ID: 1166097315

View in Genome Browser
Species Human (GRCh38)
Location 19:40549061-40549083
Sequence CTGAACAAGGAGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 1, 2: 7, 3: 38, 4: 396}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166097315 Original CRISPR CTGAACAAGGAGAGGGTGGA AGG Intronic
900582950 1:3418357-3418379 CTGCACCAGCAGAGGGTGGCCGG - Intronic
901232782 1:7650522-7650544 CTGGAAAAGGCGGGGGTGGAGGG - Intronic
901716454 1:11158768-11158790 ATGAACAAGCAGAGGGGAGAGGG + Intronic
901750033 1:11400402-11400424 CTGGACAGGGAGAGGTGGGACGG + Intergenic
902468471 1:16631955-16631977 CTGGACCTGGAGAGCGTGGATGG + Intergenic
902505665 1:16938033-16938055 CTGGACCTGGAGAGCGTGGATGG - Intronic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902782363 1:18712755-18712777 CCGAACAAGAGGTGGGTGGAGGG + Intronic
903764568 1:25725851-25725873 CTGAAGAATGAGAGGGTGCTCGG + Intronic
905271871 1:36792670-36792692 CTGCTGAAGGAGTGGGTGGACGG + Intergenic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906694393 1:47814431-47814453 CTGGACAAGGAGAGGTGAGAAGG + Intronic
908834643 1:68216738-68216760 ATGAACAAGTAGAGGGTTAATGG + Intronic
908992596 1:70111230-70111252 CTGAAGAAGAAAAGAGTGGATGG - Intronic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
910240926 1:85085412-85085434 CTGAACAGGGATATGGAGGAAGG + Intronic
911013585 1:93307804-93307826 GTGAACAAGGGGAGAGTGGTAGG - Intergenic
911658461 1:100473001-100473023 TTAAACAAGGAGAAAGTGGAAGG - Intronic
914878650 1:151530735-151530757 CTGAACAAGGAGGTGGGGCATGG + Exonic
914930087 1:151923142-151923164 ATGAACAAGGACAGCTTGGAGGG + Intergenic
915002654 1:152607696-152607718 CTGAGCCAGGAGAGGGTGCTGGG - Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
916217733 1:162411940-162411962 CTGCTCAAGGAAGGGGTGGATGG - Exonic
918990911 1:191696150-191696172 ATGAACAAGGATAGCTTGGAAGG - Intergenic
919545398 1:198911512-198911534 GTGAACAAGGAGACAGTGGCAGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920402005 1:205681786-205681808 CAGAGCCAGGAGAGAGTGGACGG + Intergenic
922974570 1:229773141-229773163 GTGATCAAGCAGAGGATGGAAGG - Intergenic
923300492 1:232635719-232635741 ATGAATAGGGAGTGGGTGGATGG + Intergenic
923437758 1:233984031-233984053 CTGAACAAGGCCAGAGAGGAGGG - Intronic
923956952 1:239032941-239032963 CTGAAAATGGGGTGGGTGGAAGG + Intergenic
1063578571 10:7284277-7284299 CTGGGCAAGGATGGGGTGGAGGG - Intronic
1063614393 10:7589669-7589691 CTGAACAAGCAGAGTGTCGGGGG - Intronic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1064543620 10:16429647-16429669 ATGAACAAAGAGAGGAAGGATGG + Intergenic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1065233899 10:23626806-23626828 CGCAACAGGGAGAGAGTGGATGG + Intergenic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065602143 10:27379907-27379929 CTGGACTACTAGAGGGTGGAGGG - Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065952734 10:30666759-30666781 CTAAAAAAGGAGGGTGTGGAGGG - Intergenic
