ID: 1166094667

View in Genome Browser
Species Human (GRCh38)
Location 19:40531168-40531190
Sequence AGGGGGCTTTACTTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166094659_1166094667 4 Left 1166094659 19:40531141-40531163 CCCTCCATCATGAAGGAATCACT 0: 1
1: 0
2: 3
3: 11
4: 158
Right 1166094667 19:40531168-40531190 AGGGGGCTTTACTTTGAGGATGG 0: 1
1: 0
2: 1
3: 7
4: 160
1166094660_1166094667 3 Left 1166094660 19:40531142-40531164 CCTCCATCATGAAGGAATCACTT 0: 1
1: 0
2: 1
3: 13
4: 346
Right 1166094667 19:40531168-40531190 AGGGGGCTTTACTTTGAGGATGG 0: 1
1: 0
2: 1
3: 7
4: 160
1166094661_1166094667 0 Left 1166094661 19:40531145-40531167 CCATCATGAAGGAATCACTTTTG 0: 1
1: 0
2: 0
3: 22
4: 247
Right 1166094667 19:40531168-40531190 AGGGGGCTTTACTTTGAGGATGG 0: 1
1: 0
2: 1
3: 7
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166094667 Original CRISPR AGGGGGCTTTACTTTGAGGA TGG Intronic
901120742 1:6891116-6891138 GGGAGGCTTGCCTTTGAGGAAGG - Intronic
901138440 1:7012512-7012534 AGGGGGCCTGGCTTGGAGGAGGG - Intronic
901659425 1:10789203-10789225 AGGGGGCTTTGCTAGGAGCAAGG - Intronic
901727883 1:11256688-11256710 AGGAGGCAGTACTGTGAGGAGGG - Intronic
902248785 1:15139880-15139902 AGCGGGCTTTGCTTGGAGGCTGG - Intergenic
903653612 1:24935486-24935508 AGGGTGCTCTGCTTTGAGGATGG + Intronic
905456853 1:38094338-38094360 TAGGGGCTTTGCTGTGAGGATGG - Intergenic
905664618 1:39755483-39755505 AAGGGGCTGTGCTTTGAGGGAGG - Intronic
907432808 1:54423715-54423737 AGGGGGCATAACCTTGAGTAAGG - Intergenic
912898598 1:113621990-113622012 ATGGGGATTTCCTCTGAGGAGGG + Intronic
913286740 1:117233518-117233540 AGGGGGCATGACTTTGGAGAAGG - Intergenic
913584399 1:120259417-120259439 TGGGGGCTTCACGTTGAGCAGGG + Intergenic
913623782 1:120638921-120638943 TGGGGGCTTCACGTTGAGCAGGG - Intergenic
914566395 1:148871294-148871316 TGGGGGCTTCACGTTGAGCAAGG + Intronic
914606424 1:149258946-149258968 TGGGGGCTTCACGTTGAGCAAGG - Intergenic
915108393 1:153548216-153548238 AGGGGGCTGGATTGTGAGGAGGG - Intronic
915544515 1:156588990-156589012 CAGGGTCTTTTCTTTGAGGATGG - Intergenic
917760181 1:178148206-178148228 AGGGGGCTTAACCATGAGTAAGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
919979126 1:202631488-202631510 AGGGGACTTTGCTTGGGGGAGGG - Intronic
920867025 1:209761682-209761704 AGGAGGCTTTCCTTTGAATATGG + Intronic
922822395 1:228493451-228493473 AAGGGGTTTTAAGTTGAGGAGGG + Intronic
923382378 1:233434439-233434461 AGGTGGCTGAATTTTGAGGAAGG + Intergenic
1063135079 10:3209075-3209097 AGGTGGTTTTATTTTGAGGAGGG + Intergenic
