ID: 1166107666

View in Genome Browser
Species Human (GRCh38)
Location 19:40605378-40605400
Sequence GGGAGGCACGGCCGGGCAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166107666_1166107680 26 Left 1166107666 19:40605378-40605400 CCGTTTGCCCGGCCGTGCCTCCC 0: 1
1: 0
2: 4
3: 15
4: 226
Right 1166107680 19:40605427-40605449 CCACGTGGAGCACCCGCAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 105
1166107666_1166107673 -4 Left 1166107666 19:40605378-40605400 CCGTTTGCCCGGCCGTGCCTCCC 0: 1
1: 0
2: 4
3: 15
4: 226
Right 1166107673 19:40605397-40605419 TCCCCTAGGCGTGGCATCTATGG 0: 1
1: 0
2: 0
3: 6
4: 47
1166107666_1166107678 23 Left 1166107666 19:40605378-40605400 CCGTTTGCCCGGCCGTGCCTCCC 0: 1
1: 0
2: 4
3: 15
4: 226
Right 1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1166107666_1166107677 11 Left 1166107666 19:40605378-40605400 CCGTTTGCCCGGCCGTGCCTCCC 0: 1
1: 0
2: 4
3: 15
4: 226
Right 1166107677 19:40605412-40605434 ATCTATGGTGAGCGTCCACGTGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166107666 Original CRISPR GGGAGGCACGGCCGGGCAAA CGG (reversed) Intronic
901083607 1:6597460-6597482 GGGAGGGAGAGCCGGGCAAAGGG + Intronic
901470960 1:9456163-9456185 GAGATGCACAGGCGGGCAAAGGG + Intergenic
902110842 1:14076954-14076976 GGGATGCACGGCTGGCCAAGTGG + Intergenic
902940678 1:19798717-19798739 GGGAGGGAGGGCTGGGCACAGGG - Intronic
903884338 1:26532130-26532152 GGGAGGCAGGGCCTGGCCCAGGG + Intronic
904995118 1:34625730-34625752 GCAAGGCAGGGCAGGGCAAACGG - Intergenic
905452335 1:38064732-38064754 GGGAAGCAGGGTTGGGCAAATGG - Intergenic
907053439 1:51344881-51344903 GAGAGGCACAGCTGGGGAAAGGG - Intronic
907246862 1:53114295-53114317 GGGTGGCACCACAGGGCAAAGGG + Intronic
909107401 1:71429968-71429990 GAGAGGCAGGGGCTGGCAAAAGG - Intronic
909340675 1:74527900-74527922 GGGTGGCACTGCCTGGCAGAGGG + Intronic
910138740 1:84001839-84001861 GGGAGGCACTGCAGGGTCAAGGG + Intergenic
913454675 1:119019061-119019083 AGGAGGCATGGCGGGCCAAAAGG - Intergenic
915249434 1:154577843-154577865 GGGAGGCAGGGCCAGGGCAAGGG - Exonic
915586200 1:156845267-156845289 GGGCGGCACCGCCGGGCAGCTGG - Exonic
916384216 1:164249517-164249539 AGGGGGCATGGCCGGCCAAAAGG - Intergenic
918187675 1:182142577-182142599 GAGAGGCAGGGTCAGGCAAAGGG - Intergenic
918637366 1:186794187-186794209 GAGAGGCATGGACGGGGAAAGGG - Intergenic
919008421 1:191929044-191929066 GGGAGCAACGGCCTGGCACAGGG - Intergenic
920013362 1:202886343-202886365 GGAAGGCAGGGCAGGGCAGAAGG + Intronic
920612330 1:207454193-207454215 GGGAGGGACGGCCCGGCACGAGG - Intergenic
1062930320 10:1348514-1348536 GGGAGGCACCTCCCGGCCAAGGG - Intronic
