ID: 1166097385

View in Genome Browser
Species Human (GRCh38)
Location 19:40549383-40549405
Sequence CGTCCAGGTCGTGCGCCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166097385_1166097403 24 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097403 19:40549430-40549452 GGCCTGGGGCGGGGCGGGGCGGG 0: 2
1: 17
2: 142
3: 896
4: 3582
1166097385_1166097404 25 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097404 19:40549431-40549453 GCCTGGGGCGGGGCGGGGCGGGG 0: 2
1: 23
2: 138
3: 830
4: 3362
1166097385_1166097398 15 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097398 19:40549421-40549443 CAGCGCAGGGGCCTGGGGCGGGG 0: 1
1: 0
2: 7
3: 78
4: 837
1166097385_1166097402 23 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097402 19:40549429-40549451 GGGCCTGGGGCGGGGCGGGGCGG 0: 1
1: 8
2: 129
3: 760
4: 4449
1166097385_1166097390 2 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097390 19:40549408-40549430 GAGCTGGTGAGGCCAGCGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 259
1166097385_1166097392 8 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097392 19:40549414-40549436 GTGAGGCCAGCGCAGGGGCCTGG 0: 1
1: 0
2: 1
3: 73
4: 596
1166097385_1166097394 10 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097394 19:40549416-40549438 GAGGCCAGCGCAGGGGCCTGGGG 0: 1
1: 0
2: 7
3: 69
4: 601
1166097385_1166097399 18 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097399 19:40549424-40549446 CGCAGGGGCCTGGGGCGGGGCGG 0: 1
1: 0
2: 6
3: 132
4: 1512
1166097385_1166097393 9 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097393 19:40549415-40549437 TGAGGCCAGCGCAGGGGCCTGGG 0: 1
1: 0
2: 2
3: 40
4: 427
1166097385_1166097391 3 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097391 19:40549409-40549431 AGCTGGTGAGGCCAGCGCAGGGG 0: 1
1: 0
2: 1
3: 29
4: 320
1166097385_1166097397 14 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097397 19:40549420-40549442 CCAGCGCAGGGGCCTGGGGCGGG 0: 1
1: 0
2: 12
3: 103
4: 863
1166097385_1166097400 19 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097400 19:40549425-40549447 GCAGGGGCCTGGGGCGGGGCGGG 0: 1
1: 2
2: 41
3: 475
4: 2533
1166097385_1166097395 13 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097395 19:40549419-40549441 GCCAGCGCAGGGGCCTGGGGCGG 0: 1
1: 0
2: 4
3: 95
4: 750
1166097385_1166097406 28 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097406 19:40549434-40549456 TGGGGCGGGGCGGGGCGGGGCGG 0: 20
1: 201
2: 376
3: 1548
4: 8203
1166097385_1166097401 20 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097401 19:40549426-40549448 CAGGGGCCTGGGGCGGGGCGGGG 0: 1
1: 2
2: 27
3: 285
4: 2400
1166097385_1166097387 -9 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097387 19:40549397-40549419 ACCTGGACGACGAGCTGGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 78
1166097385_1166097389 1 Left 1166097385 19:40549383-40549405 CCAGGTGGCGCACGACCTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1166097389 19:40549407-40549429 CGAGCTGGTGAGGCCAGCGCAGG 0: 1
1: 0
2: 2
