ID: 1166096267

View in Genome Browser
Species Human (GRCh38)
Location 19:40541376-40541398
Sequence CAGCAGAGGGAGCCCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1193
Summary {0: 1, 1: 0, 2: 4, 3: 158, 4: 1030}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166096258_1166096267 5 Left 1166096258 19:40541348-40541370 CCAGCACGAGACTCCTGGGCCCT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG 0: 1
1: 0
2: 4
3: 158
4: 1030
1166096259_1166096267 -8 Left 1166096259 19:40541361-40541383 CCTGGGCCCTTTTCCCAGCAGAG 0: 1
1: 0
2: 1
3: 30
4: 315
Right 1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG 0: 1
1: 0
2: 4
3: 158
4: 1030
1166096255_1166096267 18 Left 1166096255 19:40541335-40541357 CCAGAGGCAGGCTCCAGCACGAG 0: 1
1: 0
2: 2
3: 15
4: 148
Right 1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG 0: 1
1: 0
2: 4
3: 158
4: 1030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166096267 Original CRISPR CAGCAGAGGGAGCCCGAGGC AGG Intronic
900231396 1:1560390-1560412 CAGCCTGGGGAGACCGAGGCAGG - Intronic
900371469 1:2334066-2334088 CAGCTGGGGGAGCCTCAGGCAGG + Intronic
900461323 1:2803338-2803360 CCGGACAGGGAGGCCGAGGCCGG + Intergenic
900555108 1:3276437-3276459 CAGCAGAGGCAGCTCAGGGCCGG - Intronic
900558090 1:3290004-3290026 CAGCAGGGGCAGCCCCAGGCAGG - Intronic
900590697 1:3458242-3458264 GGGCAGAGGGAGCCGCAGGCTGG - Intronic
900646053 1:3709185-3709207 CAGCTGGGGGAGCCCGTGGCTGG - Intronic
900740077 1:4325758-4325780 CTGCAGGGGCAGCCTGAGGCTGG - Intergenic
900875128 1:5337045-5337067 CAACAGACGGAGGCGGAGGCAGG + Intergenic
901022111 1:6260861-6260883 CCGCAGCCGGAGCCGGAGGCGGG - Exonic
901137882 1:7009435-7009457 CAGCACAGAGAGGCCCAGGCAGG - Intronic
901241195 1:7694685-7694707 CAGCAGAGAGGGCCGGAGGGAGG - Intronic
901242611 1:7704185-7704207 CCGCGCAGGGAGCCCGAGCCCGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901470927 1:9455996-9456018 CAGCAGGGGGACACCCAGGCTGG - Intergenic
901606175 1:10461154-10461176 CAGCACTGGGAGGCCGAGGGGGG - Exonic
901635008 1:10666456-10666478 CTGCAGAGGCTGGCCGAGGCTGG - Intronic
901724598 1:11230961-11230983 CAGCAGAGGCATCCCGGGACTGG + Exonic
901814350 1:11785337-11785359 CAGCAGGGGGAGCCTGCTGCTGG + Intronic
901847743 1:11994993-11995015 CAGCACTGGGAGGCTGAGGCAGG + Intronic
903011409 1:20333225-20333247 CAGCTTTGGGAGGCCGAGGCAGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903178806 1:21595294-21595316 GGGCAGGGGGAGCCCCAGGCAGG - Intergenic
903203705 1:21764460-21764482 GCGCAGTGGGAGGCCGAGGCTGG + Intronic
903533866 1:24053512-24053534 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
903858993 1:26354073-26354095 CAGCAGCAGGAGCTCCAGGCTGG - Exonic
903883489 1:26528389-26528411 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
903888496 1:26554954-26554976 CAGCGGTGGGGGCGCGAGGCTGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904168625 1:28575397-28575419 CAGCATTGGGAGGCAGAGGCGGG - Intronic
904339400 1:29824464-29824486 CAGGAGACGAAGCCCCAGGCTGG + Intergenic
904689127 1:32280699-32280721 CAACACTGGGAGGCCGAGGCAGG - Intronic
904700449 1:32354850-32354872 CAGCACTGGGAGGCCGAGGAGGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904840251 1:33367932-33367954 CAGCAGAGGGCGCCAGGGACCGG - Intronic
905160661 1:36030725-36030747 CAGCATTGGGAGGCTGAGGCGGG - Intronic
905165271 1:36077975-36077997 CAACACTGGGAGGCCGAGGCGGG + Intergenic
905462293 1:38129696-38129718 CAGCAGAAGGAGCCTCAGCCTGG - Intergenic
905569250 1:38991141-38991163 CAGCAGGGGGCGCCCCGGGCCGG + Intergenic
906189366 1:43885901-43885923 GAGCAGAGGATGCCAGAGGCTGG + Intronic
906317370 1:44796816-44796838 CAGCACTGGGAGGCCGAGGCCGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906625886 1:47325260-47325282 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
906655102 1:47542533-47542555 CAGCAGAGGGACCCTGGGCCAGG - Intergenic
906704110 1:47882224-47882246 CAGCATGGGGAGCATGAGGCAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907010070 1:50954650-50954672 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
907344057 1:53759462-53759484 TAGCAGAGGGAGCCTAAGCCTGG + Intergenic
907858714 1:58328848-58328870 CAGGATTGGGAGGCCGAGGCAGG - Intronic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908232505 1:62119691-62119713 CAGCACTGGGAGTTCGAGGCGGG + Intronic
908238418 1:62169131-62169153 CACCAGAGGGGGCGGGAGGCTGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908603794 1:65771169-65771191 CAGCAGAGGGAGGCTTAGTCTGG - Intergenic
908696959 1:66854553-66854575 CAGCACTGGGAGGCGGAGGCAGG + Intronic
909274377 1:73666064-73666086 CAGCACAGGGACCCCGGGCCTGG - Intergenic
909626052 1:77717111-77717133 CAGCACTGGGAGGCCAAGGCAGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910404961 1:86878431-86878453 CAGCATTGGGAGGCCAAGGCAGG + Intronic
910596324 1:88984456-88984478 CAACACTGGGAGGCCGAGGCAGG - Intronic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910642748 1:89481097-89481119 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
910689109 1:89948006-89948028 CAGCATTGGGAGGCTGAGGCGGG - Intergenic
910755026 1:90680470-90680492 GAGGAGAGAGAGCCCTAGGCAGG - Intergenic
911123753 1:94321182-94321204 AAGTACAGGGAGGCCGAGGCAGG + Intergenic
911317125 1:96369183-96369205 CAGCACTGGGAGACTGAGGCAGG + Intergenic
912004316 1:104878353-104878375 CAGCAGAGGGACCCTGAGCCTGG - Intergenic
912343041 1:108936341-108936363 CAGCACTGGGAGGCCGAGGCAGG - Intronic
912495907 1:110091155-110091177 CAGCACTGGAAGGCCGAGGCAGG - Intergenic
912716980 1:111989911-111989933 CGGGAGAGGCAGCCCGTGGCCGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912927890 1:113929674-113929696 CGGCAGCAGGAGGCCGAGGCGGG + Intronic
914238335 1:145832773-145832795 CAGCACTTGGAGTCCGAGGCAGG + Intronic
914831845 1:151176000-151176022 CAGCAGGAGGAGCCCGGTGCCGG + Exonic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915038623 1:152949020-152949042 CAGGAGAGGCAGCACCAGGCTGG + Intergenic
915175670 1:154012755-154012777 CAGCACTGGGAGGCCGAGGCGGG + Intronic
915198780 1:154210723-154210745 CAACACTGGGAGGCCGAGGCAGG - Intronic
915476589 1:156156191-156156213 GAGGAGAGGCAGCCAGAGGCAGG - Intronic
915490755 1:156248852-156248874 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
916413372 1:164569805-164569827 CAGCACTGGGAGGCCGAGGCAGG - Intronic
916548363 1:165827752-165827774 AAGCGGAGGGAGTCCGACGCGGG + Exonic
916674481 1:167054303-167054325 CAGCAGAGGGCGGCGGAGGAAGG - Exonic
916730300 1:167560504-167560526 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
917101001 1:171445258-171445280 TATCAGACGGAGGCCGAGGCAGG + Intergenic
917645730 1:177026850-177026872 CAGCAGGGTGAGCTTGAGGCAGG - Intronic
917869551 1:179229456-179229478 CAGCGCCAGGAGCCCGAGGCCGG - Exonic
917894950 1:179478542-179478564 CAGCAGAGGGACCCTGGGCCTGG + Intronic
918500286 1:185187304-185187326 AAGCCGAGGGAGGCTGAGGCAGG - Intronic
918709475 1:187708754-187708776 CAACTTAGGGAGGCCGAGGCAGG - Intergenic
919059524 1:192613955-192613977 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
919528203 1:198680205-198680227 CAACATTGGGAGGCCGAGGCAGG + Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919824039 1:201491182-201491204 CAGCAGTGGGAAGCCAAGGCTGG + Intronic
919897841 1:202020332-202020354 CAACAAGGGGAGGCCGAGGCAGG + Intergenic
920031193 1:203038393-203038415 GAGCAGGGGGAGGCAGAGGCTGG + Intronic
920294502 1:204947556-204947578 CAGCAGTGGGAGCTGGAGGCTGG - Intronic
920379444 1:205527230-205527252 CAGCACTGGGAGGCCAAGGCAGG + Intronic
920495352 1:206450863-206450885 CAGCACTGGGAGGCCCAGGCGGG + Intronic
921257149 1:213352791-213352813 CAGCATTGGGAGGCTGAGGCAGG + Intergenic
921427531 1:215021792-215021814 CAGGCGTGGGAGGCCGAGGCGGG - Intronic
921498506 1:215870539-215870561 CAGCAGTGGGAGGCCGAGGTGGG - Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
921724825 1:218512137-218512159 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
921848077 1:219905172-219905194 CTGCAGAGGGAGGCAGAGGCAGG + Intronic
922115402 1:222608196-222608218 CAGCAGAGGGACCCTGGGCCAGG + Intergenic
922136401 1:222831728-222831750 CAGTAGAGGAAGCCTGAGACAGG + Intergenic
922423708 1:225475574-225475596 GAGCAGAGGGCGCCCCGGGCAGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922454459 1:225763571-225763593 CAGCTTTGGGAGGCCGAGGCAGG - Intergenic
922477979 1:225920103-225920125 CTGCAGCTGAAGCCCGAGGCAGG - Exonic
922561740 1:226574749-226574771 CACCTCAGGGAGCCCGAGGTGGG + Intronic
922999729 1:229997027-229997049 CAGCACTGAGAGGCCGAGGCGGG - Intergenic
923355582 1:233151934-233151956 CAGCAGAGAGAGGCAGAGGGAGG - Intronic
923549725 1:234953958-234953980 CAGAAAAAGGAGGCCGAGGCAGG - Intergenic
924614473 1:245601165-245601187 CAGTAGAAGGAGCCCGAGTGTGG - Intronic
924780920 1:247146841-247146863 CAGCAGAGGGAGACAGATTCGGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063153136 10:3354936-3354958 AGGCAGAGGGAGCCAGAGGAAGG - Intergenic
1063449590 10:6142604-6142626 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064264241 10:13812125-13812147 CAACACTGGGAGGCCGAGGCAGG - Intronic
1064325037 10:14341898-14341920 CAGCACTGGGAGACTGAGGCAGG - Intronic
1064458749 10:15512777-15512799 CTGCTGTGGGAGGCCGAGGCGGG - Intergenic
1064589205 10:16871286-16871308 CAGCACAGGGAGGCTGAGGCAGG - Intronic
1065011235 10:21422749-21422771 CAGCACTGGGAGGCCGAAGCGGG + Intergenic
1065286623 10:24193163-24193185 CAGGAGGGGGAGGCCGAGGTGGG - Intronic
1065588288 10:27241018-27241040 CAGAAGGGGGAAACCGAGGCCGG + Intronic
1066657270 10:37708016-37708038 CAGCAGATGGAGCTGGAGACAGG - Intergenic
1066682464 10:37947368-37947390 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1067105046 10:43361033-43361055 CAGCACTGGGAGGCCTAGGCAGG - Intergenic
1067253495 10:44610469-44610491 GAGCAGAGGATGCCAGAGGCTGG - Intergenic
1067539397 10:47140820-47140842 GAGCAGAGGGAGCCCCAGCCTGG + Intergenic
1068016323 10:51521040-51521062 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1068196165 10:53719593-53719615 CATCAAAGGGACCCCTAGGCAGG - Intergenic
1068890389 10:62142582-62142604 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069291015 10:66779607-66779629 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1069378978 10:67822739-67822761 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1069380533 10:67839680-67839702 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1069489691 10:68850723-68850745 CAGCACTGGGAGGCCAAGGCAGG + Intronic