1064147023 10:12833673-12833695 GGAAGGCAAGTGCGGGCAAAGGG + Exonic
1065304391 10:24354817-24354839 GGGAGGCATGGCAGACCAAAAGG + Intronic
1066287549 10:33982711-33982733 TGGGGGCACGGCAGGCCAAAAGG + Intergenic
1067536311 10:47112873-47112895 GGGAGCCAGGGCCGGACACAGGG - Intergenic
1067821243 10:49532592-49532614 GGGAGGCACGGCTGGCCTCATGG + Exonic
1070149251 10:73795716-73795738 GGGAGGCAGAGGCGGGCAGATGG + Intronic
1070532023 10:77345361-77345383 GGGAGGCACCACCTGGCAAAGGG - Intronic
1072083563 10:92056925-92056947 GGGAGGTAGGGCCTGGAAAAGGG - Intronic
1072303322 10:94083554-94083576 GGGCTGCACAGCAGGGCAAATGG - Intronic
1074366171 10:112859189-112859211 TGGAGGCAGGGCAGGGCAAAGGG - Intergenic
1074419065 10:113293296-113293318 GGGAAGCAGGACCGGGCAGAGGG - Intergenic
1075106617 10:119543424-119543446 GCGCGGCACGGCCGGGGAGAGGG - Intergenic
1075279019 10:121122770-121122792 GGGAGGCACTTCTGGCCAAAAGG + Intergenic
1076862999 10:133150813-133150835 GGGAGGCACGGCCGGAGAGGAGG - Intergenic
1077095063 11:795739-795761 GGGAGGAAGGGGCGGGCAAGGGG - Intronic
1077372074 11:2187049-2187071 AGGAGGCACGGCCGGGCGAAGGG + Intergenic
1077712934 11:4554138-4554160 GGGGGGCATGGCAGGCCAAAAGG - Intergenic
1077730909 11:4728545-4728567 GGGAGGCCTGACTGGGCAAAAGG - Intronic
1078479329 11:11662397-11662419 AGGAGGCAAGGCTGAGCAAAGGG - Intergenic
1079674202 11:23203682-23203704 GCCAGGCACGGAGGGGCAAAAGG - Intergenic
1081659899 11:44881701-44881723 GGGAGGCACTGCCTGCCCAAGGG + Intronic
1083332749 11:61906508-61906530 GGGACACACGGCGGGGCAGAGGG + Exonic
1083430694 11:62612510-62612532 GGGGGCCACGGCCGGGGAGAGGG + Exonic
1084740012 11:71133435-71133457 GGGAGGGACGGACGGACAGACGG + Intronic
1086572979 11:88306416-88306438 GGGGGGCATGGCGGGCCAAAAGG - Intronic
1089316016 11:117591943-117591965 GGGAGGCAGGGCTGGGAAAAGGG + Intronic
1089559121 11:119334784-119334806 GCGAACCACGGCCGGGCAACGGG - Exonic
1090939020 11:131371688-131371710 GGGAGGCACGGTGCAGCAAATGG - Intronic
1091599544 12:1909537-1909559 GGCAGGCAGGGCCTGGAAAAGGG - Intronic
1092230318 12:6772487-6772509 TGGAGGGAAGGCCGGGCACAGGG + Intergenic
1093612739 12:21182528-21182550 GGGAGGGACTGGCGGGCAGAAGG - Intronic
1094117928 12:26938043-26938065 GGGAGGCTTGGCCGGGCTATCGG - Exonic
1097264799 12:57738655-57738677 GGGAGGCAGGGGCGGGGAATTGG + Intronic
1103563743 12:121805229-121805251 GGGAGGGACGGCGGGGCAGTGGG - Intronic
1103831378 12:123782313-123782335 GGGAGGCAGGGCAGGGCAAAAGG - Intronic
1104325596 12:127793475-127793497 GGGAGGCACGGGCAGGAGAATGG + Intergenic
1104363443 12:128155071-128155093 GGGAGGCACAGCCCTGGAAAAGG - Intergenic
