + Intronic
917671092 1:177274271-177274293 CTGCAGGCATCCTGGGGGCAGGG + Intronic
917837598 1:178953469-178953491 CTGGAGGGACAGTAGGGGTGAGG + Intergenic
920194364 1:204217060-204217082 CTGGAGGCATAGAAGTGGCAGGG + Intergenic
920200572 1:204257527-204257549 CTGCAGGGACAGGCGGCGCAGGG + Exonic
920535335 1:206733432-206733454 TGGCAGGCTCAGTATGGGCAGGG - Exonic
920960283 1:210657388-210657410 CTGCAGTCACAGTGGGCACATGG + Intronic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
922801419 1:228366377-228366399 CTGGAGGCACAGGACCGGCAGGG - Intronic
923021611 1:230168438-230168460 CTCCGGGGACAGGAGGGGCAAGG - Intronic
924481504 1:244439496-244439518 TCCCAGCCACAGTAGGGGCAGGG - Intronic
924728234 1:246689759-246689781 CTGCAGTCACTGTAGGAGCGGGG - Intergenic
1062971689 10:1653603-1653625 CTGCAGGCACAGAAGGCGTTGGG - Intronic
1062971695 10:1653640-1653662 CTGCAGGCACAGAAGGTGTTGGG - Intronic
1063071478 10:2671062-2671084 GTGCAGGCAGAGGCGGGGCAGGG - Intergenic
1063199717 10:3776182-3776204 GTGGAGGCACAGAAGTGGCAGGG + Exonic
1065349565 10:24783275-24783297 TACCAGGCACAGCAGGGGCATGG + Intergenic
1065439152 10:25731461-25731483 TTGCCCGGACAGTAGGGGCAGGG - Intergenic
1065553064 10:26888465-26888487 CTGCAGGGACAGTGAGGCCAGGG - Intergenic
1065589580 10:27251556-27251578 CTGCTGGGGCAATAGGGGCATGG + Intergenic
1065992711 10:31028833-31028855 CTGTAGGTTCCGTAGGGGCAAGG - Intronic
1067549446 10:47223537-47223559 CACCAGGCTCAGTGGGGGCAGGG + Intergenic
1067551444 10:47239210-47239232 GTGCATGCACAGGAGAGGCAAGG - Intergenic
1067563855 10:47322694-47322716 CAGCAGGGACAGCAGGGGCAGGG - Exonic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1072740685 10:97907345-97907367 CTGCAGGTAGAGAAGGGGGAGGG + Intronic
1075015221 10:118905727-118905749 ATGCAGGCAGAGGAGGGGCTTGG + Intergenic
1075715669 10:124553834-124553856 CTGCAGACAGAGGAGGGGCCTGG - Intronic
1075815193 10:125259736-125259758 CTGCACCCACAGGAGGGGCAGGG + Intergenic
1076071425 10:127493073-127493095 GTGCAGGCACAGCAGGGACATGG - Intergenic
1076092803 10:127702906-127702928 CTGCAGGCACAGCAGTGGTGTGG - Intergenic
1076744896 10:132507922-132507944 CTGGAGCCACAGCAGGGTCACGG + Intergenic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077226965 11:1442785-1442807 CTCCCGGCACAGTAAGGGTAGGG + Intronic
1077496035 11:2886792-2886814 CTGCAGGCGGGGGAGGGGCATGG - Intergenic
1077496802 11:2890583-2890605 GTGGAGGCTCAGTGGGGGCAGGG - Intronic
1077564167 11:3285918-3285940 CTGAAGGCTCAGCAGGGGAAGGG - Intergenic
1077570057 11:3331735-3331757 CTGAAGGCTCAGCAGGGGAAGGG - Intergenic
1078097727 11:8310952-8310974 CTGGGGGCCCAGGAGGGGCAGGG - Intergenic
1079032973 11:16999327-16999349 CTGCAGGCAGAGGAGGGCCTGGG - Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1080653725 11:34242430-34242452 ACGCAGCCACAGGAGGGGCAGGG + Intronic