1069667593 10:70173853-70173875 CAACACTGGGAGACCGAGGCAGG + Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070813361 10:79309406-79309428 CAGGAGTGGGAGCCCTAAGCTGG + Intronic
1071599354 10:86949953-86949975 CAACACTGGGAGGCCGAGGCAGG + Intronic
1072081029 10:92032258-92032280 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1072162600 10:92782333-92782355 CAGCACTGGGAGGCTGAGGCCGG + Intergenic
1072187956 10:93060432-93060454 CGGCAGAGGGAGCCAGCGGCCGG + Intergenic
1072445991 10:95499184-95499206 CAGCTAGGGGAGGCCGAGGCAGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072873960 10:99152063-99152085 CAGCTTTGGGAGGCCGAGGCGGG + Intronic
1072973112 10:100034481-100034503 TACCAGAGGGAGGCCGAGGGGGG + Intergenic
1072974915 10:100049203-100049225 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1073021479 10:100448344-100448366 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1073103448 10:101019016-101019038 ATGCAGACGGAGCCCGATGCGGG - Exonic
1073439464 10:103544082-103544104 CTGCAGAGGGGGACGGAGGCTGG + Intronic
1073542200 10:104323513-104323535 CTGCAGAGGTACCCCCAGGCAGG - Intronic
1073759814 10:106617199-106617221 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1074042924 10:109810118-109810140 CAGCACAGGGACCCTGAGCCTGG + Intergenic
1074640211 10:115370922-115370944 CAGCAGAGGGACCCTGGGCCTGG - Intronic
1075550317 10:123388102-123388124 CAGCAGAGGGACCCTGGGCCAGG - Intergenic
1075574902 10:123571168-123571190 GAGCAGAGGGGCCCCCAGGCAGG - Intergenic
1075878853 10:125832284-125832306 CAACACTGGGAGGCCGAGGCAGG - Intronic
1076638715 10:131900253-131900275 CAGGATTGGGAGACCGAGGCCGG + Intergenic
1076668095 10:132104266-132104288 CGGCAGAGGGACCCCGTGACCGG - Intergenic
1076704453 10:132293649-132293671 CAGCAGAGGGAACGCAGGGCAGG + Intronic
1076756865 10:132577130-132577152 GGGCAGAGGGACCCCCAGGCAGG + Intronic
1076821754 10:132943152-132943174 CAGCAGGGGGTGGCCGAGGCGGG + Intergenic
1076838449 10:133032866-133032888 CAGCAGAGGGTTCCCTGGGCTGG - Intergenic
1076977950 11:189689-189711 AAGCAGGGGGCGCCCGAGCCCGG - Intronic
1077081152 11:725262-725284 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1077204826 11:1337163-1337185 GAGAAGCGGGAGCGCGAGGCGGG - Intergenic
1077384493 11:2262628-2262650 CAGAACAGGGACCCGGAGGCAGG + Intergenic
1077592804 11:3505677-3505699 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1078083373 11:8219377-8219399 CTGCAAAGAGAGCCCCAGGCAGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078216717 11:9318007-9318029 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1078233225 11:9461164-9461186 GAGCAGCGGGAGCCGGAGCCCGG - Intronic
1078354916 11:10626210-10626232 GAGCCGATGGGGCCCGAGGCTGG - Exonic
1078481614 11:11681174-11681196 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1078854096 11:15192183-15192205 CAACAGAGGGAGCCAGAGGGAGG - Intronic
1079218179 11:18533898-18533920 CAGCACTCGGAGGCCGAGGCAGG - Intronic
1079652152 11:22942840-22942862 CAGCAGAGGTACCCCGTGCCTGG + Intergenic
1079941422 11:26685371-26685393 CAGCACTCGGAGGCCGAGGCTGG + Intronic
1080565304 11:33504011-33504033 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1080973354 11:37304302-37304324 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
1081580583 11:44348912-44348934 CAGCAAAGTAACCCCGAGGCTGG - Intergenic
1081620942 11:44618894-44618916 CAGCAGAGGGAGGCCCAGAGCGG - Intronic
1082016490 11:47492481-47492503 CAACTGTGGGAGGCCGAGGCAGG + Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083190696 11:61050020-61050042 GAGCAGAGGGAGCCAGGGCCAGG - Intergenic
1083211490 11:61190104-61190126 CAGCATTGGGAGGCTGAGGCAGG + Intergenic
1083492660 11:63024230-63024252 GAGCAGAGGGAACACCAGGCGGG - Intergenic
1083554209 11:63613538-63613560 CAGCAGAGGGATTCAGAGGATGG - Intronic
1083687643 11:64386308-64386330 CAGCAAAGAGAGCCCGGGGCTGG - Intergenic
1083693460 11:64426289-64426311 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1083730194 11:64648657-64648679 CTGCAGAGGCAGACCGGGGCAGG - Intronic
1083806684 11:65078680-65078702 CAGGAGGGAGAGGCCGAGGCTGG + Exonic
1084165472 11:67373111-67373133 AGGCCGGGGGAGCCCGAGGCCGG - Intronic
1084453880 11:69256285-69256307 CAGGAGAGAGAGCGCGAGGAAGG + Intergenic
1084477707 11:69398410-69398432 CTGAAGAGGGATCCCGAGGAGGG - Intergenic
1084598218 11:70129867-70129889 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1085070456 11:73539513-73539535 CAGCGCTGGGAGGCCGAGGCGGG - Intronic
1085354915 11:75827361-75827383 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085496827 11:76978041-76978063 CATGGGAGGGAGGCCGAGGCGGG + Intronic
1085511665 11:77091316-77091338 CAGCAGAGGGTGGCAGAGGCAGG - Intronic
1085554985 11:77411740-77411762 CAGCTAGGGGAGCCCCAGGCAGG + Intronic
1085651497 11:78272835-78272857 CAGCAGAGGGACCCTGGGCCCGG - Intronic
1086287941 11:85271109-85271131 CAGCAGAGGGACCCTGGGCCTGG - Intronic
1086412153 11:86553702-86553724 CAGCTGAGTGAGCTTGAGGCAGG - Intronic
1086572573 11:88302375-88302397 CAGCATTGGGAGGCCGAGGCGGG + Intronic
1087067966 11:94045152-94045174 CAGCAATGGGAGGCCAAGGCAGG - Intronic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088645518 11:111913493-111913515 CAGCTGGGGCGGCCCGAGGCCGG - Exonic
1088652371 11:111969179-111969201 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1089202609 11:116733506-116733528 GAGAAGAGGGAGCCCCAGGCTGG + Intergenic
1089645296 11:119874878-119874900 CAGCAGAAGGGGCCGGAAGCTGG - Intergenic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1089738427 11:120565026-120565048 CCCCAGCGGGAGCACGAGGCCGG - Intronic
1090361745 11:126177519-126177541 CAGAAGAGGGAACCGGTGGCAGG + Intergenic
1090881030 11:130831497-130831519 CAGGAAAGGGACCCAGAGGCTGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090920006 11:131198912-131198934 TAGCAGAGGCAGCCTGTGGCTGG - Intergenic
1090937508 11:131357196-131357218 AGACAGAGGGAGGCCGAGGCAGG - Intergenic
1091014766 11:132040034-132040056 CTCCAGAGGGAGGCTGAGGCAGG - Intronic
1091170509 11:133516137-133516159 CCGCAGAGGGAGAGCAAGGCTGG + Intronic
1091251351 11:134146809-134146831 CACCTGGGGGAGGCCGAGGCAGG - Intronic
1091563486 12:1631141-1631163 GAGCAGTGGGAGGCGGAGGCTGG + Intronic
1091640082 12:2229814-2229836 CAGGTGAGGGGTCCCGAGGCGGG + Intronic
1091702102 12:2670286-2670308 CAACAGAAGGAGCCCCGGGCAGG + Intronic
1091749936 12:3015927-3015949 CAGCACTGGGAGGTCGAGGCAGG + Intronic
1091797143 12:3303938-3303960 CTGCAGGGGGAGGCAGAGGCTGG + Intergenic
1091912868 12:4245811-4245833 CAGCAAAGAGAGGCCGAGGCTGG - Intergenic
1092100444 12:5879231-5879253 CAGCAGATGAAGCCGCAGGCAGG + Intronic
1092151816 12:6254215-6254237 CAGCACTGGGAAGCCGAGGCGGG + Intergenic
1092218965 12:6700298-6700320 CGGCGAAGGGACCCCGAGGCAGG + Exonic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092408201 12:8235223-8235245 CTGCACAGGGTGCCCGGGGCTGG + Intergenic
1092418912 12:8313806-8313828 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092510868 12:9154759-9154781 CAGCAGAGGGAGCCTGGGTTTGG + Exonic
1092662702 12:10755719-10755741 CAGCAGAGGGACCCTGGGCCCGG + Intergenic
1092777928 12:11960294-11960316 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094587735 12:31793486-31793508 TAGCACTGGGAGGCCGAGGCAGG + Intergenic
1094611232 12:31997586-31997608 CAGCACTAGGAGGCCGAGGCGGG - Intergenic
1094684833 12:32701026-32701048 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1095314254 12:40740570-40740592 CTGAAGAGGGAGGCCAAGGCTGG - Intronic
1095382778 12:41615416-41615438 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
1096725098 12:53555071-53555093 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1096853407 12:54458616-54458638 CAGCACGGGGAGACCAAGGCGGG - Intronic
1097006052 12:55918619-55918641 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1097238723 12:57558425-57558447 CAGCATTGGGAGGCCAAGGCGGG + Intronic
1097495422 12:60325413-60325435 CAGCTTTGGGAGGCCGAGGCAGG - Intergenic
1097700426 12:62814462-62814484 CAGCATTGGGAGACCAAGGCAGG - Intronic
1097878936 12:64669768-64669790 TTGCACAGGAAGCCCGAGGCTGG - Intronic
1097990373 12:65826013-65826035 CGCCGGAGGGAGCCCGGGGCAGG + Intronic
1098272315 12:68780731-68780753 CAACACTGGGAGGCCGAGGCGGG - Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098630888 12:72720562-72720584 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1098822669 12:75252620-75252642 CAGGAGTGGGAGGCCGAGGCAGG + Intergenic
1099049573 12:77766998-77767020 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1099216398 12:79859087-79859109 CAACAGTGGGAGGCCAAGGCGGG + Intronic
1099301476 12:80900011-80900033 TAGAGGAGGGAGGCCGAGGCGGG - Intronic
1099639142 12:85262034-85262056 CAGCACTGGGAGACCAAGGCTGG - Intronic
1100486403 12:95032344-95032366 CAGCACAAGGAGGCTGAGGCAGG + Intronic
1101090872 12:101283794-101283816 CAACAGTGGGAGGCTGAGGCAGG - Intronic
1101146409 12:101844869-101844891 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1101230186 12:102732758-102732780 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1101520303 12:105475995-105476017 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1102109716 12:110355829-110355851 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1102122087 12:110449843-110449865 CAGCAGAGGGAGCCTGACCCCGG + Intronic
1102238624 12:111310152-111310174 CAGCAGGGGCTGCCCGGGGCTGG - Exonic
1102275778 12:111580890-111580912 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1102673366 12:114638798-114638820 CAGCATTGGGAGGCCGAGGCGGG - Intergenic
1102991464 12:117319297-117319319 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1103057770 12:117835190-117835212 CAGCAGACGGAGCTCAGGGCTGG - Intronic
1103058037 12:117836847-117836869 CAGCTGGGGGTGCCCCAGGCCGG + Intronic
1103293243 12:119864580-119864602 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1103346635 12:120255447-120255469 CAGCACTGGGAGACCGAGGCAGG + Intronic
1103477259 12:121227837-121227859 CAGCACAGGGAGGCGGAGGTAGG + Intronic
1103631834 12:122267781-122267803 CAGCACTGGGAGGCCGAGACGGG - Intergenic