1068835158 10:61545009-61545031 CTGATGAAGGAGAGGGTAAAAGG + Intergenic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1071193346 10:83127863-83127885 CTGAACAGGGAGAGAGGGAAAGG + Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072957135 10:99897249-99897271 ATGAAGAAGGAGTGGGTGGGTGG + Intronic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1073466580 10:103697799-103697821 CTGCACAGGGAGAGGCTGGTGGG + Intronic
1073677519 10:105665253-105665275 CTGACAAACGAGAGGGTGGAGGG + Intergenic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1080709026 11:34728139-34728161 GTGGACCATGAGAGGGTGGAGGG - Intergenic
1080941777 11:36926731-36926753 CTGAGCTAGGCCAGGGTGGACGG + Intergenic
1081042010 11:38224756-38224778 CTGAACATAGGAAGGGTGGAAGG - Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1083230387 11:61314049-61314071 CTGCACAAGGAGATGCTGGGTGG - Exonic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084032506 11:66489214-66489236 GGGGACAAGGAGAGGCTGGAGGG - Intronic
1084475660 11:69387199-69387221 CTGACCGAGCAGAGGGAGGAAGG - Intergenic
1084618234 11:70250875-70250897 CAGAACAAGGACAGGGTGCAAGG - Intergenic
1086426472 11:86688723-86688745 GTGAACAAGGAGAGGGAGAGAGG + Intergenic
1086858239 11:91892654-91892676 AGGAAAAAGGAGAGGGAGGAAGG - Intergenic
1088470233 11:110182242-110182264 CTGCACAATGAGTGGCTGGAAGG - Intronic
1089748488 11:120633713-120633735 CTGAGCAGGGAGAGGCTGGGAGG + Intronic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1091112882 11:132987060-132987082 GTGAAGAGGGAGAGCGTGGATGG - Intronic
1091240120 11:134046489-134046511 CTTAACAAGGAGAGGCTGGCAGG - Intergenic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1091968616 12:4766561-4766583 ATGACCAAGGACAGGGCGGAGGG + Intronic
1092143541 12:6200129-6200151 TTGAAGAAGGAGTGGGTGGCGGG + Intronic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1092703069 12:11254770-11254792 ATGAACATGAAGAGAGTGGATGG + Intergenic
1093456647 12:19371458-19371480 CTCAGAAGGGAGAGGGTGGAAGG - Intronic
1093499295 12:19793713-19793735 GTGAACAAGGAGAGGAGGTAGGG + Intergenic
1093598727 12:20995245-20995267 CTGAAAAGGGTGAGGTTGGAAGG - Intergenic
1094052607 12:26237784-26237806 CTGAACAAGGAGAGGTCAGTGGG + Intronic
1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG + Intronic
1098420716 12:70294209-70294231 GTGAAGAAGGAAAGGTTGGAGGG - Intronic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1099323155 12:81177208-81177230 CTGAACAGGGAAAAGCTGGATGG + Intronic
1099965050 12:89437196-89437218 GTGAAAAAGGAGGGGTTGGAGGG - Intronic
1100559977 12:95738521-95738543 GTGAACAAAGAGAGAGTGGCTGG + Intronic
1101575315 12:105991842-105991864 CTGAACAGGGAGTGGGAAGATGG - Intergenic
1103218330 12:119221421-119221443 ATGAAAAAGGAAAGGGTGAAAGG - Intergenic
1106181062 13:27369767-27369789 CTGAACAAGGAGGGGTTCTAAGG + Intergenic
1107826327 13:44332010-44332032 CTGACAAAGGAGGTGGTGGAGGG - Intergenic
1108968760 13:56344938-56344960 CTGAACTACTAGAGTGTGGAGGG + Intergenic
1110337451 13:74348119-74348141 CTGAACTTGGAGATGGTAGAAGG + Intergenic
1110702297 13:78562841-78562863 CTGAATAAATAGAGGATGGATGG + Intergenic
1112853647 13:103736737-103736759 CTGAAAAAGGAAACGGTGGAAGG - Intergenic
1112894874 13:104286513-104286535 CACAAAAAGGAGAGTGTGGAGGG - Intergenic
1112919486 13:104593965-104593987 CAGAACAAGGGGAGAGTGAAAGG - Intergenic
1113852247 13:113424454-113424476 CTCAAAAAGAAAAGGGTGGATGG - Intronic