1081659077 11:44876981-44877003 CTGCAGGCTCTGCAGGGGCCTGG - Intronic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083594994 11:63914955-63914977 CTGCAGGGGCAGCAGGGGCAGGG + Intronic
1083633927 11:64109866-64109888 CGGAAGGCACAGCAGGAGCAGGG + Intronic
1083764649 11:64836059-64836081 CTCCAGGCACACTGGGGGCAGGG + Intronic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1084378723 11:68796960-68796982 CCGCAGGCTCAGCAGGGGCCAGG + Intronic
1084705565 11:70814376-70814398 CTGCTGGCAGAGTAGGGGTGAGG - Intronic
1087268912 11:96091317-96091339 CTGCAAGCACAGTAAGGAAAGGG - Intronic
1087534514 11:99425779-99425801 CTGCCAGCTCAGTAGGGGCATGG + Intronic
1087549686 11:99633293-99633315 ATGCAGGCATAGCAGGAGCAAGG - Intronic
1088693041 11:112344052-112344074 CTGGAGGCACAGTGGGGGTGGGG + Intergenic
1089009149 11:115118788-115118810 CTTGAGGAACAGCAGGGGCAAGG - Intergenic
1089329590 11:117680322-117680344 CTGCACCCACAGGAGGGTCAGGG - Intronic
1089806630 11:121096462-121096484 CTTTAGCCAGAGTAGGGGCAGGG + Intergenic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1091170754 11:133517901-133517923 CACCAGGCACAGAATGGGCAAGG + Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1092231804 12:6779934-6779956 CTGCTGGAGCAGGAGGGGCATGG + Intergenic
1092770207 12:11889886-11889908 GTGCAGGCACAGAAGGGGACTGG + Intronic
1096111754 12:49033168-49033190 CAGCTGGCACAGCAGGGTCAGGG - Exonic
1100186932 12:92148740-92148762 CTGAAGGCACATTAGGGCCAGGG + Intergenic
1100407330 12:94283115-94283137 CTGCAGGCTCTGTGAGGGCAGGG - Intronic
1102123916 12:110465055-110465077 CTTCAGGAACAGTAAGGGCTGGG - Intronic
1102199544 12:111047932-111047954 GTGCAGGCACAGTTCAGGCAGGG + Intronic
1103405796 12:120674428-120674450 CTACAGGCACAGCAGGATCAGGG - Intergenic
1103704054 12:122861891-122861913 CTGCAGGCTCAGTAAGGGCCAGG - Exonic
1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG + Intronic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1104037030 12:125104654-125104676 CTGCAGGCAAAGTGGTGGCTTGG + Intronic
1104729441 12:131096990-131097012 CTGCAGCCACAGCAGAGGCGTGG - Intronic
1104939884 12:132390085-132390107 GTGCAGGCACAGGAGTGCCAAGG - Intergenic
1104947627 12:132423623-132423645 CTGCAGGCGGAGCAGGGGCTGGG + Intergenic
1107414542 13:40188537-40188559 CTGAAGCCACAGGAGGGGAAGGG + Intergenic
1109269330 13:60236800-60236822 CTGCAGGCTGCGTAGGGGCTAGG + Intergenic
1109914226 13:68959483-68959505 CTCCAGGCAATGCAGGGGCAGGG - Intergenic
1111668949 13:91304000-91304022 TTGCAGGCAGATTAGTGGCATGG - Intergenic
1112805168 13:103156789-103156811 GTGCAGGCAAAGCTGGGGCAGGG - Intergenic
1112937337 13:104817385-104817407 CAGCATGCACAGCAGGGGAAGGG + Intergenic
1113978657 13:114252373-114252395 GTACAGGCACAGTAGGGGTTAGG + Intronic
1114405380 14:22451359-22451381 CTGCAGGGAGAAAAGGGGCAGGG + Intergenic
1114555766 14:23561436-23561458 CAGAAGGGACAGAAGGGGCAGGG + Intronic
1114614096 14:24059256-24059278 CTGCAGGGACTGTGTGGGCAAGG - Exonic