1103635561 12:122302346-122302368 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1103711227 12:122914071-122914093 CAGCTTTGGGAGGCCGAGGCGGG + Intergenic
1103933851 12:124465041-124465063 CTGCAGTGGCAGCCTGAGGCAGG - Intronic
1104004144 12:124880329-124880351 CAACACTGGGAGGCCGAGGCAGG + Intronic
1104026666 12:125032519-125032541 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1104862482 12:131930907-131930929 CAACACAGGAAGGCCGAGGCAGG - Intronic
1104890807 12:132139267-132139289 AAGCAGAGGGCGGCCTAGGCTGG - Exonic
1104930968 12:132339307-132339329 AAGCAGTGGGCGCCGGAGGCTGG - Intergenic
1104981985 12:132577279-132577301 CAGAACAGGGAGCCCCAGGGAGG - Intronic
1105609469 13:21955323-21955345 CAGCAGAGGGACCCTGGGCCCGG + Intergenic
1106097404 13:26660329-26660351 GAGCAGAGGGCCCACGAGGCAGG + Intronic
1106743516 13:32674059-32674081 CAACATTGGGAGGCCGAGGCAGG - Intronic
1106917317 13:34529558-34529580 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1107144266 13:37041269-37041291 CAGCTTTGGGAGGCCGAGGCGGG + Intronic
1107368386 13:39712104-39712126 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1107514920 13:41119723-41119745 CAGCTTTGGGAGGCCGAGGCAGG - Intergenic
1107781756 13:43910842-43910864 AAGTAGTGGGAGGCCGAGGCGGG - Intergenic
1108011996 13:46025416-46025438 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1108270563 13:48755768-48755790 CAGCAGAGGGACCCTGGGTCTGG - Intergenic
1108292508 13:48975847-48975869 CCGCCGACGGAGCCCGCGGCCGG - Intergenic
1108319195 13:49271163-49271185 CAGCACTGGGAGACTGAGGCAGG + Intronic
1108376416 13:49818347-49818369 CTGCACTGGGAGGCCGAGGCGGG - Intergenic
1108623823 13:52208746-52208768 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1108662894 13:52602271-52602293 CAACACTGGGAGGCCGAGGCAGG + Intergenic
1108693133 13:52878108-52878130 CAGCACTGGGAAGCCGAGGCGGG - Intergenic
1109914150 13:68957826-68957848 CAGAAGAGTAAGCCCGAGGGAGG - Intergenic
1110395887 13:75029207-75029229 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1110706215 13:78603449-78603471 CAGCAGCAGCAGCCCGCGGCGGG - Exonic
1110959694 13:81606273-81606295 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1111459398 13:88519904-88519926 CAGCAGAGGGACCCTGGGACTGG - Intergenic
1112308306 13:98295312-98295334 CAGCAGAGGGAGCCCTGGGCAGG + Intronic
1112468664 13:99668336-99668358 CAGCACTGGGAGGCCAAGGCAGG + Intronic
1112650664 13:101393568-101393590 CATAAGTGGGAGGCCGAGGCGGG + Intronic
1113249110 13:108431603-108431625 CAGCTGTGGGAGCCCGAGGTTGG - Intergenic
1114191794 14:20445047-20445069 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114465026 14:22915740-22915762 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1114558566 14:23576255-23576277 CCGCCCCGGGAGCCCGAGGCGGG + Exonic
1115549991 14:34496242-34496264 CAGCAGTAGGAGGCCAAGGCAGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116326169 14:43535634-43535656 CCGCAGGGGGAGCCTGTGGCAGG - Intergenic
1117186251 14:53243726-53243748 CAGCAGAGGGACCCTGGGTCTGG - Intergenic
1117256739 14:53985794-53985816 CAGCAGAGGGACCCAGGGCCTGG - Intergenic
1117551647 14:56843108-56843130 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1117698908 14:58394465-58394487 CAGCACTGGGAGACCGAGGTGGG - Intergenic
1117850676 14:59965635-59965657 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1118072796 14:62264296-62264318 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1118318225 14:64738281-64738303 CAGCAGAGGGGGCCCTCGGGTGG - Intronic
1118598352 14:67453405-67453427 CAGGACAGGGAGCCCCAGGCAGG - Intronic
1118619360 14:67600485-67600507 CAGCACTGGGAGGCCAAGGCGGG + Intergenic
1119128321 14:72149024-72149046 CAGCTGGGGGAGCCTGAGGCTGG + Intronic
1119133368 14:72194770-72194792 CAGAAGAGGGACCCTGGGGCAGG + Intronic
1119452772 14:74726238-74726260 CAGTATTGGGAGCCCGAAGCAGG + Intronic
1120645139 14:87065021-87065043 CAGGAGAGAGAGCCAGAGGAGGG + Intergenic
1120885780 14:89450829-89450851 GAGCAAAGGGAGGCCGAGGTGGG - Intronic
1121732063 14:96193956-96193978 CAGCTCAGGGAGTCCTAGGCTGG + Intergenic
1121756375 14:96406163-96406185 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1121940398 14:98064755-98064777 CCCAAGAGGGAGCCCGAGGTGGG - Intergenic
1122169950 14:99864563-99864585 CAACACTGGGAGGCCGAGGCAGG + Intronic
1122286800 14:100657158-100657180 CAGGCGGGGGAGCGCGAGGCAGG + Intergenic
1122541471 14:102499952-102499974 CAGCAGAGGCAGCCCCAGGCCGG + Exonic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122708929 14:103641169-103641191 CAACACTGGGAGGCCGAGGCAGG - Intronic
1122804071 14:104247896-104247918 CAGCAGTGTGAACCCGAGGAGGG - Intergenic
1122836037 14:104431597-104431619 CAGCAGACGCAGCCTGAGGTGGG - Intergenic
1122904642 14:104796039-104796061 TAGCAGAAGGGGCCCGAGACAGG + Intergenic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1122956633 14:105074404-105074426 CAGCAGTGGGAGGCCAAGGTTGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123002934 14:105306007-105306029 CAGCAGAGCGGGGCCCAGGCTGG + Exonic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1123694190 15:22865106-22865128 CAGCACTGGGAGGCCGAGGATGG - Intronic
1123986584 15:25651700-25651722 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1124051284 15:26199343-26199365 CAGCAGAGGAAGGGGGAGGCAGG - Intergenic
1124355519 15:28992210-28992232 CTGGGGAGGGAGCCCGAGACAGG - Intronic
1124581849 15:30962822-30962844 CTGCAGAGAGAGGCCGGGGCAGG + Intronic
1124967731 15:34449547-34449569 AAGCTGAGGGAGGCCGAGGCGGG + Intergenic
1125516009 15:40321829-40321851 CAGCTTTGGGAGGCCGAGGCGGG - Intergenic
1125537659 15:40451677-40451699 CAGCAGAGGGAGACCCATGTGGG - Intronic
1125669148 15:41457285-41457307 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1125956296 15:43793076-43793098 AAGCAGAGGTAGCCCCAGGGAGG + Exonic
1125997600 15:44178744-44178766 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127078102 15:55348098-55348120 CAGCTGAGGCAGGCTGAGGCAGG - Intronic
1127114090 15:55706781-55706803 GAGGAGAGGGAGAGCGAGGCAGG + Intronic
1127117531 15:55742991-55743013 GAGCAGAGAGCGCCCGGGGCGGG - Intronic
1127201333 15:56655451-56655473 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127872116 15:63082433-63082455 CAGCACAGGGAGATCGAGGCAGG + Intergenic
1128115820 15:65104627-65104649 CAGCACTGGGAGGCCGAGGCCGG + Intronic
1128670377 15:69570287-69570309 CAGCACTGGGAGGCCGAAGCGGG + Intergenic
1128736219 15:70055398-70055420 GAGCAGAGGGGGCTAGAGGCAGG - Intronic
1130033549 15:80337426-80337448 CAGCTTTGGGAGGCCGAGGCGGG - Intergenic
1130921386 15:88347938-88347960 CAGCACTGAGAGGCCGAGGCAGG + Intergenic
1131076856 15:89500786-89500808 CAGCAGAGGGAGACAGAAACTGG - Intergenic
1131201991 15:90406409-90406431 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1131312532 15:91303979-91304001 CCACAGAGGGAGCGAGAGGCAGG + Intergenic
1131455635 15:92580455-92580477 CAGCAGAGGGGGTCTGTGGCTGG - Intergenic
1132025837 15:98403776-98403798 CAGCAGATGGAGCGCGAGTTCGG - Intergenic
1132202741 15:99966036-99966058 CAATTGAGGGAGGCCGAGGCGGG - Intergenic
1132660134 16:1057647-1057669 CACCAGAGGGCGCCAGAAGCCGG + Intergenic
1132664144 16:1073988-1074010 CAGGAGAGGGAAACTGAGGCAGG - Intergenic
1132912317 16:2320643-2320665 CAGCATTGGGAGGCTGAGGCAGG - Intronic
1133239055 16:4403910-4403932 AGGCAGAGTGAGCTCGAGGCCGG - Intronic
1133349157 16:5090054-5090076 CTGCACAGGGTGCCCGGGGCTGG + Intronic
1133395296 16:5442310-5442332 CTGCAGAGGGAGCCAGGGCCAGG + Intergenic
1133472128 16:6085515-6085537 CAACACCGGGAGGCCGAGGCGGG - Intronic
1133592940 16:7263647-7263669 CAGCACAGAGAGGCCGAGGCAGG + Intronic
1133728614 16:8559456-8559478 CAGCTCAGGGAGCCCATGGCGGG - Intergenic
1133754674 16:8753469-8753491 CAGCATAGAAAGCCCAAGGCAGG + Intronic
1133805257 16:9121805-9121827 CAGCACTGGGAGGCCAAGGCGGG + Intergenic
1133817656 16:9210468-9210490 AAGAAGAAGGAGCCAGAGGCTGG - Intergenic
1133841663 16:9415768-9415790 AGGCAGAGGGAGCCAGAGGGAGG - Intergenic
1133972415 16:10577719-10577741 CTGCACAGGCATCCCGAGGCTGG + Intronic
1134138199 16:11694384-11694406 CAGCCCTGGGAGGCCGAGGCAGG - Intronic
1134167204 16:11940490-11940512 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1134173259 16:11985758-11985780 CAGCAGAGGCTTCCTGAGGCAGG + Intronic
1134283750 16:12841826-12841848 CAGCTCAGGGAGGCTGAGGCAGG - Intergenic
1134493502 16:14713223-14713245 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134498883 16:14752347-14752369 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134525435 16:14938968-14938990 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134546970 16:15117410-15117432 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134547455 16:15121894-15121916 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134581685 16:15376668-15376690 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1134713020 16:16337454-16337476 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1134720889 16:16380814-16380836 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1134946538 16:18331071-18331093 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1134953799 16:18371218-18371240 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1135239604 16:20792742-20792764 CAGAAGTGGGAACCAGAGGCTGG + Intronic
1135312599 16:21417949-21417971 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135365547 16:21850402-21850424 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135446292 16:22520934-22520956 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1135980773 16:27145163-27145185 CAGCAGCTGGGGCCAGAGGCTGG - Intergenic
1136042496 16:27591427-27591449 CAGCTTTGGGAGGCCGAGGCGGG - Intronic
1136151776 16:28355898-28355920 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1136168009 16:28469738-28469760 CGGCACTGGGAGGCCGAGGCAGG + Intronic
1136194966 16:28645273-28645295 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136211305 16:28759385-28759407 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136234104 16:28903944-28903966 CAGCAGACGGGCCCAGAGGCTGG - Intronic
1136241448 16:28946974-28946996 CAGCACTGGGAGCCTGAGGTGGG - Intergenic