1104729410 12:131096856-131096878 GGGAGGCAGAGCCGGGCAGCAGG - Intronic
1106800827 13:33254587-33254609 GGGGGGCATGGCAGGCCAAAAGG - Intronic
1109364598 13:61339167-61339189 GAGAGGCACGGGCCGGGAAACGG + Intergenic
1113724422 13:112587789-112587811 AGGATGCAGGGCCGGGCAGAGGG - Intronic
1114183087 14:20381636-20381658 GGGAGGCACAGCCGGGCACCAGG + Exonic
1119328637 14:73777489-73777511 GGCAGGCAGGGCCGGGCCATGGG - Intronic
1119680755 14:76590708-76590730 GGGAGGCAGGGCAAGACAAAAGG + Intergenic
1121126048 14:91407323-91407345 GGGAGTCACGGCTGGCCAGACGG + Intronic
1121302716 14:92884866-92884888 GGGAGGCCGAGGCGGGCAAATGG + Intergenic
1121605778 14:95238669-95238691 GGGAGGCACAGACGGGCATCAGG + Intronic
1122030520 14:98908336-98908358 GGGAGGGACGGTGGGGCAGATGG - Intergenic
1122044407 14:99012875-99012897 GGGAGGCAGAGCCGAGCACAGGG + Intergenic
1122234753 14:100325305-100325327 GGGAGGCACAGCCTGGGCAAAGG - Intronic
1123436547 15:20258709-20258731 GGGAGGAACGGCAGAGCACACGG + Intergenic
1125061793 15:35435011-35435033 GGGAGGCTCAGGTGGGCAAATGG - Intronic
1126459793 15:48902797-48902819 GGGAAGCAGGGCCTGGCAGAGGG - Intronic
1128724992 15:69981925-69981947 GGGAGGCACAGCAGGGCAAAGGG - Intergenic
1132640872 16:977708-977730 GGGAGGGACGGAGGGGCACAGGG + Intronic
1133075606 16:3278535-3278557 GGGAGGCATGGCAGGACACAGGG - Intronic
1135723200 16:24834274-24834296 GGGAGGCAGGACAGGGCAGAGGG + Intergenic
1139328086 16:66167315-66167337 GGGAGGCATGGCCAGCCAAAAGG + Intergenic
1139593163 16:67944186-67944208 GGGAGGGACGGCCTGGCCAGTGG + Exonic
1141812126 16:86382779-86382801 GGGACGCAGGGCCAGGCAGAGGG - Intergenic
1143277269 17:5721414-5721436 CGGGGTCGCGGCCGGGCAAAGGG + Intergenic
1143655507 17:8291315-8291337 GGGAGGTACTGCCTGGGAAATGG - Exonic
1144663133 17:17084399-17084421 AGGAGCCCCGGCCGGGCACATGG - Intronic
1145206499 17:20987165-20987187 GGGAGGCAGGGAGGGGCCAAAGG + Intergenic
1145418091 17:22741185-22741207 CGGGGTCACGGCCGGGCAGAGGG - Intergenic
1146456531 17:33013765-33013787 GGGACGCACGGCGGGGCCCAAGG + Exonic
1148206403 17:45783038-45783060 GGTGGGCACGGCAGGGCACAGGG + Intergenic
1149589674 17:57819122-57819144 GGGAGGCAGGACGGGGCAGAGGG - Intergenic
1150100185 17:62416601-62416623 GGGAGGCTCAGCCAGGAAAATGG - Intergenic
1151897048 17:76987467-76987489 GGGAGCCAGGGCTGGGGAAAAGG + Intergenic
1152357270 17:79813330-79813352 GGGACGCTCGGCCGGGCGCAGGG - Intergenic
1153411630 18:4799782-4799804 GGGGAGCATGGCAGGGCAAAAGG + Intergenic
1153854722 18:9135373-9135395 GGGAGGCTCAGGCGGGCAGATGG - Intergenic
1155394867 18:25376751-25376773 GGGGGGCATGGCAGGCCAAAAGG - Intergenic