1118755909 14:68843577-68843599 CTGCAGGCTCTGTGAGGGCAGGG + Intergenic
1119190110 14:72675620-72675642 CTGGAGGCAAAGCAGAGGCATGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119738832 14:77000756-77000778 CTGCAGGGATAGGAGGGGCCCGG - Intergenic
1119850670 14:77864384-77864406 GAGCAGGCACTGTAGGCGCAAGG + Intronic
1120798697 14:88665664-88665686 CAGTAGGCAGAGTAGGGGAAGGG + Intronic
1121043744 14:90773084-90773106 CTTCAGGGACAGGAGGGGCAAGG + Intronic
1121269403 14:92627909-92627931 CTGCATGCAAAGCAGAGGCAAGG + Intronic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1127045082 15:55017192-55017214 CTGCAGGCACTGTTGGCTCAGGG + Intergenic
1128449139 15:67792010-67792032 CACCAGGCAGAGGAGGGGCAGGG + Intronic
1129421407 15:75430249-75430271 CTTCATACACAGGAGGGGCAGGG + Exonic
1130666444 15:85873659-85873681 CTGCAGACACAATACAGGCAGGG + Intergenic
1130743671 15:86627763-86627785 CAGCAGGGTCAGTAGTGGCAGGG + Intronic
1132855501 16:2042917-2042939 CTGCGGGGACAGGAGGGGAATGG - Intronic
1132878290 16:2149814-2149836 CTGCAGGCTCAGCGGGGCCAGGG - Intronic
1133099500 16:3470571-3470593 CTGCAGTCACAGCAGGCCCAAGG - Intronic
1133507216 16:6423781-6423803 CTGCAGGCCCAGGAAGGCCATGG + Intronic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136377241 16:29872744-29872766 CTGCAGGGAGAGGAGGGGGAGGG + Intronic
1136991421 16:35153392-35153414 CTGGAAGCACAGTGGGGTCAAGG + Intergenic
1138345308 16:56316732-56316754 CTGCAGGCACGGGCAGGGCAGGG + Intronic
1138456358 16:57123315-57123337 CTGCAACCTCAGTAGGGACAAGG - Intronic
1138608659 16:58105737-58105759 CTGCAGACAGAGGAGGGGCCAGG - Intergenic
1139922789 16:70470436-70470458 CAGCAGGCACCGGAGGGGCAGGG - Intronic
1141679448 16:85535773-85535795 CTGCAGGCAGAGTAGGGGTGAGG - Intergenic
1142147956 16:88500262-88500284 CGGCAGGCCCAGGAGGGGCAAGG - Intronic
1142266864 16:89068002-89068024 GGGCAGGCAGATTAGGGGCAGGG - Intergenic
1143848120 17:9788523-9788545 CTGCAGACACAGTGGGTACAAGG + Intronic
1144831953 17:18136764-18136786 CTGCAGGCACAGAAAGGGATGGG - Intronic
1147215010 17:38893916-38893938 AGGCAGGCCCAGAAGGGGCATGG - Intronic
1147605403 17:41771387-41771409 CTGGAGGCACCCTAAGGGCAGGG + Intronic
1147945372 17:44077560-44077582 CTGCTGGCACAGCCTGGGCAAGG - Exonic
1148174227 17:45550098-45550120 CTGCTGGGAGAGTAGGCGCATGG + Intergenic
1148210527 17:45805956-45805978 CTGCATGCTCTGTAGGGGCAGGG - Intronic
1148275035 17:46295349-46295371 CTGCTGGGAGAGTAGGCGCATGG - Exonic
1148297142 17:46512928-46512950 CTGCTGGGAGAGTAGGCGCATGG - Exonic
1148361698 17:47017408-47017430 CTGCTGGGAGAGTAGGCGCATGG - Intronic
1148821899 17:50364677-50364699 CTGCAGGCAGGGAAGGGACAGGG + Intergenic
1149397589 17:56260734-56260756 CACCAGGCACAGTAGAAGCATGG + Intronic
1149521815 17:57323496-57323518 CTGCAGGGACAGGAGGGCAAAGG - Intronic
1149639703 17:58194816-58194838 CTCCAGGGACAAAAGGGGCATGG + Intronic
1150405445 17:64897020-64897042 CTGCTGGGAGAGTAGGCGCATGG + Exonic