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166097385 Original CRISPR CGTCCAGGTCGTGCGCCACC TGG (reversed) Exonic
906139765 1:43527111-43527133 TGTCCAGGTCCTGGGCCAACTGG - Intronic
912763360 1:112387699-112387721 CTCCCAGGTAGTGAGCCACCAGG - Intergenic
915328068 1:155091617-155091639 AGCCCAGGTGCTGCGCCACCTGG - Intergenic
1077373035 11:2192557-2192579 GGTCCATGTCGTGAGCTACCAGG + Intergenic
1083171155 11:60924702-60924724 CGTCCAGGGCGAGGGCCACCAGG - Exonic
1084323575 11:68386656-68386678 CGTCCAGGTCCTCCGACACCAGG - Exonic
1091569154 12:1669440-1669462 CTTCCAGGTCGTGGGGCCCCAGG - Intergenic
1091755641 12:3049670-3049692 CGTCCTGGTCCTGCTCCACAGGG + Intergenic
1096627539 12:52904711-52904733 CATCCAGGCCGTGCGCACCCAGG - Exonic
1103800223 12:123533248-123533270 CGTCCAGCTCGGGCGCGACGTGG + Exonic
1123676536 15:22714950-22714972 CGTCCAGGTGGGCCGCGACCCGG - Intergenic
1124328754 15:28789210-28789232 CGTCCAGGTGGGCCGCGACCCGG - Intergenic
1124962676 15:34410166-34410188 CTTCCTGGTCGTGGGCCTCCAGG - Intronic
1124979301 15:34556388-34556410 CTTCCTGGTCGTGGGCCTCCAGG - Intronic
1125841128 15:42802142-42802164 CATCCAGGCCGTGCGCACCCAGG - Intronic
1132731120 16:1362492-1362514 CGGCCAGGTCCTGCTCTACCTGG - Exonic
1133046290 16:3090062-3090084 GGTCCTGGGCGTGCGCCAGCAGG + Exonic
1134024166 16:10941972-10941994 CGTCCAGGTGGGCCGCGACCCGG + Exonic
1135693326 16:24563633-24563655 CGTCCAGGTGGTGGTCGACCAGG + Exonic
1141069017 16:80936516-80936538 CTTCCTGGTGGTGAGCCACCTGG - Intergenic
1144952947 17:19003909-19003931 CGTCCCGGCCGCGGGCCACCAGG + Exonic
1147450443 17:40500811-40500833 GGTCCACGTCCTGCGTCACCGGG - Intronic
1150085775 17:62272678-62272700 CGCCCAGGTCCTGCCCCTCCTGG - Intronic
1151551259 17:74823779-74823801 CCTCCAGTAGGTGCGCCACCTGG - Intronic
1152403748 17:80084835-80084857 CGTCCTGGTCCAGCTCCACCAGG - Exonic
1152659727 17:81536665-81536687 CGTCCAGGCCGCGCAGCACCAGG - Exonic
1161210488 19:3062776-3062798 CGTCCAGGTCGTGCCACAGCAGG - Exonic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1166097385 19:40549383-40549405 CGTCCAGGTCGTGCGCCACCTGG - Exonic
932411659 2:71551247-71551269 CTGCCAGGTCGTGGGCCCCCAGG - Intronic
1168748717 20:267054-267076 CGTCCTGGTCGTGAGTCGCCAGG - Intergenic
1179942878 21:44650982-44651004 GGTCCAGGTGGCGCCCCACCAGG + Intronic
955228469 3:57079386-57079408 CGTCCAAGTCCTGCGTCGCCCGG - Intergenic
968221386 3:196942649-196942671 CGTCCGGGTCGGGCGCCGCGGGG + Intergenic
988972338 5:36482001-36482023 AGTCCAGGAAGTGCCCCACCAGG + Intergenic
994320905 5:98393256-98393278 CATCCAGGCCGTGCGCACCCAGG - Intergenic
1002259505 5:177983953-177983975 GGTCCAGGGCATGTGCCACCCGG + Intergenic
1017653214 6:156601806-156601828 TCTCCAGGTCCTGCGCCAACTGG + Intergenic
1032430164 7:131854557-131854579 CATCCAGGTCTTGCTCAACCAGG + Intergenic
1032953028 7:136938459-136938481 CATCCAGGCCGTGCGCATCCAGG - Intronic
1061141938 9:128772355-128772377 CATCTAGGGCATGCGCCACCAGG + Intronic
1186020685 X:5251597-5251619 AGTCCAGGTTGTGCCCCATCAGG + Intergenic
1199927153 X:152479825-152479847 CATCCAGGCCGTGCGCACCCAGG + Intergenic