1156549772 18:38003619-38003641 TGGAGGCATGGCAGGCCAAAAGG - Intergenic
1157713567 18:49866664-49866686 GGGAGGCAGGGCCGGGGAATGGG - Intronic
1157906811 18:51576565-51576587 GGAAGGCACAGCAAGGCAAAGGG + Intergenic
1158649305 18:59272562-59272584 GGGAGGCACGGCCGAGCCCAGGG - Exonic
1161256866 19:3314667-3314689 GGGAGGCAGGTCCGGGCACCCGG - Intergenic
1161683362 19:5691491-5691513 GGGAGTCAGGGCCGGGCTGACGG + Intronic
1163316219 19:16542284-16542306 GGGAGGCGGGGCCGGCCAATAGG + Intronic
1164649715 19:29882959-29882981 GGGCGGCACAGCGGGGCAGAGGG - Intergenic
1166107666 19:40605378-40605400 GGGAGGCACGGCCGGGCAAACGG - Intronic
1166740107 19:45109436-45109458 TGGAGGCCCGGCCTGGGAAAAGG + Intronic
1167646882 19:50710785-50710807 TGGCGGCACGGCAGGGCACAGGG - Intronic
1168097819 19:54125594-54125616 GGGAGGCCAGGCAGGGCACAGGG - Intronic
925018255 2:547769-547791 GGGAGGAACAGCTGGGCACAGGG + Intergenic
925018264 2:547826-547848 GGGAGGAACAGCCGGGCACAGGG + Intergenic
925605835 2:5658720-5658742 GGGAGGCTGGGGCGGGAAAATGG + Intergenic
926394022 2:12423310-12423332 AGGAGGCATGGCTGGCCAAAAGG - Intergenic
926705203 2:15832562-15832584 GGGAGGAACTGCTGGGCATAGGG - Intergenic
926932020 2:18050260-18050282 GGGTGGCACGCCTCGGCAAATGG - Intronic
927972525 2:27314884-27314906 GGCAGGGCCGGCCGGGCAGAGGG - Intronic
929795573 2:45055997-45056019 GGGAGGCAGGGGCAGGCAGAGGG + Intergenic
929966813 2:46542757-46542779 GGGAGGCCGGGCCGGGGAGAGGG + Exonic
932457208 2:71857428-71857450 GGGAGGCTCGGCCAGGCATGGGG + Intergenic
935301308 2:101696608-101696630 GGGAGGCAGGGCCAGGCAATTGG + Intergenic
936348993 2:111698327-111698349 GGGCAGCAGGGCCGGGAAAATGG + Intergenic
937166580 2:119824285-119824307 GGGAGGCAGGGCGGTGGAAAGGG + Intronic
937223003 2:120352961-120352983 GGGAGGCAGGGCTGGGCTGAGGG - Intergenic
937305478 2:120867897-120867919 TGGAGGCACTGCCGAGAAAATGG + Intronic
938035101 2:128028421-128028443 GGGAGGCGCGGCGCGGGAAAGGG + Intergenic
939419455 2:141947190-141947212 GGGAGGCTGAGGCGGGCAAATGG + Intronic
943943292 2:194026250-194026272 GGCAGGAACGGCCAAGCAAACGG + Intergenic
944933711 2:204545785-204545807 GGGAGGGGCGGCCGCGGAAAGGG - Intronic
945377521 2:209096772-209096794 GTGAGGCATGGCAGGCCAAAAGG - Intergenic
946313281 2:218894656-218894678 AGGAGGCGCGGCTGGGAAAAGGG + Intronic
946386800 2:219388348-219388370 GGGCGGCACGGCCTGACAAGGGG - Intronic
946730795 2:222707426-222707448 GGGAGGCAAGGAAGGGGAAAGGG + Intronic
947751972 2:232537702-232537724 TGGAGGCAGGGCTGGGCAGATGG - Intergenic
948023156 2:234753938-234753960 GGGAGCCACAGCCAGGCAACAGG + Intergenic
1169084972 20:2820933-2820955 GGGAGGGACAGCCGGCCACAAGG + Intergenic