1151473089 17:74330048-74330070 CTGTGGGCACAGTAGAGCCATGG + Intronic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152442661 17:80318402-80318424 CCCCAGGCACAGGAGGGGCCAGG + Intronic
1154105374 18:11518224-11518246 GTGCAGACACAGTAGGGCCATGG + Intergenic
1154107376 18:11534249-11534271 CTGCGGCCACAGCAAGGGCACGG + Intergenic
1154218240 18:12431434-12431456 CTGCAGGGAGAGAAGGGGCTGGG - Exonic
1155120843 18:22816926-22816948 CTGCAGCCACAATTCGGGCAGGG + Intronic
1157332264 18:46712542-46712564 CTGCAGGCACAGAGGAGGGAGGG - Intronic
1157718828 18:49907878-49907900 CTGAAGGCCCAGTGGGTGCATGG - Intronic
1158572940 18:58612113-58612135 CTGCAGACACTGCAGGGGAATGG + Intronic
1158624791 18:59061777-59061799 CTGCAGGCCCATTTGGGCCAGGG + Intergenic
1159413418 18:68111381-68111403 TTGCAGCCAGAGAAGGGGCAAGG - Intergenic
1160191875 18:76721497-76721519 CATGGGGCACAGTAGGGGCAGGG + Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1161021358 19:2013223-2013245 CTGCGGGCACTGGAGGGGGAGGG - Intronic
1161316595 19:3620273-3620295 CTGCAGGCACAGGAGGCTGAGGG + Intronic
1161756456 19:6137568-6137590 CTGCAGGCAGAGGAGAGACAGGG + Intronic
1161793923 19:6375799-6375821 CTGCAGGGACAGGAGCAGCAGGG + Exonic
1162127447 19:8507042-8507064 CTGCAGGGAGAGGAGGGGCTTGG - Intergenic
1162403166 19:10458107-10458129 GTGGGGGCTCAGTAGGGGCAGGG + Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1166053433 19:40274710-40274732 CTGCAGGCAGGGGAGGAGCAGGG + Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166806128 19:45488477-45488499 CTGCCGGTACAGCAGGGGGATGG + Exonic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
925846917 2:8043039-8043061 CTGCAGGGACAGAGGGGCCATGG + Intergenic
925920004 2:8631946-8631968 ATGCAGGCAGATTAGGGGGAAGG + Intergenic
926478080 2:13352982-13353004 TTGTGGGCAGAGTAGGGGCAAGG + Intergenic
926719001 2:15944918-15944940 CTGAAAGCACAGTTGGGGTATGG + Intronic
928491960 2:31793583-31793605 CTGCTGGCTCAGTAGGGCCATGG + Intergenic
928767371 2:34663278-34663300 CTGCAGGTCCAGTAGGGAGATGG + Intergenic
928948112 2:36790285-36790307 ATGCAGGCAGAGGAGGGGAAGGG - Intronic
929948487 2:46388494-46388516 CTGCATGATCAGAAGGGGCAGGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930492627 2:52094056-52094078 CTGCAGGGAGAATAGGGGCATGG + Intergenic
932594201 2:73084021-73084043 CTGCAGGGACAAGAGCGGCAGGG + Intronic
932880075 2:75493162-75493184 CTGCAGGGACAGTGGGCACAAGG - Exonic
934662905 2:96152709-96152731 CTCCAGGATCAGCAGGGGCAGGG + Intergenic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
936021873 2:109001350-109001372 GTGGGGTCACAGTAGGGGCAGGG + Intergenic
936052622 2:109236290-109236312 CTGCATGCAGTGTCGGGGCAGGG + Intronic
936111861 2:109671287-109671309 CTGCAGCCAGGGCAGGGGCAGGG + Intergenic
936504220 2:113092212-113092234 ATCCAGGCAGAGTAAGGGCAAGG + Intergenic