1114669454 14:24401113-24401135 TTGAGCAAGGAGGGGGTGGCGGG - Intronic
1118602702 14:67481775-67481797 CTGAGCAAGGAGCTAGTGGAAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG + Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122398539 14:101452483-101452505 GTGAACCAGGAGCGTGTGGATGG - Intergenic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1124041546 15:26110198-26110220 AAGAAGGAGGAGAGGGTGGAGGG + Intergenic
1127221231 15:56883848-56883870 CTGAATTGGGAGAGGGTGAAAGG - Intronic
1127371762 15:58348135-58348157 CTGAATCTGGAGAGTGTGGAAGG - Intronic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1128798611 15:70482410-70482432 CTGAACAAGGAGGGAGGGCATGG + Intergenic
1128954122 15:71921463-71921485 CGGGAGAAGGAGTGGGTGGAAGG - Intronic
1129668635 15:77594114-77594136 GTGAATAAGTAGAGGCTGGACGG + Intergenic
1129669078 15:77597171-77597193 CTGAGCAGGGACAGGGTGGGGGG + Intergenic
1130051502 15:80487425-80487447 CTGATGCAGGAGAGGGTGCAGGG + Intronic
1131385942 15:92007501-92007523 CTGAATAGGGATAGTGTGGAAGG + Intronic
1131830742 15:96353087-96353109 CTGGACAGGGAGATGGTGGTTGG + Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132804870 16:1770828-1770850 CTGAACAGGGGGAGGCCGGACGG + Intronic
1133040088 16:3056103-3056125 GTGAACAGGGAGATGGGGGAGGG + Intronic
1134267055 16:12701569-12701591 GTGAACCAGAAGAGGCTGGAGGG + Intronic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135424440 16:22325349-22325371 CCGGACCTGGAGAGGGTGGAGGG + Intronic
1136609201 16:31356029-31356051 CTGAGCAGGGAGAGGATGGATGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1138351878 16:56350374-56350396 CTGCACAGGGAGTGGGAGGAAGG - Intronic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139459641 16:67111282-67111304 CTGGAAATGGAGAGGGTGAAGGG - Intronic
1139855499 16:69976534-69976556 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1139885217 16:70203652-70203674 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140509608 16:75497374-75497396 ATGAATAAGGAGAGGGGGCAAGG + Intergenic
1140981251 16:80111912-80111934 AGGAACAAGGAAAGGGGGGAGGG + Intergenic
1141045980 16:80716478-80716500 ATGAACAATGGGTGGGTGGATGG + Intronic
1142147809 16:88499827-88499849 CTGGACCCGGAGAGGCTGGATGG - Intronic
1142562132 17:816476-816498 CGGACCAAGCAGATGGTGGAGGG - Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1146307831 17:31744135-31744157 TGGAAAGAGGAGAGGGTGGAGGG + Intergenic
1146688486 17:34857138-34857160 CTCACCCAGGAGAAGGTGGATGG + Intergenic
1147464319 17:40599040-40599062 AGGAGGAAGGAGAGGGTGGAAGG - Intergenic
1147836071 17:43332725-43332747 CTGAACAGAGATAGGGTTGAGGG + Intergenic
1147836083 17:43332797-43332819 CTGAACAGGGATAGGGTTCAGGG + Intergenic
1147845957 17:43403982-43404004 CTAATCAAGGAGAGGGAAGAGGG - Intergenic
1148557865 17:48589368-48589390 CTGAACCAGGAGTGGGGGAAGGG - Intronic
1148587925 17:48794089-48794111 CTGCTCCAGGAGAGAGTGGATGG + Intronic
1149270841 17:54975753-54975775 GTGAACAGGGAGAGAGTGGTAGG - Intronic
1149646209 17:58243497-58243519 CTCAACAAGGAGAGTGTAGTGGG - Intronic
1150359216 17:64515881-64515903 CTGAAGAAGGAGGGGTTCGAAGG + Intronic