1170785203 20:19461770-19461792 GGGAGGCAGAGGCGGGCAGATGG - Intronic
1171211602 20:23321235-23321257 GGGGGGCACAGCAGGCCAAAAGG + Intergenic
1171408939 20:24933375-24933397 GGGTGGCACGGCAGGGCCACTGG + Intergenic
1171499063 20:25579172-25579194 GGGAGGCACAGCAGGGGACATGG + Intronic
1171982817 20:31639170-31639192 GGGTGGCATGGAAGGGCAAAGGG - Intronic
1172099562 20:32476996-32477018 GGCAGGCATGGGCGGGCACACGG + Intronic
1173401590 20:42730907-42730929 GGGAGGCTGGGCTGGGCAGAGGG - Intronic
1174021788 20:47536090-47536112 GGGGGGCATGGCAGGCCAAAAGG + Intronic
1174388908 20:50205094-50205116 AGGAGGAACGGCCCGGCATAGGG - Intergenic
1175464233 20:59179168-59179190 GTGAGGCACGGTCGGGCAGTGGG - Intergenic
1175730604 20:61351152-61351174 GGGAGGCAGAGCCCTGCAAATGG - Intronic
1175787089 20:61718510-61718532 GGGAAGCACGGCCTGGGATATGG - Exonic
1175910351 20:62402397-62402419 AGGAGGCCCGGCCGGGCAAAGGG + Intronic
1180056135 21:45360089-45360111 GGGCGGCAGGGCCGGGGAAGGGG - Intergenic
1180190923 21:46162072-46162094 GGGAGGGAAGGCCGGGGACAAGG + Intronic
1180945129 22:19688518-19688540 GGCAGGCACGGCCGGGCCACGGG - Intergenic
1181032592 22:20155491-20155513 GGGAGGCGCTGCCTGGCAACGGG - Intergenic
1181415601 22:22756542-22756564 GGGAGGCAACACCGGGCACAAGG - Intronic
1182891959 22:33826626-33826648 GGGAGGCAAGGCCGGGTTGATGG - Intronic
1184112107 22:42401523-42401545 GGGAGGCTGGGCCGGGGCAAGGG + Intronic
1185277404 22:49955765-49955787 GGAAGGCACTGCAGGGCCAAAGG + Intergenic
950549013 3:13655271-13655293 GCGAGGCTCGGCCGGCCAAGGGG + Intergenic
950742548 3:15062357-15062379 GGGCGGCCTGGCCGGGCAGAGGG - Intronic
953909113 3:46882991-46883013 GGGAGTCAGGGCCGGGCAGGGGG - Intronic
953924471 3:46975416-46975438 GGGAGGCCCAGGCGGGCAGATGG - Intronic
954385600 3:50242279-50242301 GGGAGGCAGGACCGGGCAGATGG + Intronic
954798249 3:53172372-53172394 GGCAGTCACGGCAGGGCAAGGGG - Intronic
955720743 3:61878250-61878272 GGAAGGCACAGCAGGGCAAATGG - Intronic
958575424 3:95944243-95944265 GGGAGGCTGGGGAGGGCAAAGGG - Intergenic
962867614 3:139460692-139460714 GGGGGGCAGGGCAGGGCAGAGGG + Intronic
963041044 3:141070151-141070173 TGGAGCCAAGGCCAGGCAAATGG + Intronic
963231213 3:142910418-142910440 GGGAAGCAGGGCCAGGCAGAGGG - Intergenic
963277768 3:143349941-143349963 GCGAGGCAAGGCTGGGCAAGTGG + Intronic
963462620 3:145636547-145636569 GGGAAGCACGACTGGGCAGAGGG - Intergenic
963664718 3:148168078-148168100 GGGAAGCACAGACAGGCAAAAGG + Intergenic
963762166 3:149295045-149295067 GGGAGCCATGGCGGGCCAAAAGG - Intergenic
964392093 3:156208328-156208350 GGGAAGCATGGCCGTGAAAAAGG - Intronic