937906094 2:127053553-127053575 CAGCAGGCACAGGAGTGGCTCGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938080754 2:128368871-128368893 CTGCAGGTAGACTAGTGGCACGG + Intergenic
940286579 2:152038549-152038571 CTGGAGGCACAGAAGAGGAAAGG + Intronic
940779707 2:157919505-157919527 GTCCATGCACTGTAGGGGCATGG + Intronic
942310747 2:174654646-174654668 CTGCAGACATAATAAGGGCAAGG - Intronic
945058651 2:205889528-205889550 CTGGAGGCACAGGAAGGGCAGGG + Intergenic
945680121 2:212903712-212903734 ATGAATGCACAGTAGAGGCAGGG + Intergenic
945923240 2:215777760-215777782 CTGCAGCCAGGGTAGGGGTAGGG + Intergenic
946411330 2:219516742-219516764 CTGCAGGCATGGTGGGGGCCAGG - Intronic
946804041 2:223452042-223452064 CTGCAGGCAGAGCTGGCGCAGGG + Intergenic
947187085 2:227465046-227465068 CTCCGGGCACCGCAGGGGCAGGG + Intergenic
948300229 2:236900558-236900580 GTGCAGGGAAAGTAGGAGCAGGG + Intergenic
948371566 2:237492885-237492907 CTGCAGGCTCTGTGTGGGCAGGG - Intronic
948434415 2:237943627-237943649 CTGCCGACTCAGTAGGGGCCGGG - Intergenic
948600969 2:239107287-239107309 CTGCAGCCAGATTCGGGGCAGGG + Intronic
948801175 2:240434351-240434373 CCCCAGGCACAGAAGGGGTAGGG + Intergenic
948838299 2:240636796-240636818 ATGCAGGAACAGAAGGGGGAGGG - Intergenic
949041507 2:241851967-241851989 CTGCAGGGACAATAGGAGCCAGG - Exonic
1168753644 20:300847-300869 CTGCAGGCAGAATAGGGTCAAGG + Intergenic
1170626529 20:18034310-18034332 CTACAGGCAAGGTGGGGGCAGGG - Intronic
1170962445 20:21037392-21037414 CTGCAGGGCCAGGAGGGGCAGGG + Intergenic
1171288234 20:23961177-23961199 CTTCAAGCAGAGGAGGGGCATGG + Intergenic
1172227811 20:33316929-33316951 CTGAAGGCAGAGTAGGTGCTGGG - Intergenic
1172883547 20:38217050-38217072 CTGGGGGCACAGCAGGGACAGGG - Intronic
1173318929 20:41970066-41970088 CTCCAGGCATGGTAGGGGGATGG + Intergenic
1175767151 20:61599491-61599513 CTCCAGCCACAGTGGGGTCAGGG - Intronic
1175817131 20:61889082-61889104 CTGCAGGCACAGCAGGGCTGGGG - Intronic
1176379313 21:6103916-6103938 CAGCAGGGACAGTCGGAGCAGGG + Intergenic
1178686893 21:34718972-34718994 CTGAAGGCAGAGTTGGGACAGGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179744160 21:43434321-43434343 CAGCAGGGACAGTCGGAGCAGGG - Intergenic
1181044469 22:20207961-20207983 CAGCAGGCAAGGTAGGGGGACGG - Intergenic
1181088944 22:20458890-20458912 CTGCAGGCTCTGTAAGGGCAGGG + Intronic
1183172820 22:36200484-36200506 CGGCAGCCACAGCAGGGGCTAGG - Intronic
1183177375 22:36234008-36234030 CGGCAGCCACAGCAGGGGCTGGG - Intronic
1183188409 22:36305880-36305902 CTGCACGCACAGCAGGGCCCAGG + Intronic
1183461563 22:37953983-37954005 CTGGAGGCACAGGAGGGCCCAGG + Intronic
1184121257 22:42451927-42451949 CTGGAGGCACAAAACGGGCAAGG + Intergenic
1184150527 22:42635773-42635795 CAGCAGGCACAGGAGGGGTGTGG - Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184477331 22:44728827-44728849 CTGGAGGCTGAGAAGGGGCAGGG - Intronic
1184651153 22:45920037-45920059 CTGCGGGGACAGGAGGGCCATGG - Intergenic