1150499963 17:65641382-65641404 CTGATCAAGGAGAGGCTGCAGGG - Intronic
1150901933 17:69288830-69288852 CTCAGAAAGGAAAGGGTGGAAGG + Intronic
1150965272 17:69960818-69960840 CTGATCAAGGAGGGAGTGTAAGG - Intergenic
1151021553 17:70623151-70623173 CTGAAGATAGAGAGGGTTGATGG - Intergenic
1152825758 17:82463715-82463737 GTCAGGAAGGAGAGGGTGGAGGG + Intronic
1152829423 17:82488047-82488069 CTGTACCAGGAGTGGCTGGAGGG + Exonic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1155280080 18:24230235-24230257 ACAAACAAGGAGAGGGAGGAGGG + Intronic
1156318528 18:35994976-35994998 CTTAACCAGGAGAGGGACGAGGG - Intronic
1156404987 18:36775041-36775063 CAGAACAAGGAGGGCGTGAATGG + Intronic
1157300768 18:46477506-46477528 CTGGACAAGAAGCGGGGGGATGG - Intronic
1157619333 18:49007061-49007083 CTGAGAGAGGAGTGGGTGGAAGG - Intergenic
1158626891 18:59079373-59079395 CTGAGCAAGCACAGGGTGGCTGG - Intergenic
1158968933 18:62648268-62648290 CTGAAAAAGGAGGCGTTGGAAGG - Intergenic
1159028873 18:63210877-63210899 CAGAACAATGAGATGGTGAATGG - Intronic
1159088978 18:63825017-63825039 CAGAAGGAAGAGAGGGTGGAGGG + Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1159995620 18:74961079-74961101 CTGAGCGAGGACTGGGTGGAGGG + Intronic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1161249115 19:3270921-3270943 CAGAACAAGGTGGGGGTGGAGGG + Intronic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1162300894 19:9844363-9844385 CTGAACAATGAGAGTCTGGCAGG - Intronic
1162732638 19:12728184-12728206 CTCAGCAAGTAGAGGGTGGAAGG - Intergenic
1163674486 19:18648625-18648647 CTGAGCAAGGAGAGGCATGAAGG - Intronic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1166042617 19:40212945-40212967 CTGCAGAAGGAGCGGGTGGGAGG + Exonic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166602115 19:44105667-44105689 CTCAAAATGGGGAGGGTGGAAGG - Intronic
1167645501 19:50703179-50703201 CTGAACAGGAAGAGGATGGGGGG - Intronic
1168133825 19:54337567-54337589 CTGTACAAGGAGGGGGCCGATGG - Exonic
1168477354 19:56686211-56686233 CTTAACAAGGGGAGCGTAGAAGG + Intergenic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
926118704 2:10229309-10229331 GTGAACAGGGGGAGGGTGGGGGG + Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926488104 2:13488644-13488666 CTGAACAGGGAAGGGGTGTAAGG - Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
927787597 2:25984231-25984253 TTAATCAAGGAGAGGGTGGAGGG - Intergenic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
927937584 2:27084316-27084338 ATGAACAGGGAGAAGATGGATGG - Intronic
929777484 2:44938105-44938127 CAAAACAAGGAGAGAGTGGGAGG + Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930491848 2:52083688-52083710 CTGAAGAAGGTGGGGGTGGGAGG - Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
932882574 2:75517734-75517756 CTGACCAAGGAGGGGGCTGATGG - Intronic
933377800 2:81502233-81502255 GTGAAGGAGGAGTGGGTGGAAGG + Intergenic
933665248 2:84959577-84959599 CTGAAGAAGGAGACAGTGTATGG - Intergenic
934702016 2:96449985-96450007 CTGAGCAAGGAGATAGTAGATGG - Intergenic
935018810 2:99211202-99211224 CTGTACATGGAATGGGTGGATGG + Intronic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
935904055 2:107824347-107824369 CTGAACAAAATGAGGCTGGAAGG - Intergenic