1136256026 16:29039335-29039357 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1136309301 16:29396901-29396923 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136322719 16:29498457-29498479 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136437401 16:30238425-30238447 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136490657 16:30605711-30605733 AAGCACTGGGAGGCCGAGGCGGG + Intronic
1136522321 16:30805216-30805238 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137592249 16:49700759-49700781 CAGCAGAGGGGGCCCAAGGAGGG - Intronic
1137618236 16:49858960-49858982 TAGCAGAGGCAGCCCGCGGCGGG - Intergenic
1137624362 16:49898407-49898429 CAGGTGAGGGAGTCTGAGGCAGG - Intergenic
1138425863 16:56931816-56931838 TGGCTGAGGGCGCCCGAGGCAGG - Intergenic
1138447645 16:57074596-57074618 CAGCAGAAGGTGACTGAGGCTGG - Exonic
1138657333 16:58499045-58499067 CAGAGGAGGGGGCCCAAGGCTGG - Intronic
1138895408 16:61198574-61198596 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1139473973 16:67193281-67193303 CTGAGGAGGGAGCCTGAGGCTGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139583718 16:67887826-67887848 CAACACTGGGAGGCCGAGGCGGG - Intronic
1139632407 16:68238547-68238569 CAGCACTGGGAGACCGAGGCGGG - Intergenic
1139811717 16:69624451-69624473 CAACACTGGGAGGCCGAGGCGGG - Intronic
1139825489 16:69754049-69754071 CAGCACTGGGAGACCGAGGCGGG - Intronic
1139856995 16:69989319-69989341 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140033296 16:71355256-71355278 CAGCAGCGGGAGCCAAAGCCTGG - Intergenic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1140206846 16:72940156-72940178 CAACACAGGGAGGCTGAGGCAGG - Intronic
1140297880 16:73726689-73726711 CAACAGCGGGAGCACGAGGGAGG + Intergenic
1140365716 16:74378656-74378678 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1140497193 16:75399623-75399645 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1141810348 16:86371703-86371725 GAGCACATGGAGCTCGAGGCAGG - Intergenic
1142022525 16:87792819-87792841 CAGCATTGGGAGGCCTAGGCAGG - Intergenic
1142274825 16:89112886-89112908 CAGCAGAACGTGCCCCAGGCAGG - Intronic
1142278647 16:89136617-89136639 CAGCTGAGGATGGCCGAGGCCGG + Intronic
1142301335 16:89260154-89260176 CAACAGTGGCAGGCCGAGGCGGG + Intergenic
1142384839 16:89757206-89757228 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1142465374 17:134154-134176 AAGCAGGGGGCGCCCGAGCCCGG - Intergenic
1142467724 17:145732-145754 CAGGCGGGGGAGCCCCAGGCTGG + Intergenic
1142639275 17:1276285-1276307 GAGTGGAGGGAGCCCGAGGGAGG - Intergenic
1142659476 17:1417905-1417927 GAACTGTGGGAGCCCGAGGCGGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142983264 17:3683482-3683504 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1143065407 17:4243443-4243465 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1143188691 17:5025567-5025589 CAGCACTGGGAGGCCGAGGCAGG + Exonic
1143283873 17:5774682-5774704 CAGCAGTGGGAGGTGGAGGCTGG - Intronic
1143547704 17:7608343-7608365 CAACACTGGGAGGCCGAGGCTGG + Intronic
1143642840 17:8209257-8209279 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1143969591 17:10785907-10785929 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1144639678 17:16930582-16930604 GAGAAGAGGGAGCTCGAGGCTGG + Intronic
1144992625 17:19244210-19244232 CAGCACTGGGAGGCTGAGGCTGG + Intronic
1145846333 17:28041969-28041991 CAGCAGAAGCAGCCGGCGGCGGG + Intronic
1146174273 17:30654972-30654994 CAGCACTTGGAGGCCGAGGCGGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146263571 17:31437034-31437056 AAGCATTGGGAGGCCGAGGCGGG - Intronic
1146334943 17:31961298-31961320 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1146347728 17:32070999-32071021 CAGCACTTGGAGGCCGAGGCGGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146569127 17:33938117-33938139 CAGTAAAGGAAGCCCCAGGCAGG - Intronic
1146759108 17:35460643-35460665 AGGAAGAGGGAGCCAGAGGCCGG + Intergenic
1146935471 17:36810081-36810103 CAGAAGAGGGGACCTGAGGCCGG + Intergenic
1147319831 17:39639492-39639514 TATCAGAGGGAGGCAGAGGCTGG + Intronic
1147439161 17:40436874-40436896 GAGCAGAGAGAGCCAGAGGTTGG - Intergenic
1147665946 17:42148160-42148182 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1147721387 17:42541709-42541731 GAGCAGAGGGCGCCCAAGTCAGG + Intronic
1148084909 17:44988106-44988128 CAGCGGAGGGGTCCCTAGGCAGG - Intergenic
1148206821 17:45784526-45784548 TAGCCGAGCGAGCCCGAGGATGG + Exonic
1148272102 17:46269418-46269440 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1148593843 17:48837005-48837027 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1148919352 17:51016658-51016680 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1149204466 17:54227890-54227912 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1150493432 17:65589819-65589841 CAGCACTGGGAGGCTGAGGCGGG + Intronic
1150687349 17:67331493-67331515 CAGCAGAGGGACCCTGGGTCTGG - Intergenic
1151231198 17:72686405-72686427 CAGCAGTGGGATCCCGAATCAGG - Intronic
1151237375 17:72730996-72731018 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1151310264 17:73288503-73288525 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1151318927 17:73341127-73341149 CAACACTGGGAGGCCGAGGCAGG - Intronic
1151350536 17:73529245-73529267 CAGCTGAGGGAGGACCAGGCTGG + Intronic
1151416365 17:73968573-73968595 GAGCAGAGAGAGCAGGAGGCAGG + Intergenic
1151527429 17:74680631-74680653 CAGCTGAGGGAGGCAGAGGTGGG - Intronic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1151565872 17:74897995-74898017 CTGCTGAGGGAGGCTGAGGCAGG - Intergenic
1151898014 17:76993427-76993449 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1151900822 17:77012833-77012855 CAACACTGGGAGGCCGAGGCTGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152030329 17:77838217-77838239 CAGCAGTGGGTGTCTGAGGCAGG + Intergenic
1152075309 17:78155871-78155893 CAGCACTGTGAGGCCGAGGCAGG - Intronic
1152207046 17:78979867-78979889 CTGCAGAGGGATCCTGTGGCTGG - Exonic
1152301376 17:79496957-79496979 CAGAACAGGGGTCCCGAGGCAGG - Intronic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152617775 17:81345842-81345864 CACCAGAGGGACCCCGCGGCGGG + Intergenic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152635768 17:81429939-81429961 CAGCAGAGGCAGCCCGGAGCTGG + Intronic
1152730228 17:81966541-81966563 CAGGAGAGGCACCCCGAGACAGG + Intergenic
1152861258 17:82698124-82698146 GCGCAGCGGGAGCCCGCGGCTGG - Intronic
1203161615 17_GL000205v2_random:57294-57316 CAGCAGAGCCACCACGAGGCGGG + Intergenic
1153649590 18:7228340-7228362 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1153914244 18:9732085-9732107 GAGCTGAGGGAGACGGAGGCTGG - Intronic
1154118480 18:11632603-11632625 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1154146272 18:11868762-11868784 CAACACTGGGAGGCCGAGGCAGG + Intronic
1154162761 18:11992088-11992110 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1156036667 18:32772299-32772321 CGGCGGAGGGAGCGCGAGGGAGG - Intronic
1157568646 18:48697660-48697682 CAGCAGAAGGAGCACTGGGCTGG - Intronic
1157679092 18:49589698-49589720 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1157789769 18:50521171-50521193 CCGCAGAGGGAGCCCCAGATGGG - Intergenic
1157830150 18:50850167-50850189 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1158592933 18:58792575-58792597 CAGCTTTGGGAGGCCGAGGCAGG + Intergenic
1159024373 18:63169032-63169054 CAGGAGAGTCAGCCAGAGGCTGG - Intronic
1159672523 18:71239346-71239368 CACCAGAGGGAGAGCCAGGCAGG + Intergenic
1160354253 18:78213612-78213634 CGGCAGAGGGGCCTCGAGGCAGG - Intergenic
1160481809 18:79246687-79246709 CAGCAGGGGGAGCGCGAGGCCGG - Intronic
1160549973 18:79688198-79688220 CAGGGGTGGGAGCCCCAGGCTGG - Intronic
1160679851 19:407666-407688 CAGCAGAGGGGACCCGAAGGGGG + Exonic
1160709284 19:543596-543618 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1160777260 19:862010-862032 CTGCAGAGGGAGCGCGAAGCGGG + Intronic
1160906529 19:1454023-1454045 CAGCAGAGGGAGGCAGGGTCTGG + Intronic
1160953448 19:1678812-1678834 CAGCTGAGGGCTCCTGAGGCGGG - Intergenic
1161026717 19:2040369-2040391 CTGCCCAGGGAACCCGAGGCTGG + Intronic
1161057814 19:2199488-2199510 CAGCAGGGGCGCCCCGAGGCAGG - Intronic
1161445220 19:4314731-4314753 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1161882112 19:6962929-6962951 CAACATTGGGAGGCCGAGGCAGG + Intergenic
1162022051 19:7872513-7872535 GAGCTCAGGGAGCGCGAGGCCGG + Exonic
1162125455 19:8497465-8497487 GAGCTTTGGGAGCCCGAGGCAGG - Intronic
1162164996 19:8746450-8746472 CAGAGGCGGGAGGCCGAGGCAGG + Intergenic
1162307951 19:9886928-9886950 CAACACTGGGAGGCCGAGGCAGG - Intronic
1162426560 19:10600287-10600309 CAGCAACGGGAGGCTGAGGCAGG + Intergenic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162718751 19:12649378-12649400 AACCAGACGGAGCCCGTGGCAGG - Exonic
1163450217 19:17372814-17372836 CAGCACTGGGAGGCCAAGGCGGG + Intronic
1163452110 19:17384402-17384424 CAGCACTTGGAGGCCGAGGCGGG + Intergenic
1163469439 19:17487918-17487940 GAGCAGGAGGAGCCCGAGGAGGG - Intronic
1163551251 19:17967362-17967384 CAGCTCAGGGAGCCCGAGGAGGG + Intronic
1163690729 19:18736902-18736924 CTGCAGAGCGAGCCCCAGGAAGG + Intronic
1164104763 19:22099833-22099855 CAGCATTAGGAGGCCGAGGCGGG + Intergenic
1164517646 19:28949709-28949731 CAGCAGAGGGCGCCTGATGAGGG - Intergenic
1164684594 19:30158462-30158484 CAGCACAGGGAACCCTAGACTGG + Intergenic
1164953119 19:32355753-32355775 CACAGGAGGGAGGCCGAGGCGGG + Intronic
1165010754 19:32844581-32844603 CAGCACTGGGAGACTGAGGCAGG + Intronic
1165023526 19:32942993-32943015 CAGCAGCTGGAGGCTGAGGCAGG - Intronic
1165089041 19:33373203-33373225 GCGCCGAGGGAGGCCGAGGCGGG - Intergenic
1165419963 19:35717831-35717853 CGGGAGAGGGAGTCCGCGGCCGG - Intergenic
1165453577 19:35898729-35898751 CAGCAGCAGCAGCCCGACGCTGG - Exonic
1165748474 19:38245415-38245437 CAACACTGGGAGGCCGAGGCGGG - Intronic
1165852406 19:38857301-38857323 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1165862968 19:38918697-38918719 CTGCCGTGGGTGCCCGAGGCAGG - Intronic
1165985808 19:39767829-39767851 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1166062592 19:40336006-40336028 CAGCAGAGGCAGGCCGACCCAGG - Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166187429 19:41150283-41150305 CAGGTGAGGGAGGCTGAGGCAGG - Intergenic
1166679519 19:44758304-44758326 CAGCGGGAGGAGCCCGCGGCCGG - Exonic
1166793215 19:45410131-45410153 CAGCACTGGGAGGCTGAGGCAGG - Exonic