1185340871 22:50290543-50290565 CAGCAGGCCCAGCAGGGTCAGGG + Exonic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
949490260 3:4582312-4582334 CTACAGACACAGTAGGAACATGG - Intronic
949894623 3:8760042-8760064 CTGCAGGTCCAGTTGGCGCATGG - Intronic
950431532 3:12953851-12953873 CTACCTGCACAGTGGGGGCAAGG + Intronic
950782231 3:15401903-15401925 CCATAGGCACAGTAGTGGCATGG - Intronic
951647932 3:24914361-24914383 CTGCAGGAATATTGGGGGCAGGG + Intergenic
953127126 3:40102146-40102168 CTCCAGGCACATCAAGGGCAGGG - Intronic
953981041 3:47413090-47413112 CTGCAGGCCCATAACGGGCAAGG + Exonic
954034530 3:47844037-47844059 CTGATGGCACAGTAGTGGGAGGG + Intronic
955510978 3:59679938-59679960 CAGCAGGGGCAGCAGGGGCAGGG - Intergenic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
957296201 3:78335846-78335868 CTGGAGGCTCAGTATGGACAAGG - Intergenic
959068226 3:101678586-101678608 CTTCAGGCCCAGTAGAGACAGGG - Intergenic
961524775 3:127489749-127489771 ATGCAGTCACAGTGGAGGCAAGG - Intergenic
961838189 3:129682519-129682541 CAGCAGGCACTGTAGGCTCAGGG - Intronic
962308783 3:134311651-134311673 CTCCAGGGGAAGTAGGGGCAGGG - Intergenic
962686033 3:137848449-137848471 CTGAAGGCACTGTAGGATCAGGG - Intergenic
962915262 3:139895632-139895654 CTGGAGGGAAAGTAGGGGCATGG - Intergenic
967997815 3:195180010-195180032 CTGCAGGCAGAGTCGGGCCAGGG + Intronic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968899407 4:3423979-3424001 CAGCAGGTGCAGTGGGGGCAGGG - Intronic
970075228 4:12210803-12210825 CTGGAGTCAGAGTCGGGGCAGGG + Intergenic
972195598 4:36649920-36649942 CTGCAGGCACAGCAGCTTCAAGG + Intergenic
972654881 4:41054940-41054962 CTGAAGGTTCAGTAGGTGCAGGG - Intronic
975272255 4:72449683-72449705 CTGCAGGTATAATAGGGGCCAGG - Intronic
976599920 4:86928516-86928538 CTGAAGGCAGAGTAGAGGAAGGG + Intronic
977340293 4:95749479-95749501 ATATAGGCCCAGTAGGGGCAAGG - Intergenic
981148593 4:141354561-141354583 CAGCTGGCTCAGTAGAGGCATGG + Intergenic
985677758 5:1241050-1241072 GTGCAGGCTCAGGAGGGGCGCGG + Intronic
985726298 5:1517523-1517545 CTGCAGGCACAGGAGGCACCGGG + Intronic
986220063 5:5760679-5760701 CTGAAGGCTCAGTCAGGGCATGG - Intergenic
990157562 5:52896256-52896278 CTGAAGGCAGAATAGCGGCAGGG + Intronic
994078411 5:95679532-95679554 CTGCAGGCACAGTAGTAACATGG - Intronic
996844445 5:127883970-127883992 CTGCAGGCACAGAAAGGGAAAGG + Intergenic
997255901 5:132427744-132427766 CTGCAGGAATGGGAGGGGCAGGG + Intronic
998007816 5:138668709-138668731 CTGAAGGCACGGGAGGGGCCGGG - Intronic
998097325 5:139403619-139403641 CTGCCTGCACAGGAGGGCCATGG + Intronic
998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG + Intergenic
998918702 5:147043658-147043680 CTGCATGCTCAGTATGTGCAAGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999845665 5:155476661-155476683 CTGCAGGCACAGTTGGTAAAAGG + Intergenic
1001759273 5:174194120-174194142 CTGAATACACAGTAGGGACAGGG + Intronic
