ID: 1166100292

View in Genome Browser
Species Human (GRCh38)
Location 19:40567756-40567778
Sequence GCGGCGCCCCTGCTGCGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 276}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166100285_1166100292 -1 Left 1166100285 19:40567734-40567756 CCCCACGGAACTGGCGGCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1166100292 19:40567756-40567778 GCGGCGCCCCTGCTGCGGCCAGG 0: 1
1: 0
2: 2
3: 30
4: 276
1166100278_1166100292 28 Left 1166100278 19:40567705-40567727 CCACTGCTGGGGCGCAAGTTCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1166100292 19:40567756-40567778 GCGGCGCCCCTGCTGCGGCCAGG 0: 1
1: 0
2: 2
3: 30
4: 276
1166100288_1166100292 -3 Left 1166100288 19:40567736-40567758 CCACGGAACTGGCGGCCAAGGCG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1166100292 19:40567756-40567778 GCGGCGCCCCTGCTGCGGCCAGG 0: 1
1: 0
2: 2
3: 30
4: 276
1166100287_1166100292 -2 Left 1166100287 19:40567735-40567757 CCCACGGAACTGGCGGCCAAGGC 0: 1
1: 0
2: 0
3: 7
4: 37
Right 1166100292 19:40567756-40567778 GCGGCGCCCCTGCTGCGGCCAGG 0: 1
1: 0
2: 2
3: 30
4: 276
1166100276_1166100292 30 Left 1166100276 19:40567703-40567725 CCCCACTGCTGGGGCGCAAGTTC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1166100292 19:40567756-40567778 GCGGCGCCCCTGCTGCGGCCAGG 0: 1
1: 0
2: 2
3: 30
4: 276
1166100277_1166100292 29 Left 1166100277 19:40567704-40567726 CCCACTGCTGGGGCGCAAGTTCT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1166100292 19:40567756-40567778 GCGGCGCCCCTGCTGCGGCCAGG 0: 1
1: 0
2: 2
3: 30
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166100292 Original CRISPR GCGGCGCCCCTGCTGCGGCC AGG Exonic