965806633 3:172548889-172548911 GTGGGGCACGGAGGGGCAAAGGG - Intergenic
968076165 3:195817029-195817051 AGGAGGCCGGGCCGGGCAGAAGG - Intergenic
968701316 4:2059445-2059467 GGCGGGCACGGCCGGGCCCAGGG - Intergenic
970720880 4:18987418-18987440 AGGGGGCATGGCCGGCCAAAAGG - Intergenic
971742717 4:30540368-30540390 GGGAGGCGTGGCAGGCCAAAAGG + Intergenic
972406468 4:38751376-38751398 GGGGGGCATGGCGGGCCAAAAGG - Intergenic
977607266 4:98995680-98995702 GGGAGGAACTGCCGGGCGGAGGG - Exonic
982624651 4:157751107-157751129 GAGAGGCAGAGGCGGGCAAATGG + Intergenic
984523765 4:180831696-180831718 GGGAAGGACGGAAGGGCAAAAGG + Intergenic
985575231 5:670722-670744 GGGAGGCAGGGGCGGCCAACAGG - Intronic
987327615 5:16826581-16826603 GGGAGGAAGGAGCGGGCAAAGGG + Intronic
988949224 5:36241285-36241307 GAGAGGCAGGGCCGGGGAGAGGG - Intronic
989498523 5:42138266-42138288 GGGGGGCATGGCAGGCCAAAAGG + Intergenic
989505106 5:42217732-42217754 GGGGGGCATGGCAGGCCAAAAGG + Intergenic
989592176 5:43121675-43121697 GGGAGCCCCGGCCGGGCAGAAGG + Exonic
989983426 5:50667958-50667980 GGGAGGCCTGGCCGGGCAGAAGG - Intronic
991769217 5:70025320-70025342 GGGAGGCGCAGCCGGGCGGAGGG + Exonic
991848512 5:70900738-70900760 GGGAGGCGCAGCCGGGCGGAGGG + Exonic
992024073 5:72653687-72653709 GGGAGGCCCTGCAGGGCAGAAGG + Intergenic
996328139 5:122299310-122299332 GGGAGGCCAAGGCGGGCAAATGG + Intergenic
997418930 5:133750734-133750756 GGGATCCACTGCCGGGCACAGGG + Intergenic
998122736 5:139592290-139592312 GGAAAGCACGGGAGGGCAAAGGG - Intronic
1001691875 5:173639219-173639241 AGGGGGCAAGGCCGGGCAGAGGG + Intergenic
1002601106 5:180354191-180354213 GGGAGGGACGGCCGGGAACCAGG - Intergenic
1003240693 6:4343370-4343392 GGGAGGCAGGGGAGGGAAAACGG + Intergenic
1004324783 6:14664855-14664877 GGGAGGGAGGGGCTGGCAAAAGG + Intergenic
1004422033 6:15479138-15479160 GGGAGGAACAGCTGGACAAATGG - Intronic
1006097126 6:31662875-31662897 GGGAGGCAGAGGCGGGCAGATGG + Intronic
1006143073 6:31942700-31942722 CAGAGGCACAGCTGGGCAAAGGG + Intronic
1006837309 6:37006801-37006823 GGGAAGCAGGGCCGGGCAGGGGG + Intronic
1007738595 6:43997619-43997641 GAGAGGCATGGCAGGGCATAGGG - Intergenic
1007932003 6:45700127-45700149 GGCAGGCATGGCAGGCCAAAAGG - Intergenic
1011598971 6:89042342-89042364 GAGGGGCAAGGCAGGGCAAAGGG + Intergenic
1012355481 6:98308799-98308821 GGGAGGCAAGGACAGACAAAGGG - Intergenic
1019146147 6:169976738-169976760 GGAAGGACCGGCCGGGCACAGGG + Intergenic
1019475427 7:1241838-1241860 GGGAGTCACGGCTGGGCGAGGGG - Intergenic
1023083642 7:36548472-36548494 TAGAAGCACGGCCGGGCACAGGG - Intronic
1026023470 7:66728056-66728078 CGGAGGCAGGGCCAGGCAGAGGG - Intronic