937098110 2:119248711-119248733 CTGAACAAGGAGGGGGTGGCAGG + Intronic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938562952 2:132490714-132490736 CTGAACAGGGTGAGGGAGGTAGG + Intronic
938920178 2:135987671-135987693 CTGGAACATGAGAGGGTGGAAGG + Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943645047 2:190401084-190401106 AGGAACAAGGGGAGGGTGGAGGG + Intergenic
944748258 2:202680269-202680291 CTGACAAGGGAGAGGGGGGAGGG + Intronic
945574280 2:211510307-211510329 CTAAAAGAGGAGAGGGTGGGAGG + Intronic
946748885 2:222872757-222872779 CTGATCTAGGAGAAGGGGGATGG + Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
947818534 2:233054533-233054555 CAGAACAGGGAAGGGGTGGAGGG + Intergenic
947997888 2:234544193-234544215 ATGACCTTGGAGAGGGTGGAAGG + Intergenic
948076092 2:235166332-235166354 CTGTCCAGGGAGAGGGTGCAGGG - Intergenic
948522854 2:238551856-238551878 TTGGACAAAGAAAGGGTGGATGG + Intergenic
948530108 2:238598734-238598756 CTGAGCCAGGACAGGGTAGAAGG - Intergenic
948673792 2:239585149-239585171 CTGACCAAGGAAGGGCTGGAGGG - Exonic
948695721 2:239732192-239732214 TGGAGGAAGGAGAGGGTGGAGGG - Intergenic
948741972 2:240054118-240054140 CTGAACAAGGACAGGGTGGATGG - Intergenic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
1169154238 20:3315890-3315912 CTGGACATGGACATGGTGGAAGG - Intronic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1171371499 20:24665281-24665303 CGGAACAAGCAGTGAGTGGAGGG - Intronic
1173615422 20:44400328-44400350 CGAAACAGGGAGAGGGAGGAGGG + Intronic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174582337 20:51580722-51580744 CTGAACAAGGAGTTGGTTCAGGG + Intergenic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177549438 21:22601000-22601022 ATGAACAAGGACAGCTTGGAAGG - Intergenic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1179396998 21:41049704-41049726 CTCAGAAAGGAGAGGGTGGGAGG - Intergenic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180223648 21:46376082-46376104 CTGCAGACGGAGAGGGTAGAGGG - Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182015210 22:27033364-27033386 CTGAAATAGAAGAGGATGGATGG + Intergenic
1182021646 22:27086650-27086672 CTGCACAAGGAGATCGGGGACGG + Intergenic
1182447162 22:30396717-30396739 CTGAACAAGGAGGGATTGAAAGG - Intronic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1183002417 22:34872424-34872446 GTGTTCAAGGAGAGGCTGGATGG - Intergenic
1183680350 22:39325017-39325039 CTGGATTAGGAGAGGATGGAAGG + Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184744555 22:46448685-46448707 GAGAACAAGGAGTGAGTGGAAGG + Intronic
1184959351 22:47917854-47917876 GGGAAGAAGGAGAGGGAGGAGGG - Intergenic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
949493158 3:4608492-4608514 CTCAAGAAGGATAGGGAGGAAGG + Intronic
950651379 3:14409477-14409499 CTCAGCTAGGAAAGGGTGGAAGG + Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
952901076 3:38112089-38112111 CTGACCAAGGAGAGGCTGGAGGG + Intronic
953029149 3:39166135-39166157 CTGAAGAAAAAAAGGGTGGAAGG + Intergenic
953058146 3:39404791-39404813 GTGAACACTCAGAGGGTGGAGGG + Intergenic
953626923 3:44579350-44579372 CTGAATCAGGAGCGGGTGGGCGG - Intronic
953878324 3:46678944-46678966 CTGAACTAGGAGGGTATGGAGGG + Intronic