1064245462 10:13664379-13664401 AGGGAGCTTTACTAGGAGGTAGG + Intronic
1067277168 10:44846089-44846111 AGGGGAACTTAGTTTGAGGAGGG - Intergenic
1070885915 10:79898509-79898531 AGGGAGGCTTATTTTGAGGATGG - Intergenic
1073106731 10:101036551-101036573 AGGGGCCTTTACCTTGGTGAGGG - Exonic
1075394882 10:122120139-122120161 AGGAGACCTTACTGTGAGGACGG - Intronic
1078617650 11:12880486-12880508 AGGGGGCATGACATAGAGGAGGG - Intronic
1082252587 11:49997951-49997973 AGGGAGGTTTATTTTGAGAAAGG + Intergenic
1084026872 11:66456129-66456151 AGGGGGCTATCTTTTCAGGAGGG - Intronic
1084219170 11:67667066-67667088 AGGGGTCTAGAATTTGAGGAGGG + Intronic
1084596117 11:70118037-70118059 AGGGGGCTGGACTCTGAGGCTGG - Intronic
1086968937 11:93059561-93059583 ATGTGGCTTTAGTTTGTGGAAGG + Intergenic
1087484393 11:98743658-98743680 AGGGGGTTTTACTAACAGGAAGG + Intergenic
1087567320 11:99878327-99878349 AGTTGACTTTACTTTGATGAAGG + Intronic
1088171603 11:107004036-107004058 ATGGGGCATGACTTTGAGCAAGG + Intronic
1089235374 11:117020014-117020036 GTGGGGCTTTTCTTTGGGGAAGG - Intronic
1090005601 11:122999722-122999744 AGTGGGCTTTACTTCGTTGAGGG + Intergenic
1090364846 11:126197233-126197255 GTGGGGCTTTAGTTTCAGGATGG + Intergenic
1090451533 11:126810666-126810688 AGAGGTCTTTACATTGAAGAGGG + Intronic
1093811528 12:23498369-23498391 GGAGGGTTTTGCTTTGAGGAGGG - Intergenic
1094096835 12:26714916-26714938 AGGATGCCTCACTTTGAGGAAGG - Intronic
1100569635 12:95835374-95835396 AGGAGGCTCTAGTTTGGGGAAGG + Intergenic
1101490644 12:105206494-105206516 GAGAGGCTCTACTTTGAGGATGG - Intronic
1105282458 13:18975745-18975767 AGAGGGGTTTTCTTTGAGAAAGG - Intergenic
1107808381 13:44175741-44175763 AAGGTGCTTTATTGTGAGGACGG + Intergenic
1113822376 13:113223919-113223941 AATGGCCTTTATTTTGAGGAAGG - Intronic
1117164232 14:53017847-53017869 ATGGGGCCATATTTTGAGGAGGG - Intergenic
1119650617 14:76380518-76380540 TGTGGGCTTTACTTTGAAGGAGG - Intronic
1122953616 14:105059965-105059987 AGGGGGCATCACTTTGGAGATGG - Intronic
1124360386 15:29032668-29032690 ATGGGGCTGTGCTTTGGGGATGG - Intronic
1124494728 15:30179445-30179467 AGGGGACTTTGCTTGGGGGAGGG - Intergenic
1124748841 15:32359200-32359222 AGGGGACTTTGCTTGGGGGAGGG + Intergenic
1127923742 15:63517555-63517577 AGTGGGCTTCACTGTGAGGTGGG + Intronic
1128636097 15:69303437-69303459 TGGGAGGTTTTCTTTGAGGATGG - Intronic
1128899068 15:71402675-71402697 AGGAGGCTTAACCTTGAGGGAGG + Intronic
1131629477 15:94161176-94161198 AGGGGGCTTAACTTTAAGTGAGG + Intergenic
1131778462 15:95827931-95827953 AGGGGCCTTTCCTTGGATGAGGG - Intergenic