1167080834 19:47275181-47275203 CAGGAGAGGGAGGCAGCGGCGGG - Exonic
1167156146 19:47740499-47740521 CAGCATTGGGAGGCTGAGGCGGG + Intronic
1167247622 19:48383242-48383264 CAGCAGCGGGAGGCAGAGGAAGG - Exonic
1167357061 19:49010662-49010684 GAACAGAGGGAGCCCGAGGGAGG - Intronic
1167512806 19:49905092-49905114 CAGCTTTGGGAGGCCGAGGCGGG - Intronic
1167682754 19:50934892-50934914 CAGCACAGGGATGCCAAGGCAGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168216664 19:54931173-54931195 CAGCAGTGGGAGGCCAAGACGGG + Intronic
1168356564 19:55703891-55703913 CAGCAGAGGGCGCCGGAGAGCGG + Intronic
1168403577 19:56099462-56099484 CAACACTGGGAGGCCGAGGCGGG + Intronic
1168605069 19:57752116-57752138 CAGCTCCGGGAGCCCGAGGCGGG - Intronic
925376201 2:3388001-3388023 TAGCGGAGGGGCCCCGAGGCAGG + Exonic
925386834 2:3467845-3467867 CAGCAGAGGGTTGCAGAGGCGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925586717 2:5471890-5471912 CAGCAAAGGGAGCTCCAGCCTGG + Intergenic
926117242 2:10221309-10221331 CAGCTGTGGGCGCCCGAGGGTGG + Intergenic
926128487 2:10286114-10286136 CAGCAGAGGGAAGCTGAGGAGGG + Intergenic
927543023 2:23929039-23929061 CAGCACTTGGAGGCCGAGGCGGG + Intronic
927544481 2:23940610-23940632 GAGCTGAGTGAGGCCGAGGCCGG + Exonic
927707210 2:25303788-25303810 CCGCAGAGGGAACCTCAGGCAGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928155009 2:28868764-28868786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
928172620 2:29013046-29013068 CAGCTGAGGCTGCCTGAGGCTGG - Intronic
928330973 2:30357608-30357630 CTGGAGAGGGAGCCCAGGGCTGG + Intergenic
928510274 2:31996430-31996452 CAGCTGAGGGAGGCTAAGGCAGG + Intronic
928551854 2:32380478-32380500 CAGCTGAGGGAGGCTGAGGCGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929195562 2:39180933-39180955 CAGCACTGGGAGGCCGAGGTGGG - Intronic
929514265 2:42592148-42592170 CAGCTAAGGGAGGCTGAGGCAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929789567 2:45013239-45013261 CAGCATGGAGCGCCCGAGGCGGG - Intergenic
930710019 2:54542329-54542351 CTGCAGAAGGAGCTCAAGGCAGG + Intronic
930804080 2:55472587-55472609 CAGGAGAGGGAGGCCAAGGCAGG + Intergenic
930808545 2:55517580-55517602 TAAAATAGGGAGCCCGAGGCGGG + Intergenic
931267583 2:60674195-60674217 CTGCAAAGGGAGGCTGAGGCAGG + Intergenic
931353459 2:61513245-61513267 CAGCACTGGGAGGCCAAGGCAGG - Intronic
931512783 2:63019460-63019482 CAGCACTGGGAGGCCCAGGCGGG + Intronic
931841879 2:66159980-66160002 AAGCAGAGGGAGGCTGAGGCAGG + Intergenic
932321352 2:70824084-70824106 AACCAGAGGGAGCCAGAGCCAGG + Intergenic
932401870 2:71486300-71486322 AAGCAGAGAGAGCCAGAGGGTGG - Intronic
932531382 2:72537353-72537375 CAGCACTGGGAGGCTGAGGCAGG + Intronic
932725961 2:74179840-74179862 CAGCTTTGGGAGGCCGAGGCGGG - Intergenic
932764309 2:74460427-74460449 CAGGAGGGTGAGCCCGGGGCAGG + Exonic
933268172 2:80204079-80204101 CAGCAGAGGGACCCTGGGCCCGG + Intronic
933739815 2:85524670-85524692 GAGCAGAGAGAGCGAGAGGCAGG + Intergenic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
935013675 2:99159172-99159194 CAGCTCTGGGAGGCCGAGGCAGG - Intronic
935234775 2:101129387-101129409 CAACACTGGGAGGCCGAGGCAGG - Intronic
935318999 2:101867053-101867075 GAGCAGAGGGGGCCCAAGGAGGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935735447 2:106103369-106103391 CTGGTGAGGCAGCCCGAGGCAGG + Intronic
936115356 2:109698104-109698126 CAGCACAAGGAGGCTGAGGCAGG - Intergenic
936267663 2:111022754-111022776 CAGCAGAGGGAGGCGAGGGCAGG + Intronic
936350601 2:111709866-111709888 CAGCAGAGGGGGCCAGAGACTGG + Intergenic
936757654 2:115734407-115734429 CAGCACTGGGAGGCCGAGGTGGG + Intronic
937001574 2:118472470-118472492 CAGCATTGGGAGGCCGAGGCGGG - Intergenic
937439337 2:121903271-121903293 CCGCTGAGGGAGCCAGAGCCGGG + Intergenic
937444844 2:121949245-121949267 CAGCACTGGGAGGCCCAGGCGGG - Intergenic
938243436 2:129760362-129760384 CAGCAGTGGTAGGCCGAGGCGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938792639 2:134690530-134690552 CAGCACTGGGAGGCTGAGGCTGG - Intronic
939491433 2:142881998-142882020 CAGCACTGGGAGGCCGAGGCAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940663019 2:156571219-156571241 CAGCAGAGGAAGCCCTACCCAGG + Exonic
942137631 2:172943625-172943647 CAGCACAGGAATCCAGAGGCAGG - Intronic
942407505 2:175671198-175671220 CAGCACTGGGAGCCTGAGGCGGG + Intergenic
942708379 2:178802628-178802650 CATCAGATAGAGCCCTAGGCAGG - Intronic
943666927 2:190618823-190618845 CAGCACTGGGAGGCCAAGGCAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944586956 2:201181040-201181062 CCACAGGGGGAGCCCCAGGCTGG + Intergenic
944894570 2:204150963-204150985 CAGCAGAGGGAAGCTGCGGCAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945365925 2:208953525-208953547 CAGCACTTGGAGGCCGAGGCGGG - Intergenic
945618659 2:212106733-212106755 CAGCAGAGGGACCCTGGGCCAGG - Intronic
945737192 2:213615342-213615364 CAGCACTGGGAGGCTGAGGCGGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946109189 2:217399121-217399143 CAGGAGAGGAAGCGCAAGGCAGG + Intronic
946217167 2:218193452-218193474 CAGCACTTGGAGGCCGAGGCAGG + Intergenic
946306626 2:218860057-218860079 CAGCAGCAGCAGCCCGAGGCGGG - Exonic
946385048 2:219378507-219378529 CAGCAGAAAGAGCCCTGGGCTGG + Intronic
947826114 2:233107169-233107191 CAGCAGAGGGTGCGGTAGGCAGG + Intronic
947943167 2:234076300-234076322 CAGCAGAGGGGGCCTGAGAGTGG - Intronic
947970594 2:234319876-234319898 CAACATTGGGAGGCCGAGGCAGG - Intergenic
948293941 2:236847263-236847285 AGGCAGAGGGAGCCAGAGGGAGG + Intergenic
948389945 2:237604754-237604776 CAGCTTTGGGAGGCCGAGGCGGG + Intergenic
948468690 2:238164129-238164151 CAGTACAGGGCGCCCGTGGCTGG + Exonic
948957645 2:241306371-241306393 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
948984967 2:241515721-241515743 CAACACTGGGAGGCCGAGGCGGG + Intergenic
949051225 2:241898648-241898670 CAGCAGTGGGAGCCCGGCTCTGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169381741 20:5113260-5113282 CAGCGGAGGTAGCCGGCGGCAGG - Intergenic
1169478791 20:5958122-5958144 CAGCACTGGGAGTCCGAGGCAGG + Intronic
1169548532 20:6676518-6676540 AAACAGAGGGAGGCCGAGGCAGG - Intergenic
1169841765 20:9945626-9945648 CAGCACTGGAAGGCCGAGGCAGG + Intergenic
1170898952 20:20441481-20441503 CAGCAGAGGCAGGTCAAGGCAGG + Intronic
1171005454 20:21461085-21461107 TAGTAGAGGGAGGCTGAGGCGGG - Intergenic
1172150924 20:32789838-32789860 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1172157781 20:32841060-32841082 CAGCACTGGGAGGCCAAGGCAGG - Intronic
1172327075 20:34044582-34044604 CAGCTTCGGGAGGCCGAGGCAGG - Intronic
1172339434 20:34144604-34144626 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1172703098 20:36864258-36864280 CAGGAGAGGGAAGCCGAGGCAGG - Intergenic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1173000001 20:39098827-39098849 GAGCAGAGGGAGGTGGAGGCAGG - Intergenic
1173005151 20:39134564-39134586 AAGCAGAGGGAGCCCCTGTCTGG + Intergenic
1174153586 20:48502770-48502792 CTGCAGCTGGAGCCCTAGGCAGG - Intergenic
1174270894 20:49367522-49367544 TAGCACTGGGAGGCCGAGGCAGG + Exonic
1174346389 20:49933205-49933227 CAGCAGGAGGAGGCTGAGGCGGG - Intergenic
1174575566 20:51534579-51534601 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1175195411 20:57239889-57239911 CAGCAGGGGGACCCAGAGACTGG + Intronic
1175255620 20:57645176-57645198 CAACAGAGGGACCCTGGGGCTGG - Intergenic
1175813544 20:61872013-61872035 CTGCAGAGGGAGGGCGAGGTGGG + Intronic
1175940148 20:62533998-62534020 CAGGGGCGGGAGCCCCAGGCTGG + Intergenic
1175994364 20:62805465-62805487 CACCTGCGGGAGCCCGGGGCGGG + Intronic
1176170084 20:63692799-63692821 CTGCAGGAGGAGCCCGTGGCTGG + Exonic
1176230712 20:64031426-64031448 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1176654103 21:9574553-9574575 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1178025803 21:28465089-28465111 CAGCACTGGGAGGCCGAGGCTGG - Intergenic
1178077278 21:29023845-29023867 CAACACTGGGAGGCCGAGGCGGG - Intergenic
1178348769 21:31855252-31855274 CAGCTGCTGGAGCCTGAGGCAGG - Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178544349 21:33480277-33480299 CAGCAGTGGGAGCCCGGCGGCGG - Intergenic
1179494281 21:41761947-41761969 CTGCAGAAAGAGCCCGGGGCAGG - Intronic
1179681137 21:43022094-43022116 AAGCACAGGGAGGCCAAGGCGGG + Intronic
1179793183 21:43767576-43767598 CAGCACAGCGACCCCGAGGCTGG + Intergenic
1179802143 21:43816180-43816202 CAGGAGAGGGAGGCAGGGGCCGG - Intergenic
1179977861 21:44880477-44880499 CAACAGTGGGAGGCCAAGGCAGG + Intergenic
1180051153 21:45331614-45331636 CAGCAGAGGGTGGCCCAGGGAGG + Intergenic
1180154849 21:45972821-45972843 CAGCAGTGGGAGCCCTCGGGTGG - Intergenic
1180763149 22:18223832-18223854 CTGCAGAGGCAGCCCCAGGTAGG - Intergenic
1180772496 22:18400715-18400737 CTGCAGAGGCAGCCCCAGGTAGG + Intergenic
1180803876 22:18650331-18650353 CTGCAGAGGCAGCCCCAGGTAGG + Intergenic
1180806887 22:18719118-18719140 CTGCAGAGGCAGCCCCAGGTAGG - Intergenic
1181157203 22:20930626-20930648 CAACACTGGGAGGCCGAGGCGGG - Intronic
1181217842 22:21344928-21344950 CTGCAGAGGCAGCCCCAGGTAGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1182182328 22:28363177-28363199 CAGCAGAGGGACCCTGGGTCCGG - Intronic
1182333788 22:29569740-29569762 CAGCACTCGGAGGCCGAGGCAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182631135 22:31686352-31686374 CAGCACTGGGAAGCCGAGGCGGG - Intronic
1182984282 22:34701757-34701779 CAGCACTGGGAGGTCGAGGCGGG + Intergenic
1183411375 22:37656738-37656760 CAGCACTGGGAGCCTGAGGCAGG + Intronic
1183450201 22:37889850-37889872 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
1183642882 22:39102751-39102773 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1184129549 22:42509575-42509597 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1184139752 22:42571668-42571690 CAACACTGGGAGGCCGAGGCGGG - Intronic
1184156098 22:42668221-42668243 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184256199 22:43288485-43288507 AAGCGGGAGGAGCCCGAGGCGGG - Intronic
1184761358 22:46546621-46546643 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1184781609 22:46652409-46652431 CAGCCCAGGGAGACCCAGGCTGG + Intronic
1185001021 22:48245842-48245864 CAGCAGTAGGAGGCTGAGGCGGG + Intergenic
1203234336 22_KI270731v1_random:141703-141725 CTGCAGAGGCAGCCCCAGGTAGG + Intergenic