954318179 3:49812596-49812618 CTGACCAAGGAGAGGCTGCCAGG - Intronic
954759112 3:52861242-52861264 CTGAACAGAGAGAGGGGAGAAGG + Intronic
954912745 3:54122542-54122564 CAGAAAAAGGAGCGGGTGGGGGG - Intronic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
956368195 3:68529235-68529257 GTGAAGAAGGGCAGGGTGGAGGG - Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
958549961 3:95599635-95599657 TTTTACACGGAGAGGGTGGAGGG - Intergenic
962114494 3:132488308-132488330 CTCAACAAGGATAGGGTCAAAGG - Exonic
962503045 3:136014919-136014941 CTGAACAAGGAAAAGTTGAAAGG - Intronic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963837413 3:150071054-150071076 CTGGACAAGGGGAGAGTGGCAGG + Intergenic
964689803 3:159437587-159437609 CGGAGGAAGGAGACGGTGGAGGG + Intronic
965695273 3:171401494-171401516 CTGAGGAAGGAGAGGGTTCAGGG + Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
967540775 3:190665139-190665161 CTGGAGAAGGATAGGGCGGATGG + Intergenic
967951845 3:194847397-194847419 CTGTACCAGGAGAGAGTGGCTGG + Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
969582548 4:8073529-8073551 CTGAGCAAGGGGAGGGGTGAGGG + Intronic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
970511338 4:16784748-16784770 CGGAAGAAGGAGAGAGTGGTGGG - Intronic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
975561782 4:75715423-75715445 ATGGACAAAGAGAGGGTAGAAGG - Intronic
976114529 4:81712758-81712780 TTGGACAAGGAAAGAGTGGAAGG + Intronic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
977428797 4:96904561-96904583 CTAAACATGGAGAGGGAGGGAGG + Intergenic
977804925 4:101286017-101286039 ATGTACAAGGCGGGGGTGGATGG + Intronic
978091844 4:104726741-104726763 TTGAGCAGAGAGAGGGTGGATGG + Intergenic
981419766 4:144535878-144535900 CTCAGGAAGGAGAGGCTGGATGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984327405 4:178271543-178271565 CTGAAAGGGGAGAGGGTGCAGGG - Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985223417 4:187732342-187732364 TTGAACAACGTGAGGGTGAAGGG - Intergenic
985647895 5:1093707-1093729 CTGAACACGGGGAGGGAGGTCGG - Intronic
986003443 5:3648417-3648439 CTGACCAAGGAGTGGGAAGAAGG + Intergenic
986026729 5:3858202-3858224 GTGAATAAGGAGGGGGTGAAAGG + Intergenic
986395325 5:7323511-7323533 ATCAAGTAGGAGAGGGTGGAGGG - Intergenic
986597373 5:9437751-9437773 CTTACCAAGGAGAGAGAGGATGG + Exonic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
991629684 5:68644092-68644114 CTGACCAAGAAGAGTGTGTATGG - Intergenic
992380001 5:76227463-76227485 AGGCACAAGGAGAGGGTGGTAGG - Intronic
992807485 5:80351817-80351839 CGGAACAAGGAGACGCTGGAGGG - Intergenic
993903353 5:93598696-93598718 CTGTACGAGGAGGGGGTGGTGGG + Intergenic
994406190 5:99348121-99348143 AGGAAAAATGAGAGGGTGGATGG + Intergenic
995994172 5:118279696-118279718 ATGAAAAAGGAGAGGGTGAAAGG - Intergenic
997593798 5:135092695-135092717 GTGAGGAAGGAGAGGGTGTATGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997738939 5:136236756-136236778 ATCAACAAGGAGAGGGTTCAGGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998384715 5:141750138-141750160 GGGAACAGGGAGATGGTGGAGGG + Intergenic