1132498970 16:276253-276275 AGGGGGGGTTACTATGGGGAGGG + Intronic
1132958326 16:2608438-2608460 AGTGTACTTTACTTTTAGGAAGG + Intergenic
1132970938 16:2688534-2688556 AGTGTACTTTACTTTTAGGAAGG + Intronic
1134291821 16:12907482-12907504 AGGGGGCTTTCCTGAGAGCAAGG + Intronic
1138668715 16:58595594-58595616 TGGGGACTTTATTTTGGGGAGGG + Intronic
1139098815 16:63740208-63740230 AGGGGGCTTTATTTTTTGGAAGG - Intergenic
1139558205 16:67726139-67726161 GGGGGGTTTTGTTTTGAGGAGGG - Exonic
1142491487 17:282574-282596 AAGGGGCTTTGCTTTAAGCAAGG + Intronic
1143889539 17:10092016-10092038 ATGGGATTTTACTTTGAGGAAGG - Intronic
1144829364 17:18122847-18122869 AGGAGGCTTTAATTTGGGGGAGG - Intronic
1145248690 17:21285637-21285659 AGGGGGCTGTACCTTAGGGAGGG - Intronic
1148505277 17:48122201-48122223 AGGGGCCTTTATTTTGGGAAAGG + Exonic
1149185433 17:53991764-53991786 AAGTCTCTTTACTTTGAGGAGGG - Intergenic
1149438347 17:56653327-56653349 AGGGAGCTTTAGTTTGTGCAGGG - Intergenic
1150924755 17:69521221-69521243 AAGGGGCTTTCCTTTGAGATTGG + Intronic
1152462008 17:80446394-80446416 AGGGGGCTTTTCTTTCATGATGG + Intergenic
1154112069 18:11578856-11578878 AGGGGGCTGTACTCAGGGGAAGG + Intergenic
1157638331 18:49184962-49184984 AGGAGGCTTTAGTTTTTGGAAGG + Intronic
1157957369 18:52113396-52113418 AGGAGGCTTTACCTTGGGAAAGG + Intergenic
1160894688 19:1396901-1396923 AGGTGGCTTTCATCTGAGGAAGG + Intergenic
1162489620 19:10984442-10984464 CGAGGGCCTTACTTGGAGGATGG + Intronic
1164171872 19:22732364-22732386 TGGGTCCTTTACTTGGAGGAAGG + Intergenic
1165951071 19:39474193-39474215 AGGGGGCATTTGTTGGAGGAGGG - Intronic
1166094667 19:40531168-40531190 AGGGGGCTTTACTTTGAGGATGG + Intronic
925682750 2:6440089-6440111 GGGGGTCTGTACTTTGTGGAAGG - Intergenic
932449617 2:71801293-71801315 AGGACTCTTTCCTTTGAGGAGGG + Intergenic
935502416 2:103857571-103857593 AGGGAGGTTTACCTTGAGGGAGG - Intergenic
936476540 2:112844726-112844748 AGGAGCCTTTCCTCTGAGGAGGG - Intergenic
936844129 2:116809678-116809700 AGCAGGCATTACTGTGAGGATGG + Intergenic
939649275 2:144741764-144741786 AGGGTGATGTACTTTGAAGATGG + Intergenic
940736099 2:157454001-157454023 AGGGGACTTGTCTTTGAGAATGG + Intronic
941614062 2:167698947-167698969 AGGTGGCTTCCCTTTGGGGATGG - Intergenic
941738982 2:169012800-169012822 AGGCTGCATTACTTTGAGTAAGG - Intronic
943753528 2:191535028-191535050 AGTGGGCTGTACATTGTGGAGGG + Intergenic
946527288 2:220534622-220534644 AGGGAGCTTTAGTTTTGGGAGGG - Intergenic
947448399 2:230182519-230182541 AGGGGGATTCACTTTGGGGTTGG + Intronic