949376221 3:3393050-3393072 CAGCAGAGGTGGCCCCAGGGAGG - Intergenic
950018120 3:9768440-9768462 CAGCAGAGGAAGGGCCAGGCTGG - Intronic
950136582 3:10585247-10585269 CAGCTTTGGGAGGCCGAGGCTGG + Intronic
950193275 3:10992579-10992601 CTGCGGAGGGAGCGCGCGGCGGG + Intergenic
950448411 3:13051766-13051788 TAGCAGAGGGAAACTGAGGCAGG - Intronic
950522701 3:13506024-13506046 CAGCAGAGGGAGCATTAGGGAGG - Exonic
950572294 3:13808951-13808973 TAGCAGAGAGAGGCCCAGGCTGG + Intergenic
950576777 3:13836905-13836927 CAGCAGTGGCAGCCCCAGGTAGG + Intronic
951127055 3:18996385-18996407 CAGCAGAGGGATCCTGGGCCTGG + Intergenic
951202923 3:19894738-19894760 CAACACTGGGAGGCCGAGGCAGG + Intronic
951738905 3:25898514-25898536 CAGCTGCGGGAGGCTGAGGCAGG - Intergenic
952255054 3:31687823-31687845 CAACAGTGGGAGGCTGAGGCAGG + Intronic
952261866 3:31747939-31747961 CAGCAGAGTGTGCACCAGGCGGG - Exonic
952541247 3:34370542-34370564 CAGCACAGGGACCCTGGGGCCGG - Intergenic
952819026 3:37470041-37470063 CAGCACTGGGAGGCCGAGGTGGG - Intronic
952929665 3:38349260-38349282 GAGCAGAGAGAGGCGGAGGCTGG + Intronic
953991552 3:47487849-47487871 CAGCACTGGGAGGCCGAGGTAGG - Intergenic
954026888 3:47790181-47790203 CAGCTTTGGGAGGCCGAGGCGGG - Intergenic
954058054 3:48044514-48044536 CAGCACTGGGAGGCCGAGGTGGG + Intronic
954175426 3:48841130-48841152 CAGCACTGGGGGGCCGAGGCGGG - Intronic
954185350 3:48912797-48912819 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954605864 3:51908728-51908750 CAGCACAGGGAGCCAGGGGCTGG + Intergenic
954634224 3:52062850-52062872 CATCACTGGGAGCCCAAGGCGGG - Intergenic
954707383 3:52488372-52488394 CAGCAAAGGCGCCCCGAGGCTGG - Exonic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955271297 3:57502151-57502173 CAACCCAGGGAGGCCGAGGCGGG - Intronic
955283276 3:57614728-57614750 TAGCAGAGGGAGGCCGAGGCGGG + Intergenic
956761238 3:72446992-72447014 GCGCAGGGGCAGCCCGAGGCCGG + Intergenic
956822101 3:72963324-72963346 CAGCACTGGGAGGCTGAGGCGGG + Intronic
957680631 3:83428580-83428602 CAGCTGAGGCAGGCTGAGGCAGG + Intergenic
958012606 3:87899614-87899636 CAGCTGTGGGAGGCTGAGGCGGG + Intergenic
958157344 3:89771602-89771624 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
958416534 3:93881074-93881096 CAGCACTGGGAGGCTGAGGCAGG + Intronic
958487310 3:94729239-94729261 CAACATAGGGAGACCCAGGCTGG + Intergenic
958878773 3:99645532-99645554 CAGTAGAGGGAGCCAGGGGCTGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959439680 3:106360364-106360386 CAGCAGAGGGACCCTGAACCTGG - Intergenic
960512971 3:118572323-118572345 CAGCACTGGGAGGCCGAGGCTGG - Intergenic
960760446 3:121068252-121068274 CAGCACTGGGAGGCCGAGGCAGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961301350 3:125924148-125924170 CTGCACAGGGTGCCCGGGGCTGG - Intergenic
961346486 3:126266760-126266782 CAGCCCAGGGAGCCAGGGGCTGG + Intergenic
961387556 3:126530923-126530945 GCGCAGAGGGGGCCTGAGGCAGG + Intronic
961413868 3:126743393-126743415 CAGCAGAGGTCGCCTGAGCCAGG - Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961451990 3:127006404-127006426 GTGCAGAGGGTGCCTGAGGCTGG + Intronic
961453776 3:127014458-127014480 CAGCTGAGGGAGGCAGAGGCTGG - Exonic
961896595 3:130173026-130173048 CAACACTGGGAGGCCGAGGCAGG - Intergenic
962312881 3:134338390-134338412 CAGCAGAGGAAGCCAAAAGCAGG - Intergenic
962349346 3:134645183-134645205 CAGCAGGGGAAGCCCGTTGCTGG + Intronic
962518559 3:136176576-136176598 CAGCATTGGGAGGCTGAGGCAGG + Intronic
963204065 3:142614767-142614789 CAGCAGATGGAGCCCAGGCCAGG - Intronic
963736557 3:149023734-149023756 CAGAATAGGGAGGCCAAGGCAGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
963960516 3:151304325-151304347 CAGCACTGGGTGGCCGAGGCTGG + Intronic
964615090 3:158655237-158655259 CAGGAGTGGGAGGCCAAGGCGGG + Intronic
965795349 3:172433264-172433286 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
965897463 3:173594955-173594977 CAGCACAGGGACCCTGAGCCTGG + Intronic
966005318 3:175004125-175004147 CAGCACTGGGAGGCCAAGGCAGG + Intronic
966059266 3:175734761-175734783 CAGCAGAGGGACCCTGGGCCTGG + Intronic
966596121 3:181726047-181726069 CAGCTGGGGGAGCGCCAGGCAGG + Intergenic
966624964 3:182005860-182005882 CTGGAGAGGCAGCTCGAGGCAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966794590 3:183701331-183701353 CAGCACTGGGAGGCCAAGGCAGG - Intronic
966851692 3:184168773-184168795 GAGCAGAGGGTGTCCCAGGCAGG + Intronic
967721459 3:192820642-192820664 TTGCAGAGAGAGCCCGGGGCGGG - Intronic
968141484 3:196261408-196261430 CAGCACTGGGAGGCCGAGGCAGG + Intronic
968350125 3:198046671-198046693 GAGCAGAGGGAGCTCAGGGCTGG + Intergenic
968458888 4:713825-713847 CAGCAGAGGGCGCACAGGGCAGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968643489 4:1726878-1726900 TAGCACTGGGAGGCCGAGGCGGG + Intronic
968664663 4:1814617-1814639 CAGCACAGTGAGGCAGAGGCGGG + Intronic
968752198 4:2396057-2396079 CTGCAGAGGGGACCCAAGGCGGG + Intronic
968752382 4:2396762-2396784 CTGCAGAGGGGACCCAAGGCGGG + Intronic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
968932128 4:3586725-3586747 CAGCAGCGGGGGCCCTGGGCAGG + Intronic
968948323 4:3677140-3677162 CAGCGGGAGGAGCCCGGGGCTGG + Intergenic
969055701 4:4401386-4401408 CAGGAGAGGGAACACGAGCCCGG - Intronic
969226078 4:5799167-5799189 CAGCAGAGGCGGCCAGGGGCAGG - Intronic
969386883 4:6857365-6857387 CTGCAGATGGAGCATGAGGCTGG - Intronic
969423055 4:7108399-7108421 GGGCAGGGGGAGTCCGAGGCCGG - Intergenic
969806198 4:9610936-9610958 CAACACTGGGAGACCGAGGCAGG + Intergenic
969864363 4:10064137-10064159 CAGCTGTGGGAGCCCGATGAGGG - Intergenic
970401212 4:15719571-15719593 GGGCAGAGAGAGCCAGAGGCAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970807526 4:20053842-20053864 CTGCAGTTGGAGGCCGAGGCAGG - Intergenic
971753285 4:30678187-30678209 CAGCAGAGGGAGCCTGGGCCCGG - Intergenic
972426173 4:38935161-38935183 CAGCTGTGGGAGGCCGAGGTGGG - Intronic
972484796 4:39530871-39530893 CAGCAGAGGGATCCTGGGCCCGG + Intergenic
972514299 4:39797840-39797862 CAGCACTGAGAGGCCGAGGCAGG - Intergenic
972629505 4:40831149-40831171 CAGCACTGGGAGGCCGAGGTGGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973015768 4:45135117-45135139 CAGCAGAGGGAGCCTGGGCCTGG + Intergenic
973075789 4:45924200-45924222 GAGCAAAAGGAGCCAGAGGCAGG - Intergenic
973169587 4:47122857-47122879 CAGTAGAGGGAGCTAGAGGAAGG - Intronic
973307927 4:48674489-48674511 CAACATAGGGAGGCCAAGGCGGG + Intronic
973318286 4:48783535-48783557 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
973557324 4:52097502-52097524 CAGCAGAGAGAGCGCAAGGAGGG + Intergenic
973730029 4:53814357-53814379 AAGCAGAGGGAGCTCTGGGCTGG + Intronic
973768131 4:54182256-54182278 CAGGCGTGGGAGGCCGAGGCAGG - Intronic
974206078 4:58705088-58705110 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
975570839 4:75816209-75816231 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976581371 4:86740501-86740523 CAGCAGAGGGACCCTGGGCCCGG + Intronic
977442981 4:97093765-97093787 CAGCTGTGGGAGGCTGAGGCAGG - Intergenic
977799360 4:101207578-101207600 CAGCACTGGGAGGCCGAGGTGGG + Intronic
978045014 4:104114825-104114847 CAGCAGAGGCAGCCTAAGCCTGG + Intergenic
978141336 4:105320684-105320706 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978443487 4:108758802-108758824 CAGCACTGGGAGGCCGAGGCGGG + Intronic
978490066 4:109302788-109302810 CAGCAGCGGGAGCGGCAGGCCGG - Intergenic
978801324 4:112758146-112758168 CAGCACTCGGAGGCCGAGGCGGG - Intergenic
978906928 4:114016201-114016223 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979426443 4:120572747-120572769 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
979783208 4:124682068-124682090 ATGCACAGGGAGGCCGAGGCGGG + Intronic
980316213 4:131204315-131204337 CAGCTATGGGAGGCCGAGGCGGG + Intergenic
980454588 4:133022666-133022688 CAGAAGAGGGAGCCAGGAGCAGG + Intergenic
980933081 4:139199874-139199896 CAACACTGGGAGGCCGAGGCGGG + Intergenic
981061873 4:140433408-140433430 CAGGATTGGGAGGCCGAGGCGGG + Intergenic
981175828 4:141682708-141682730 CAATAGGGGGAGGCCGAGGCGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982110796 4:152051673-152051695 CAACACAGGGAGGCCGAGGCAGG - Intergenic
982846457 4:160259181-160259203 CAGCATTGGGAGGCCGAGGTGGG - Intergenic
982948474 4:161658215-161658237 CAGCATCGGGAGGCAGAGGCAGG + Intronic
982962156 4:161853512-161853534 AGGCCGAGGGAGGCCGAGGCAGG - Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983669052 4:170215090-170215112 CAGCACAGGGACCCTGAGTCTGG - Intergenic
984645839 4:182218974-182218996 CAGCACTGGGAGGCCGAGGCAGG + Intronic
984738099 4:183130296-183130318 CAGCACTGGGAGGCCGAGGCAGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985125541 4:186690447-186690469 CAGCACCTGGAGGCCGAGGCAGG + Intronic
985156068 4:186988222-186988244 CAGCAGAGGGACCCCGGCCCTGG + Intergenic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
986454162 5:7899042-7899064 CAAGAGAGGGAGCAAGAGGCAGG + Intronic
987135755 5:14897940-14897962 CATCATAGAGGGCCCGAGGCAGG + Intergenic
987511706 5:18847892-18847914 CAGCAGAGGGACCCTGCGCCAGG + Intergenic
988075168 5:26342973-26342995 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991119462 5:62994361-62994383 CAGCAGAGGGATTCTGAGCCTGG + Intergenic
991143608 5:63274857-63274879 GAGCTGAGGGAGGCTGAGGCAGG + Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991485837 5:67135819-67135841 CAGCAGAGGAAGCTAGAGGCAGG + Intronic
992004344 5:72462795-72462817 CAACTGTGGGAGGCCGAGGCGGG - Intronic
992640011 5:78761126-78761148 CAGTAGGGGCAGCCCCAGGCTGG - Intronic
993215907 5:85022049-85022071 CAGCACAGGGATCCTGAGCCCGG + Intergenic
993257099 5:85605396-85605418 CAGAAGAGTGAGTCCCAGGCTGG + Intergenic
993968990 5:94393958-94393980 CAGCTGAGGGAGGCTGAGACAGG - Intronic
993987013 5:94609700-94609722 CAGGAGTGGGAGGCCGAGGCAGG + Intronic
994337321 5:98582839-98582861 CAGAAGAGGGAGCCAGAAACTGG - Intergenic
994340129 5:98617261-98617283 CAGCACTGGGAGACTGAGGCAGG + Intergenic
994542834 5:101121676-101121698 CAGCAGAGGGATCCTGGGTCTGG + Intergenic
994548696 5:101204844-101204866 CAGCACAGGGACCCTGAGCCTGG - Intergenic
994878108 5:105451069-105451091 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
995396625 5:111693875-111693897 CAGCTGAGAGAGGCTGAGGCAGG + Intronic
996044466 5:118854942-118854964 CAGCAGCAGGAGGCCGAGGTGGG + Intronic