998397454 5:141827867-141827889 CTCAACAAGAGGAGGGTGGCTGG - Intergenic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
1000145401 5:158448785-158448807 ATGAACAAGGAGAGGGTGGTTGG - Intergenic
1001925046 5:175630124-175630146 CTGAACAGGAACAGGCTGGAGGG - Intergenic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1002663673 5:180807615-180807637 CTGATTAAAGAGGGGGTGGAAGG - Intronic
1003335584 6:5168899-5168921 GTGATAAAGGAGAGGGAGGAGGG + Intronic
1003910158 6:10736109-10736131 ATGAACAAGGACAGCTTGGACGG - Intergenic
1006425119 6:33958892-33958914 GGGAAAAAGGAAAGGGTGGAGGG - Intergenic
1006483351 6:34316925-34316947 CTGAAGAAGGCAAGGGTGCAGGG + Intronic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1007373524 6:41442096-41442118 CTGGACTATGAGAGGGAGGAGGG - Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1008660077 6:53658564-53658586 TAGACCGAGGAGAGGGTGGAAGG + Intronic
1009457131 6:63870933-63870955 CTGAACAACGATTGGGTAGAAGG - Intronic
1009531155 6:64817605-64817627 GTGGACTAGAAGAGGGTGGAGGG - Intronic
1010569831 6:77463449-77463471 CGGACGAAGGAGAGGGCGGAAGG + Exonic
1011215056 6:84996729-84996751 CTGAGCCAGGAGAGTGTGGTAGG + Intergenic
1011712537 6:90069228-90069250 CTGAACACTGAGTGGATGGATGG + Intronic
1011969964 6:93210804-93210826 CTGAACAAAGGGAGGTTGCATGG - Intergenic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013242714 6:108260953-108260975 CTGAACGCGGAGGGGGCGGAGGG - Exonic
1013330248 6:109094255-109094277 GTGTACAAGGAGAGGGTGAGAGG - Exonic
1013521509 6:110937954-110937976 ATGAACAAGAAGAGACTGGAAGG + Intergenic
1013979090 6:116108841-116108863 ATGAAGAAAGAGAGGGTGGTGGG - Intronic
1014018872 6:116565527-116565549 CTGCACTAGCAGAGGGTGGGAGG + Intergenic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1017155990 6:151323134-151323156 ATGATCAAGGACAGGGTGCACGG - Intronic
1017488493 6:154923866-154923888 CTGAACAAAGGGAGGGGGAAGGG - Intronic
1020361223 7:7328821-7328843 CTGAAGTAGGAGTTGGTGGAAGG - Intergenic
1023985099 7:45089384-45089406 CTGACCAAGCAGAGGGTGCAGGG + Intergenic
1024369428 7:48563346-48563368 CTGAAGAAAGAGAGGGTTAAAGG + Intronic
1024770071 7:52712353-52712375 ATTAAGAAGGAGAGGATGGAGGG + Intergenic
1025058564 7:55784966-55784988 CTGAACAGGGAGGTGGTTGAGGG - Intergenic
1025194925 7:56925278-56925300 CAGGACCAGAAGAGGGTGGAGGG - Intergenic
1025677027 7:63651665-63651687 CAGGACCAGAAGAGGGTGGAGGG + Intergenic
1025827813 7:65024835-65024857 CTGAACAGGGAGGTGGTTGAGGG + Intergenic
1026006062 7:66601246-66601268 CTGAACAGGGAGATGGTTGAGGG - Intergenic
1026378731 7:69777818-69777840 CTGAACAATGTGAGGTGGGAGGG + Intronic
1028016349 7:85719008-85719030 TTAGCCAAGGAGAGGGTGGAAGG + Intergenic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1032384039 7:131509213-131509235 CTAACCAGGGAGAGGGAGGAGGG + Intronic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1033455437 7:141498984-141499006 CTTAAAAAGCAGAGGGTGGTTGG + Intergenic
1034537315 7:151733650-151733672 CTGAGCAGGGAGAGGAGGGATGG - Intronic
1035655240 8:1300513-1300535 CTGAACAGGGACAGGAGGGACGG - Intergenic
1035892123 8:3356848-3356870 CTGATCCAGGACAGCGTGGAGGG + Intronic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1036278912 8:7381732-7381754 GTGAACTACTAGAGGGTGGAGGG + Intronic
