ID: 1166102257

View in Genome Browser
Species Human (GRCh38)
Location 19:40577601-40577623
Sequence CTTCCTGCGCACCAAAGAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166102249_1166102257 27 Left 1166102249 19:40577551-40577573 CCGCAGATCTTCATCGACAGGGA 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1166102257 19:40577601-40577623 CTTCCTGCGCACCAAAGAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 84
1166102251_1166102257 3 Left 1166102251 19:40577575-40577597 CCTACAGTCTTCGCCCCCATCCT 0: 1
1: 0
2: 0
3: 16
4: 182
Right 1166102257 19:40577601-40577623 CTTCCTGCGCACCAAAGAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 84
1166102247_1166102257 28 Left 1166102247 19:40577550-40577572 CCCGCAGATCTTCATCGACAGGG 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1166102257 19:40577601-40577623 CTTCCTGCGCACCAAAGAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 84
1166102252_1166102257 -10 Left 1166102252 19:40577588-40577610 CCCCCATCCTCAACTTCCTGCGC 0: 1
1: 0
2: 1
3: 42
4: 815
Right 1166102257 19:40577601-40577623 CTTCCTGCGCACCAAAGAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 84
1166102250_1166102257 4 Left 1166102250 19:40577574-40577596 CCCTACAGTCTTCGCCCCCATCC 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1166102257 19:40577601-40577623 CTTCCTGCGCACCAAAGAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166102257 Original CRISPR CTTCCTGCGCACCAAAGAGT TGG Exonic