1002160092 5:177309939-177309961 CTCCAGGGACAGGAGGGGAAAGG - Intronic
1002603918 5:180370844-180370866 CTGCAGGCAGGGCAGGGGCCAGG + Intergenic
1002640449 5:180628269-180628291 CTGCAGGCTCTGGGGGGGCATGG - Intronic
1004300475 6:14453093-14453115 CTAGAGGCTCAGTGGGGGCATGG + Intergenic
1004321826 6:14637801-14637823 CTGCTGGCATAGTAGGCACATGG - Intergenic
1004482200 6:16031623-16031645 CTGCATGCACACTAGAGGGACGG + Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005364677 6:25064951-25064973 CTCCAGACACAGTAGAGTCAGGG + Intergenic
1006386323 6:33733081-33733103 CTGCAGGCAGAGTAGGTGGCCGG + Intronic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006447819 6:34089816-34089838 CTGGAGGGACAGGAGAGGCATGG - Intronic
1006630706 6:35427830-35427852 CTGCAGCGCCCGTAGGGGCAGGG - Exonic
1007386662 6:41524724-41524746 TGGCAGGCAGAGCAGGGGCAGGG + Intergenic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1015804204 6:137092150-137092172 CTGCAGCAACAACAGGGGCAAGG - Intergenic
1015812878 6:137178921-137178943 ATGGAGACACAGTAGGTGCAGGG + Intergenic
1016977417 6:149822962-149822984 CTGCAGTCACAATAGGGGTTAGG + Intronic
1017045365 6:150342244-150342266 CAGAAGGCACAGTTGGGTCAGGG + Intergenic
1018018037 6:159729749-159729771 CTGCAGACACTGTAGTAGCAAGG - Intronic
1018156455 6:160989961-160989983 CTGAAGACAAAGTGGGGGCACGG + Intergenic
1019144946 6:169970548-169970570 CTGCAGGCACAGGAGGCCCCGGG - Intergenic
1019659494 7:2216067-2216089 GTGCAGACCCTGTAGGGGCAGGG - Intronic
1019704947 7:2493160-2493182 CTGGATGGACAGTGGGGGCATGG + Intergenic
1019719678 7:2560449-2560471 CTGCACCCGCAGTAGGGGCTTGG + Intronic
1020258185 7:6514338-6514360 CTGCAGGCAGGGAAGTGGCAGGG + Intronic
1021839324 7:24709708-24709730 CTGCAGGCACATCCTGGGCATGG + Intronic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023807003 7:43879382-43879404 GTGCAGGCACAGGAGGCTCAGGG + Intronic
1024202649 7:47122382-47122404 CAGCAGGGACATTTGGGGCAGGG - Intergenic
1024469697 7:49754884-49754906 CTGCAGGCATGGGAGAGGCATGG + Intergenic
1026302024 7:69106440-69106462 CTGTAGGCAGAGCAGCGGCATGG + Intergenic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029283302 7:99450361-99450383 CTGCAAGCACGGTAGGTGCCAGG + Exonic
1029747706 7:102525586-102525608 ATGGAGCCACAGTGGGGGCATGG + Intergenic
1029765657 7:102624676-102624698 ATGGAGCCACAGTGGGGGCATGG + Intronic
1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG + Intergenic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1032791093 7:135243012-135243034 CTGCAGGCTCACTAAGGACAGGG - Intronic
1033319874 7:140329864-140329886 CTAAAGGCACAGAAGAGGCAAGG + Intronic
1034186269 7:149179574-149179596 CTCCTGCCACAGTAGGAGCAGGG - Exonic
1034997266 7:155585905-155585927 CTGCAGGTGCAGTGGGGGCCAGG - Intergenic
1035201452 7:157269895-157269917 CTGCAGGCTCACGATGGGCAGGG - Intergenic
1035485665 7:159223213-159223235 CAGTAGGCACAGTTAGGGCAGGG + Intergenic