1036342608 8:7930134-7930156 GTGAACTACTAGAGGGTGGAGGG - Intronic
1036450831 8:8865922-8865944 CTGAACAAGGAGAGGTGTGGAGG - Intronic
1036453792 8:8891752-8891774 CTCACCGAGGAGAGAGTGGAGGG - Exonic
1036824889 8:11968309-11968331 GTGTACACGGAGAGGGTGTAAGG + Intergenic
1037915555 8:22770708-22770730 CTGATCAAGGAGAGGTGGGATGG - Intronic
1038938190 8:32275624-32275646 GTGAGCAAGGAGAGAGTAGAGGG + Intronic
1040730475 8:50441094-50441116 CTGGACAAGGACAGTGTGGTGGG + Intronic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1041465158 8:58151025-58151047 GTGACCAAGGAGAGGGAGCAAGG + Intronic
1044031479 8:87242936-87242958 CTGAAAAAGGACAGGGTGGAGGG + Intronic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044806706 8:96015980-96016002 GTGAACAAGGAAAGAGTGGGTGG - Intergenic
1045328287 8:101133598-101133620 CTGCATAAGGAGGGGGTCGAAGG + Intergenic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1048994041 8:139778817-139778839 CTGAAGGAGAAGAGAGTGGAGGG + Intronic
1049212644 8:141393747-141393769 CAGAACATGGTGAGGGTGGCTGG + Intronic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1052469021 9:28869428-28869450 ATGAACAAGGAGTGGGGGGAGGG + Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1054824000 9:69552853-69552875 ATGAGCAAGGTGAGGGTAGAAGG - Intronic
1056262365 9:84861922-84861944 ATGAACAAGCATAGGGTGGATGG - Intronic
1056560402 9:87724753-87724775 CTGAGCTAGGAGAGGGGGAATGG + Intergenic
1057397254 9:94691197-94691219 GTAAACAAGGATAGGGTGGAAGG - Intergenic
1060408885 9:123386879-123386901 GGGAACAGGGAGAGGGTGCAGGG + Intronic
1060839410 9:126782020-126782042 CTGAGCAGGGAGAGAGAGGAGGG + Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061654667 9:132079705-132079727 CGGAACAAGGAGACGCTGGAGGG - Exonic
1061803749 9:133127098-133127120 CTGGCCAAGGAATGGGTGGAAGG - Intronic
1062325540 9:136010835-136010857 CAGAACAAGGACAGGGTGTGGGG + Exonic
1062725309 9:138070012-138070034 CTGCCCAAGGAGAGGGAGGTGGG + Intronic
1185463789 X:343900-343922 CTCACCAAGGAGAGGCGGGAGGG + Intronic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187381665 X:18807478-18807500 AAGAGCAAGAAGAGGGTGGAAGG - Intronic
1187522071 X:20022534-20022556 CTGAGGAAGGAGAGGAGGGACGG + Intronic
1188023945 X:25188766-25188788 TTTAACAATGAGAGTGTGGAGGG + Intergenic
1190132901 X:47767865-47767887 GTGAACCACTAGAGGGTGGAGGG - Intergenic
1190657440 X:52624525-52624547 CTGATCAGGCAGAGGGTTGAGGG - Intergenic
1192088401 X:68125789-68125811 CTGAAAAAATAGAGGGGGGAGGG + Intronic
1192590683 X:72357045-72357067 TTGAACCAGGAGAGGGTGGAAGG + Intronic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1192858238 X:75037166-75037188 ATCAACAAGGAGAGGGTTGCTGG - Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195903697 X:109824112-109824134 CAGAGCAAGGAGAGGGTCCAGGG - Intergenic
1196318588 X:114260742-114260764 CAGAAGATGGAGAGAGTGGATGG - Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1198054973 X:132984927-132984949 GTGAGCAAGGAGAGGGAGCAAGG - Intergenic
1198384096 X:136111805-136111827 CTGGACAAGGATAGTGTGGCTGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201902432 Y:19057336-19057358 CAGAACAAGGTGTGGGTGGCAGG + Intergenic