ID: 1166102247

View in Genome Browser
Species Human (GRCh38)
Location 19:40577550-40577572
Sequence CCCTGTCGATGAAGATCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166102247_1166102257 28 Left 1166102247 19:40577550-40577572 CCCGCAGATCTTCATCGACAGGG 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1166102257 19:40577601-40577623 CTTCCTGCGCACCAAAGAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166102247 Original CRISPR CCCTGTCGATGAAGATCTGC GGG (reversed) Exonic