1035999663 8:4586822-4586844 CTGCACGCACAGTAGGATCATGG + Intronic
1036062233 8:5336393-5336415 CTCCAAGCACCGTAGGGGGATGG + Intergenic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1038342288 8:26696716-26696738 CAGCAGGCCCAGTAGGTACAAGG - Intergenic
1038765728 8:30426002-30426024 CTGCAGGCACTCTTTGGGCACGG - Intronic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1041441200 8:57898859-57898881 CATCAGGCACAGCAGGTGCAGGG - Intergenic
1042529732 8:69802723-69802745 CTCCAGGCAGAGGAGTGGCAGGG - Intronic
1046195600 8:110859982-110860004 CTGCAGGCTCAGTGGAGCCAGGG + Intergenic
1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG + Intronic
1047462322 8:125078382-125078404 CTACAAGCTCAGTAGGGGCAGGG + Intronic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048938920 8:139379899-139379921 CGGCCAGCACAGTACGGGCATGG + Intergenic
1049363387 8:142224956-142224978 CTGCAGGCTCAGGTGGGGAAGGG - Intronic
1049594587 8:143477534-143477556 CTGCAGGCCCAGCAGGTGCATGG + Intronic
1049630411 8:143651704-143651726 GAGCTGGAACAGTAGGGGCAGGG + Exonic
1049674810 8:143884718-143884740 CTGCAGGAACAGGAGGTGCAGGG - Intergenic
1050030000 9:1375889-1375911 CTACAGGCAGAGCAGTGGCATGG + Intergenic
1050030221 9:1378236-1378258 CTGCAGGCCCAGAAGGCTCAGGG - Intergenic
1050141979 9:2525463-2525485 CTGTAGGCAGAGCAGTGGCATGG - Intergenic
1051613633 9:18985698-18985720 CTGCCGGAACAGAAAGGGCAGGG - Intronic
1052024975 9:23564148-23564170 CTACATGTACAATAGGGGCATGG + Intergenic
1053139423 9:35673585-35673607 CTCCAGGCACAGAAGGGGAAAGG - Intronic
1053165311 9:35840305-35840327 TTGAAGGCAGAGTTGGGGCAGGG + Intronic
1056194814 9:84219071-84219093 CTGCAGGCACCGCAGCAGCAAGG - Intergenic
1056466013 9:86855655-86855677 TTGCAGACACAATAGGGTCAGGG - Intergenic
1057827690 9:98383326-98383348 CTGCAGGCACAGTGAAGCCAGGG + Intronic
1060143307 9:121229174-121229196 CTGAAGACAAAGTAGGGGGAGGG - Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062443233 9:136582857-136582879 CTCCAGGCACCTTAAGGGCAAGG - Intergenic
1062638039 9:137501662-137501684 CTGCAGGCACGGTGGTGTCAAGG - Exonic
1187447695 X:19373206-19373228 ATGCAGGGACAGAGGGGGCAAGG + Intronic
1188733474 X:33682347-33682369 CTGCATTAACAGTAGGTGCATGG + Intergenic
1194041292 X:88944948-88944970 CTGCATGCACACTAGGAGGATGG + Intergenic
1195128931 X:101836309-101836331 AGGCAGGCACAGTAGGGATATGG - Intronic
1197016837 X:121635227-121635249 TAGCAGTCAGAGTAGGGGCATGG + Intergenic
1199000690 X:142632828-142632850 CTGCAGGCAGTGTAGATGCAGGG + Intergenic
1199606673 X:149584305-149584327 CTGGGGTGACAGTAGGGGCAGGG + Intronic
1199632450 X:149785063-149785085 CTGGGGTGACAGTAGGGGCAGGG - Intronic
1199878366 X:151953371-151953393 CTGCTGGCACACCAGTGGCAAGG - Exonic
1199894243 X:152116501-152116523 CTGGAGTGACAGCAGGGGCAGGG + Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200897006 Y:8386330-8386352 CTGGAGGCACAGTACAGGCAGGG + Intergenic