948049556 2:234969326-234969348 AGGGGACTTGACCATGAGGAAGG - Intronic
948612821 2:239180594-239180616 TGGGGGCTTTACTTACAGAATGG - Intronic
948796047 2:240402531-240402553 AGGGGCCTTGGCTGTGAGGAGGG - Intergenic
1170983230 20:21235484-21235506 AGTGGTCTTTACTTGGAGAACGG - Intronic
1171177179 20:23061325-23061347 AGAGGGCTTTACTCTGAAGTAGG + Intergenic
1175177429 20:57120650-57120672 AAGGGGCCTGACTTTGAGGCAGG - Intergenic
1176429127 21:6565171-6565193 AGGGCGCTTTACTTGGCTGAGGG - Intergenic
1176690035 21:9895114-9895136 TTGGGGTTTTACTTTGAGAAGGG + Intergenic
1177586239 21:23100133-23100155 AGAGGGCTTTTAATTGAGGAAGG + Intergenic
1179704617 21:43173487-43173509 AGGGCGCTTTACTTGGCTGAGGG - Intergenic
1183508917 22:38223780-38223802 AGGGGGTTGTCCTTGGAGGATGG - Intronic
1184607190 22:45580909-45580931 AGGGGGCTTTACAAAGACGACGG - Intronic
951443324 3:22747768-22747790 AGGGGGCTTGACCTTGGAGAAGG - Intergenic
952815320 3:37442490-37442512 GGGGGTCTTTCCTTGGAGGAAGG - Intergenic
954456772 3:50603881-50603903 AGGTGGATTTTATTTGAGGATGG - Intergenic
955365797 3:58308814-58308836 TGGGGGCTTAACTTAGAGAAGGG + Intronic
960802962 3:121557350-121557372 AGAGAGGTTTAGTTTGAGGAAGG + Intergenic
961092750 3:124129145-124129167 AGGCAGCTTTTGTTTGAGGAAGG + Intronic
961611892 3:128146065-128146087 AGGGGGCTGTACTTTTAGAGAGG + Intronic
963921660 3:150911411-150911433 TGTGGGCTTTATTTTTAGGAAGG + Intronic
964807631 3:160629033-160629055 AGAGGGTGTTACTTTGAGGAGGG + Intergenic
968126969 3:196167188-196167210 AGGGTGGTTTAGTTTGGGGAAGG + Intergenic
969576014 4:8036229-8036251 AGATGGCCTTACTTTTAGGAAGG + Exonic
975236704 4:72006603-72006625 AAGGAGCGTTACTTTGAGGTTGG + Intergenic
978002161 4:103569221-103569243 AGAGGGTTTTTCTTTGAGGGAGG + Intergenic
978307534 4:107348151-107348173 AAGGGGCTTTGTTTTGAGAAGGG - Intergenic
980478022 4:133345447-133345469 AGGTGGCTTTAATTCCAGGAAGG - Intergenic
981632474 4:146836234-146836256 AGTTGTCCTTACTTTGAGGAGGG - Intronic
984902764 4:184599770-184599792 AGGGGGGTTTATTTTGGGAAAGG - Intergenic
991437682 5:66613543-66613565 AGGGGGCTCTACTGTGATGGGGG - Intronic
993466374 5:88251477-88251499 AGGGGGGATTAGTTTTAGGAAGG + Intronic
995917092 5:117261076-117261098 AGAGGGCTGTAATTTGAGGCTGG - Intergenic
996966248 5:129309488-129309510 AGGGGGATGGATTTTGAGGAGGG + Intergenic
1000281918 5:159789483-159789505 AGTGGGCTTTACTTTAAGGATGG - Intergenic
1000436919 5:161223124-161223146 AGTGGGCTTTACTCTTGGGATGG + Intergenic
1006234250 6:32614625-32614647 AGAGGGCTTTATTTCTAGGAAGG + Intergenic