996173397 5:120324197-120324219 CAGCACTGGGAGGCCGAGGCGGG + Intergenic
996214358 5:120848981-120849003 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
997274655 5:132574421-132574443 CAGCAGAGGGACCCTGGGCCTGG + Intronic
997511617 5:134458574-134458596 CAGGAGAGGGCTCCAGAGGCAGG - Intergenic
997552943 5:134769650-134769672 CAGGGGTGGGAGGCCGAGGCAGG - Intronic
997887326 5:137641854-137641876 CAGCAGCAGCAGCTCGAGGCTGG - Intronic
998176339 5:139904315-139904337 CGGGAGAGGGAGCCCGATCCCGG - Intronic
999012273 5:148056033-148056055 CAGCAGAGGGACCCTAAGCCTGG - Intronic
999149220 5:149415711-149415733 CAGAAGAAAGAGCCCAAGGCTGG + Intergenic
999734273 5:154500964-154500986 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001713036 5:173793238-173793260 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1001744648 5:174082992-174083014 AAGCAGAGGAAGCCTGAGGAAGG - Intronic
1002027850 5:176407548-176407570 CAGCAGTGGGAGGCTGAGGTGGG - Intronic
1002063039 5:176637723-176637745 CAGCAGAGGGAGGGAGAGGAGGG + Intronic
1002124285 5:177030370-177030392 CAGCACTGGGAGGCCGAGGCGGG + Intronic
1002189382 5:177470814-177470836 CATCAGAGGCACCCCGAGCCTGG + Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002313665 5:178329690-178329712 CAGGACCGGGAGGCCGAGGCAGG + Intronic
1002427837 5:179186322-179186344 CAGCAGAAGGAGCCCGGCCCCGG - Intronic
1002456297 5:179346797-179346819 CACCTAAGGGTGCCCGAGGCTGG + Intergenic
1002525946 5:179816392-179816414 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1002600623 5:180352543-180352565 CACGAGAGGGAGTCCGGGGCGGG - Intronic
1002645068 5:180648993-180649015 CCCCAGAGGGCGCTCGAGGCGGG - Intronic
1002664159 5:180810460-180810482 CAGCAGCGGAAGCGCGCGGCAGG + Intronic
1002929210 6:1621679-1621701 CAGCAGAGAGAGCCCGCGACGGG + Intergenic
1002961093 6:1915436-1915458 CAGCAGGGGCAGCCCAGGGCCGG + Intronic
1003074624 6:2971973-2971995 CAACACTGGGAGGCCGAGGCAGG + Intronic
1003164406 6:3663718-3663740 CTGGAGAGGGTGCCAGAGGCAGG - Intergenic
1003171509 6:3724964-3724986 GAGCATAGGGAAGCCGAGGCGGG - Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003378775 6:5603636-5603658 CTGCAGATGAAGCCAGAGGCTGG - Intronic
1004517433 6:16332286-16332308 CACCAGAGGGCGCCCCAGGATGG + Intronic
1004707316 6:18136559-18136581 CAGCACCGGGTGGCCGAGGCGGG + Intronic
1005040684 6:21596730-21596752 CAGCAGCGGGAGCTAGGGGCGGG + Exonic
1005107976 6:22246002-22246024 AAGCAGGGGGAAGCCGAGGCAGG - Intergenic
1005136091 6:22570583-22570605 GAGAAGAGGGAGCCGGAAGCTGG - Exonic
1005511250 6:26513372-26513394 CAGGACAGGGAGCCAAAGGCAGG - Intergenic
1005874499 6:30000702-30000724 CAGCTTTGGGAGGCCGAGGCCGG + Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006474629 6:34246163-34246185 CCAGAGAGGGAGCCCCAGGCTGG - Exonic
1006518831 6:34559859-34559881 CAGCCCAGGGAGCTGGAGGCAGG - Intergenic
1006617890 6:35342387-35342409 CACCAGAGGGCGCCACAGGCTGG + Intergenic
1006647327 6:35523605-35523627 CAACAGTGGGAGGCCGAGGCAGG + Intergenic
1006860564 6:37169677-37169699 CATCAAAGGCCGCCCGAGGCCGG - Intergenic
1007109377 6:39304185-39304207 GAGCCGAGGGAGCTGGAGGCAGG + Intronic
1007321796 6:41033147-41033169 CTGCAGAGGGAGCCAGTGGCAGG + Intronic
1007565136 6:42844261-42844283 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1007665396 6:43510291-43510313 TGGCAGAGAGAGCCTGAGGCGGG + Exonic
1007741208 6:44010653-44010675 CAGCACTGAGAGACCGAGGCAGG - Intergenic
1007828757 6:44622069-44622091 TTGCTGAGGGAGCCCCAGGCAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1010147520 6:72688081-72688103 CAGTATTGGGAGGCCGAGGCAGG - Intronic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1010795894 6:80115880-80115902 CAGCATTGGGAGGCCGAGGGGGG - Intronic
1011470570 6:87703498-87703520 CAGCACTGGGAGGCCGAGGCAGG + Intergenic
1011682799 6:89799434-89799456 CAACACTGGGAGGCCGAGGCGGG + Intronic
1011942321 6:92857626-92857648 CAGCAGAAGGACCCTGAGCCTGG + Intergenic
1012436440 6:99219943-99219965 CAGCAGGGGGAGTCCTGGGCTGG - Intergenic
1012534880 6:100283511-100283533 CAGCAGAGGCTGCTGGAGGCTGG - Intergenic
1012728620 6:102850077-102850099 CACTAGAGGGAGGCCTAGGCGGG + Intergenic
1013416120 6:109926179-109926201 CATCAGAGGTACCTCGAGGCAGG + Intergenic
1014757079 6:125313180-125313202 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1015120283 6:129693464-129693486 CAGAAGAGAAAGCCCTAGGCTGG - Intronic
1015986306 6:138887470-138887492 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1016139744 6:140594196-140594218 CAGCACAGGGACCCTGAGCCTGG - Intergenic
1016253183 6:142071765-142071787 CAGCAGAGGGACCCTGGGCCTGG - Intronic
1016746909 6:147590657-147590679 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1016947258 6:149546357-149546379 CACCAGGGGGCGCCCGCGGCGGG + Intergenic
1017270429 6:152497045-152497067 CAGCAAAGGGAGACAGAGGTGGG - Intronic
1018242883 6:161795478-161795500 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1018592468 6:165442513-165442535 CAGAAGAGGGAGTGCAAGGCGGG + Intronic
1018804476 6:167248358-167248380 CAGCAGAGGGAACCAGAGGGAGG - Intergenic
1018825766 6:167406996-167407018 GAGCAGAGAGAGCCAGAGGGAGG - Intergenic
1018894505 6:168004289-168004311 CAGCACATGGAGCCCACGGCAGG + Intronic
1018947291 6:168356685-168356707 CAGCAGGGGCAGCCCCAGGCAGG + Intergenic
1018947307 6:168356740-168356762 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947323 6:168356795-168356817 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947388 6:168357015-168357037 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947404 6:168357070-168357092 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947420 6:168357125-168357147 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947438 6:168357180-168357202 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947455 6:168357235-168357257 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947520 6:168357455-168357477 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947553 6:168357565-168357587 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947652 6:168357894-168357916 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947669 6:168357949-168357971 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947689 6:168358004-168358026 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947707 6:168358059-168358081 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947727 6:168358114-168358136 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947743 6:168358169-168358191 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947843 6:168358498-168358520 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947858 6:168358553-168358575 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947878 6:168358608-168358630 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947896 6:168358663-168358685 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947916 6:168358718-168358740 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947932 6:168358773-168358795 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947948 6:168358828-168358850 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1019058749 6:169241086-169241108 CAGGAGATGGAGCCCAGGGCAGG - Intronic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1019207516 6:170375090-170375112 CAGCAGAGGGAGCCCTGAACTGG - Intronic
1019305632 7:333054-333076 GGTCAGAGGGCGCCCGAGGCAGG - Intergenic
1019371372 7:663670-663692 CAGCAGCGGTGGCCCGAAGCAGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019479123 7:1258123-1258145 CTGCAGAGGGAGCCCGGGCCTGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019748051 7:2711665-2711687 CAGCACAGGGAGGCAGAGGCAGG - Intronic
1019779539 7:2931204-2931226 CAGCAGAGGGAGGCCAGGGCGGG - Intronic
1019965316 7:4494094-4494116 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1019969308 7:4527400-4527422 CAGCCTTGGGAGGCCGAGGCTGG + Intergenic
1020117162 7:5482257-5482279 CAGCAGAGGGACCCCACTGCAGG + Intronic
1020160602 7:5768319-5768341 CAGTAGTGGGAGGCCGAGGCAGG + Intronic
1020303882 7:6817764-6817786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1020320556 7:6936123-6936145 CTGCACAGGGTGCCCGGGGCTGG + Intergenic
1020834652 7:13134358-13134380 CAGCACTGGGAGGCAGAGGCTGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022299356 7:29088728-29088750 CACCTGTGGGAGGCCGAGGCGGG + Intronic
1022412021 7:30146443-30146465 CAGTATAGGGAGGCCGAGGGCGG + Intronic
1023124935 7:36946050-36946072 CAGCAGAGGTAGCCTGAGCTGGG + Intronic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1024274232 7:47664931-47664953 CAACAGAGGGAGCTCGTGGTGGG + Intergenic
1024959137 7:54956924-54956946 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1025201905 7:56967383-56967405 GAGCAGAGGGGGCGGGAGGCAGG - Intergenic
1025257671 7:57396407-57396429 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1025670041 7:63609545-63609567 GAGCAGAGGGGGCGGGAGGCAGG + Intergenic
1025729546 7:64097842-64097864 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1025825845 7:65009767-65009789 CAGCACTGGGAGGCCAAGGCTGG + Intergenic
1025898841 7:65727552-65727574 CAGCACTGGGAGGCCAAGGCTGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026013395 7:66654249-66654271 CAGCAGCGGGAGAGCGACGCTGG - Intronic
1026017334 7:66681847-66681869 CAGCAGCGGGAGGGCGACGCCGG - Intronic
1026047677 7:66918689-66918711 CAACAGTGGGAGGCTGAGGCAGG - Intergenic
1026315686 7:69225245-69225267 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1026735998 7:72949066-72949088 CAGCTGGAGGAGCCCGGGGCAGG - Exonic
1026786348 7:73304000-73304022 CAGCTGGAGGAGCCCGGGGCAGG - Exonic
1026884094 7:73927864-73927886 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1027121080 7:75520869-75520891 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1028323370 7:89490925-89490947 CAGCTTTGGGAGGCCGAGGCGGG + Intergenic
1029022400 7:97378482-97378504 CTGCACGGGGAGGCCGAGGCGGG - Intergenic
1029148631 7:98464675-98464697 AAGCATAGGGAGGCAGAGGCTGG + Intergenic
1029239776 7:99151560-99151582 CAGGATTGGGAGCCTGAGGCTGG - Intergenic
1029269066 7:99365702-99365724 CAGCAGGGGGAGCCCCGGCCTGG + Intronic
1029289376 7:99490401-99490423 CAGCACTGGGAGGCCAAGGCTGG - Intronic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1029374680 7:100170523-100170545 AAGCAGAGGGAGACAGAGGGAGG + Intronic