1026888268 7:73967247-73967269 CGGAGGCAGGGCCAGGCAGAGGG - Intergenic
1028530435 7:91832251-91832273 GGCAGGCATGGCAGGCCAAAAGG + Intronic
1029599031 7:101553202-101553224 GGCAGGCAGGGCCTGGGAAACGG - Intronic
1029926668 7:104326523-104326545 GGGACGCATGGCCTGCCAAATGG + Intergenic
1031276052 7:119724714-119724736 GGGAGGCATGGCAAGCCAAAAGG + Intergenic
1033527733 7:142232832-142232854 GGGGGGCATGGCGGGCCAAAAGG + Intergenic
1033564717 7:142567370-142567392 GGGAGGCGTGGCGGGCCAAAAGG - Intergenic
1034034079 7:147801853-147801875 GGGGGGGGCGGCCGGGCAGAGGG + Intronic
1035889229 8:3325582-3325604 GGGAGGCCGAGGCGGGCAAATGG + Intronic
1037606579 8:20442820-20442842 GGGAGGCACAGCAGGTCACATGG + Intergenic
1037624149 8:20593002-20593024 AGAAGGCACGGCTGGCCAAAAGG + Intergenic
1040906247 8:52472372-52472394 GGGAAGCACGCCAGGGCAACTGG - Intergenic
1045065496 8:98440161-98440183 GAGAGGCACAGACGGACAAAAGG + Intronic
1047273414 8:123384549-123384571 GGGAGGCACTGCACTGCAAAGGG - Intronic
1047770839 8:128028510-128028532 GAGAGGCAGGACTGGGCAAAGGG + Intergenic
1053139879 9:35675842-35675864 GGGGCGCAGGGCCGGGCAGAAGG - Exonic
1056376960 9:86024245-86024267 AGGAGGCACTGCTGGGAAAAGGG + Intergenic
1057706939 9:97401429-97401451 AGCAGGCAAGGCAGGGCAAAGGG + Intergenic
1057930027 9:99185154-99185176 GGGAGGCAGGGCAGGGGAGAGGG + Intergenic
1058012911 9:99998341-99998363 GGGAGGAACTGCAAGGCAAAAGG - Intronic
1058065139 9:100540484-100540506 GGGAGGCACGGGTGGGCACTTGG - Intronic
1059176860 9:112175597-112175619 GGGAGGCACCCCCGGGGAGAGGG + Intergenic
1062083852 9:134638486-134638508 GTGAGCCACGGCCTGGCAGAGGG - Intergenic
1062315799 9:135966514-135966536 GGGAGGCAGCGTCGGGCAGAGGG - Intergenic
1185719341 X:2369929-2369951 GGGAGTCCGGGCCGGGCACAGGG - Intronic
1187236673 X:17474524-17474546 GGGAAGCAGGGCTGGGCATAGGG + Intronic
1188498714 X:30803739-30803761 GGAAGGCAAGGCAGGGCACAAGG - Intergenic
1189415134 X:40806168-40806190 GGGGGGCATGGCAGGCCAAAAGG + Intergenic
1190310988 X:49116959-49116981 GGGTGGCAGGGCCTGGCTAATGG - Intronic
1192185724 X:68945642-68945664 GCTAGGCACTGCTGGGCAAAGGG - Intergenic
1192558677 X:72110532-72110554 GGGGGTCACGGCAGGGGAAAGGG - Intergenic
1194340484 X:92699834-92699856 GAGAGGCACGGGCGGGAAACTGG - Intergenic
1200032397 X:153307015-153307037 GGGAGGCCCCTCCGGGAAAACGG + Intergenic
1200100073 X:153685873-153685895 GGGAGGCAGGGCCTGGCCCAGGG + Intronic
1200172122 X:154084561-154084583 GGGAGGTACAGACAGGCAAATGG - Intronic
1200648840 Y:5816570-5816592 GAGAGGCACGGGCGGGAAACTGG - Intergenic
1201300697 Y:12502330-12502352 GGGAGGCATGGTGGGTCAAAAGG - Intergenic