1007228952 6:40334843-40334865 AGGGGGCTAGGCTTTGGGGAGGG - Intergenic
1007736811 6:43987111-43987133 AGAGGGCTTAACCTTGAGTAGGG - Intergenic
1009780604 6:68264176-68264198 AGAAGGCATGACTTTGAGGAAGG + Intergenic
1011177641 6:84582814-84582836 AGGGGACGTCACTTGGAGGAGGG - Intergenic
1012766900 6:103378190-103378212 GGGTGGATTTACTTTGTGGAAGG + Intergenic
1013288497 6:108700029-108700051 AGGGGGCTGTACAGTGAGGCTGG + Intergenic
1018957588 6:168420444-168420466 ACGGCGCTTTCCTTAGAGGAGGG - Intergenic
1019960360 7:4454366-4454388 ATGGGTCATTACTTTTAGGAGGG + Intergenic
1021854738 7:24843284-24843306 AGGGAGATTTTGTTTGAGGAGGG + Intronic
1022356294 7:29617734-29617756 AGGGGAATTGAGTTTGAGGATGG - Intergenic
1022888049 7:34666916-34666938 AAGGCCCTTTTCTTTGAGGAGGG - Intronic
1023890521 7:44388804-44388826 AGGGCACTTTACTCTGGGGAGGG + Intronic
1025709189 7:63891571-63891593 TGGGGCCTTCACTTTGGGGAGGG - Intergenic
1026147743 7:67762170-67762192 AAGGTGCTTTAGTTTGGGGAAGG + Intergenic
1027462569 7:78473499-78473521 ATGTGGATTTACTTGGAGGAAGG - Intronic
1027856516 7:83518779-83518801 AGGGAGCTTTCCTGAGAGGAAGG - Intronic
1032140061 7:129320744-129320766 AGGGGAATTTATTTAGAGGATGG - Intronic
1033261395 7:139846911-139846933 TGTGGGCTTTTCTTTGAAGAAGG + Intronic
1036203870 8:6791317-6791339 AGGTGGCTTTGGCTTGAGGAGGG + Intergenic
1041830440 8:62147505-62147527 GGGGGGCTTAACTTTCAGAATGG - Intergenic
1045413790 8:101946172-101946194 TGGGGGTCTTACTTTGAGAATGG + Intronic
1051851944 9:21519587-21519609 ATGGGGCTTTTCTTTGGGGCTGG + Intergenic
1053479094 9:38402784-38402806 GGGGGCCTTTACTCTGAGGAAGG + Intergenic
1055377159 9:75660955-75660977 AGGGGGAGTTCTTTTGAGGATGG + Intergenic
1057528237 9:95821386-95821408 TGGAGGATTTACTTTGAAGATGG - Intergenic
1057854333 9:98591016-98591038 AGGGAGCTTTCCATTCAGGAGGG + Intronic
1058890131 9:109354430-109354452 AGGGGGCATAACTTTGGGGTAGG - Intergenic
1059248903 9:112870834-112870856 AGGAAGCTTTACCTTGGGGAAGG + Exonic
1059830363 9:118088350-118088372 AGGTGGCGTAACTTTGAGGTGGG - Intergenic
1061448011 9:130652502-130652524 AGAGGCCTTTAGTGTGAGGAGGG - Intergenic
1062208422 9:135349814-135349836 AGGAGGCTCTACTTCCAGGATGG - Intergenic
1187659918 X:21532830-21532852 AGGAGCTTATACTTTGAGGAAGG + Intronic
1190442127 X:50485204-50485226 TGGGGGGTTTTTTTTGAGGAAGG + Intergenic
1194668187 X:96698605-96698627 AGGGGCTTTTTCTTTGGGGAAGG - Intronic
1196939050 X:120757803-120757825 ATGGGGATCTAATTTGAGGAAGG + Intergenic
1199823953 X:151478949-151478971 AGGGGGCTTTTTTTTGAGACAGG - Intergenic