1030213438 7:107019237-107019259 CAACTTTGGGAGCCCGAGGCGGG - Intergenic
1031408902 7:121419545-121419567 CAACCTAGGGAACCCGAGGCTGG + Intergenic
1031976948 7:128100161-128100183 CAGCACTGGGAGACCAAGGCGGG + Intergenic
1032064829 7:128759947-128759969 CAACACTGGGAGGCCGAGGCGGG + Intronic
1032172491 7:129597090-129597112 CAGCACTGGGAGGCCAAGGCAGG + Intergenic
1032784627 7:135191127-135191149 CAGCAAAGGCAGCCAGAGGATGG + Intronic
1032836874 7:135682851-135682873 CAGCAGAGGAAGCGGGAGACAGG + Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033208942 7:139446087-139446109 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
1033217376 7:139502994-139503016 CAGCACTGGGAGGGCGAGGCAGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033325117 7:140371285-140371307 CAGCTGAGGGAGGCTGAGGCAGG - Intronic
1033641905 7:143269431-143269453 CAGCCGAGGGAACCAGAGTCTGG + Intronic
1033713048 7:143969086-143969108 CAGCTTTGGGAGGCCGAGGCGGG + Intergenic
1034113563 7:148562362-148562384 CAGAAGCAGGAGCCCTAGGCTGG + Intergenic
1034135604 7:148765517-148765539 CTGCACAGGGAGGCTGAGGCAGG + Intronic
1034173694 7:149083461-149083483 TAGCACTGGGAGGCCGAGGCGGG - Intronic
1034206765 7:149323235-149323257 CAGCTGTGGGAGGCTGAGGCAGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034995293 7:155573115-155573137 CACTTGAGGGAGGCCGAGGCAGG + Intergenic
1035223672 7:157421882-157421904 CAGCACTGGGAGGCCGAGGCGGG - Intergenic
1035232274 7:157472500-157472522 CAGGAGAGGGAGCCCATGCCTGG + Intergenic
1035635029 8:1138120-1138142 CAGCAGAGCGAGCCTGAGAATGG + Intergenic
1035861851 8:3037452-3037474 CGGTATAGGGAGGCCGAGGCGGG - Intronic
1036359149 8:8065424-8065446 CAGCAGAGGGCGCGAGAGCCAGG + Intergenic
1036369334 8:8149420-8149442 CAACACTGGGAGGCCGAGGCAGG + Intergenic
1036548204 8:9792430-9792452 CAGCTGAAGGAGGCTGAGGCAGG + Intergenic
1036881556 8:12516220-12516242 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1036891809 8:12601528-12601550 CAGCAGAGGGCGCGAGAGCCAGG - Intergenic
1037367371 8:18137126-18137148 CAGCACTGGGAGGCCAAGGCGGG - Intergenic
1037378702 8:18261380-18261402 CAGTCAAGGGAGCCCGATGCCGG + Intergenic
1037769212 8:21789162-21789184 GAGCCGAGGGAGCCGGCGGCTGG - Intronic
1038400869 8:27283758-27283780 CAGCCCAGGGAGCCCCGGGCAGG + Intergenic
1038462899 8:27731344-27731366 CAACACTGGGAGGCCGAGGCGGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038748918 8:30278341-30278363 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1039403274 8:37291376-37291398 CAGCACAGAGAGTCTGAGGCTGG - Intergenic
1039745532 8:40422810-40422832 GACCACAGGGAGCCCCAGGCAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040851814 8:51908794-51908816 CAGCAGAGTGTGGCAGAGGCAGG - Intergenic
1041632945 8:60108652-60108674 CAGCAGAGCAAGCCTGGGGCAGG + Intergenic
1041726749 8:61025093-61025115 CAGCACTTGGAGGCCGAGGCAGG - Intergenic
1042283175 8:67077585-67077607 CAGCTTTGGGAGGCCGAGGCGGG - Intronic
1042307360 8:67345416-67345438 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1042365103 8:67927216-67927238 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1042608974 8:70577169-70577191 CACGAGAGGGAGGCCGAGGGGGG + Intronic
1044006240 8:86940411-86940433 AGGCCGAGGGAGGCCGAGGCAGG - Intronic
1044189442 8:89297555-89297577 CAGCACAAGAAGCCCGATGCTGG + Intergenic
1044743727 8:95352566-95352588 CAGGACAGGGATCCTGAGGCAGG + Intergenic
1045016279 8:98004038-98004060 CAGCACAGGGAGGCCAAGGCGGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045211679 8:100106094-100106116 CCGCCCAGGGAGGCCGAGGCCGG + Exonic
1045238229 8:100374832-100374854 CAACACTGGGAGGCCGAGGCGGG + Intronic
1046395318 8:113632968-113632990 CAGGAGAGGGAGGCCAAGGTGGG - Intergenic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046750354 8:117920348-117920370 CAGCACTTGGAGGCCGAGGCGGG - Intronic
1047757806 8:127932018-127932040 CAACAGAGGAAGCCTGAGGATGG - Intergenic
1048307672 8:133295464-133295486 CGGCAGAGCCAGCCCCAGGCTGG - Intronic
1048500668 8:134971891-134971913 CAGCACTGGGAGGCCGAGGCAGG - Intergenic
1048804909 8:138231129-138231151 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049207983 8:141372214-141372236 CAGCTGTGTGAGCCCGAGGGAGG - Intergenic
1049236135 8:141513311-141513333 CAGCGGAGGGAGCTGGAGCCTGG + Intergenic
1049243510 8:141550367-141550389 CAGCAGAGGGAGCAGGGGCCAGG + Intergenic
1049345171 8:142134882-142134904 CAGCGCAGGAACCCCGAGGCCGG + Intergenic
1049594504 8:143477194-143477216 GAGCAGAGAGAGCCCGGTGCCGG + Intronic
1049826888 8:144674740-144674762 CACAGGAGGGAGCCCGAGGAGGG - Intergenic
1049837607 8:144748318-144748340 CAGCACTGGGAGGCCGAGGCGGG - Intronic
1049918107 9:337905-337927 CAGCACTGGGAGGCCGAGGCAGG + Intronic
1050155973 9:2666796-2666818 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050574942 9:6985070-6985092 CAGCAGAGGGAGTCGGATTCTGG - Intronic
1050828661 9:9983211-9983233 CAGCAGAGGTAGCCCCATTCTGG + Intronic
1051029656 9:12658712-12658734 CACGAGAGGGAGGCCAAGGCGGG - Intergenic
1052156833 9:25202807-25202829 CAGCAGATGGAGCCTGGGCCTGG + Intergenic
1052290986 9:26840300-26840322 CAGCACTGGAAGGCCGAGGCGGG - Intergenic
1052701304 9:31941257-31941279 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1052864018 9:33454090-33454112 CAGCTGAAGGTGCCCAAGGCTGG - Intergenic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1053202437 9:36161936-36161958 CAGCACTGGGAGACTGAGGCAGG + Intronic
1053276699 9:36788586-36788608 GAGAAGAGGGAGCCCCTGGCAGG + Intergenic
1054257980 9:62834072-62834094 CAGCAGAGGAAGACTGGGGCAGG - Intergenic
1054458007 9:65445203-65445225 CAGCAGCGGGGGCCCTGGGCAGG - Intergenic
1055167863 9:73219098-73219120 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1055776191 9:79769460-79769482 CAGAGGATGGAGCCCGATGCAGG - Intergenic
1056236936 9:84604043-84604065 CCACAGTGGGAGGCCGAGGCAGG - Intergenic
1056331226 9:85522849-85522871 CAGCAGAGAGAGGCCGATGCGGG - Intergenic
1057684939 9:97222708-97222730 CAGCAGAGGAAGACCGGGTCAGG - Intergenic
1058515282 9:105766045-105766067 CAGCACTGGGAGGCCGAGGCAGG - Intronic
1058862161 9:109126976-109126998 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
1059777400 9:117489169-117489191 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1060299036 9:122363274-122363296 CAGCTCAGGGAGGCTGAGGCGGG - Intergenic
1060375879 9:123114905-123114927 CAGCAGAGGGATGGAGAGGCAGG - Intronic
1060479142 9:124007883-124007905 GAGCAAAGGGGGCCCCAGGCAGG + Intronic
1060588102 9:124799409-124799431 CAGCAGCTGGAGGCCCAGGCGGG - Exonic
1060758360 9:126228455-126228477 CACCTGCTGGAGCCCGAGGCTGG + Intergenic
1060924832 9:127449071-127449093 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1060986218 9:127820439-127820461 CTGCAATGGGAGGCCGAGGCAGG - Intronic
1061011297 9:127956120-127956142 CAGGAGTGGGGGCCCTAGGCTGG + Intronic
1061231673 9:129319243-129319265 CAGCAGAGGGGGCCAGGGGAGGG - Intergenic
1061326429 9:129867477-129867499 GAGCAGGGGGAGCCAGAGGAAGG + Intronic
1061483405 9:130908460-130908482 CAGCTTGGGGAGCCTGAGGCAGG + Intronic
1061485305 9:130917596-130917618 CTGCAGAGGCAGCCCTGGGCGGG - Intronic
1061675038 9:132210794-132210816 CAGCAGAGGGAGCGTGGGGTGGG + Intronic
1061714293 9:132509345-132509367 CAGCAGAGGTAGCCCGGGCTGGG - Intronic
1061756743 9:132818734-132818756 CTTCAGTGGGAGGCCGAGGCGGG + Intronic
1061817476 9:133205648-133205670 CACCTGAGGGAGCCGGAGGGAGG + Exonic
1061906592 9:133702431-133702453 AAGCAGAGGGAACCAGAGCCGGG - Intronic
1062076392 9:134592297-134592319 CCGCAGAGAGAGGCCGAGGCTGG - Intergenic
1062212186 9:135371153-135371175 CAGCAGGGGGAGCTGGAGGCAGG - Intergenic
1062232209 9:135487824-135487846 CTGCAGAGGCAGCCCCAGGTGGG - Exonic
1062242929 9:135549578-135549600 CACCTGAGGGAGCCGGAGGGAGG - Exonic
1062329086 9:136028956-136028978 CACAAGAGGGAGGCCGAGGTGGG + Intronic
1062375162 9:136258851-136258873 CAGCAGAGCCTGTCCGAGGCTGG - Intergenic
1062424297 9:136498883-136498905 CAACAGGGTGAGCGCGAGGCTGG - Exonic
1062618094 9:137407150-137407172 CAGCAGAGGGGCCCAGAGACCGG - Intronic
1062707644 9:137954166-137954188 CAGCAGAGGGCCCCCAAGCCAGG + Intronic
1202800793 9_KI270719v1_random:174308-174330 CAGCAGAGGAAGACTGGGGCAGG + Intergenic
1203631825 Un_KI270750v1:78011-78033 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1185479979 X:438758-438780 CAGCAGGGGGTTCCCGCGGCTGG + Intergenic
1185583609 X:1229028-1229050 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1186195715 X:7108799-7108821 CAACACTGGGAGACCGAGGCTGG - Intronic
1186379287 X:9040161-9040183 CAGAAGTAGGAGCCTGAGGCTGG + Intronic
1186496132 X:10014545-10014567 GAGCTGGGGGAGCCCGCGGCCGG - Intergenic
1187115895 X:16350226-16350248 CAACACTGGGAGTCCGAGGCAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188997573 X:36904750-36904772 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
1189785379 X:44554676-44554698 CAGCACTGGGAGGCAGAGGCGGG - Intergenic
1189821096 X:44871272-44871294 CTGCAAAGGGAGGCCGAGGCGGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190228074 X:48560891-48560913 CAGCAAAGAGAGCCCTAGCCCGG - Exonic
1190319383 X:49171397-49171419 CAACACTGGGAGGCCGAGGCGGG - Intergenic
1190784892 X:53636475-53636497 AGCCAGTGGGAGCCCGAGGCGGG + Intronic
1191673334 X:63769626-63769648 CAGCAGAGGGACCCTGGGCCCGG - Intronic
1191875207 X:65788499-65788521 GGGCAGAGGGAGCCCCAGCCGGG - Intergenic
1192034208 X:67545764-67545786 CAGCAGCGGGAGAGCGAGGGAGG + Exonic
1192122773 X:68472828-68472850 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1192538767 X:71950440-71950462 AAGCAGAGTGAGCCTGAGGGTGG + Intergenic
1194752656 X:97702079-97702101 CAACACTGGGAGGCCGAGGCAGG - Intergenic
1195370337 X:104166751-104166773 CCAGAGAGGGAGCCCGAGCCAGG + Exonic
1196971416 X:121113044-121113066 CAGCACTTGGAGGCCGAGGCAGG - Intergenic
1197266819 X:124383191-124383213 CAGCATTGGGAGGCTGAGGCAGG - Intronic
1199020284 X:142870430-142870452 CAGCAGAGGGACCCTGGGCCAGG - Intergenic
1200157309 X:153984110-153984132 CAGCACTGGGAGGCCGAAGCGGG - Intergenic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1202303920 Y:23447605-23447627 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1202566890 Y:26222986-26223008 CAGCACTGGGAGGCTGAGGCGGG + Intergenic